ID: 998970575

View in Genome Browser
Species Human (GRCh38)
Location 5:147586966-147586988
Sequence TTCCATTTCAGAATGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 230}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998970575_998970582 11 Left 998970575 5:147586966-147586988 CCCTGCCCCATTCTGAAATGGAA 0: 1
1: 0
2: 0
3: 22
4: 230
Right 998970582 5:147587000-147587022 GGCACTTGAAGAGGCCTTACAGG 0: 1
1: 0
2: 0
3: 7
4: 98
998970575_998970581 2 Left 998970575 5:147586966-147586988 CCCTGCCCCATTCTGAAATGGAA 0: 1
1: 0
2: 0
3: 22
4: 230
Right 998970581 5:147586991-147587013 ATAGAATTTGGCACTTGAAGAGG 0: 1
1: 0
2: 3
3: 21
4: 229
998970575_998970580 -10 Left 998970575 5:147586966-147586988 CCCTGCCCCATTCTGAAATGGAA 0: 1
1: 0
2: 0
3: 22
4: 230
Right 998970580 5:147586979-147587001 TGAAATGGAATAATAGAATTTGG 0: 1
1: 0
2: 2
3: 68
4: 628
998970575_998970583 12 Left 998970575 5:147586966-147586988 CCCTGCCCCATTCTGAAATGGAA 0: 1
1: 0
2: 0
3: 22
4: 230
Right 998970583 5:147587001-147587023 GCACTTGAAGAGGCCTTACAGGG 0: 1
1: 0
2: 1
3: 6
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998970575 Original CRISPR TTCCATTTCAGAATGGGGCA GGG (reversed) Intronic
905357738 1:37396515-37396537 TTCCATGACTGAAAGGGGCAGGG - Intergenic
907913537 1:58848020-58848042 TACAATCTCAGTATGGGGCAAGG - Intergenic
909950645 1:81716014-81716036 TTTCATATGAAAATGGGGCAAGG + Intronic
911288806 1:96029329-96029351 TGCCAACTCAGAAGGGGGCAGGG + Intergenic
916330167 1:163606851-163606873 TGCCATTACAGAATGGGCGATGG - Intergenic
918194105 1:182205997-182206019 TTGCCTTTCAAACTGGGGCAGGG - Intergenic
919824270 1:201492662-201492684 CTCTATTTCTGAGTGGGGCAAGG - Intronic
920162571 1:204010625-204010647 TTCCATATGAGATTTGGGCAGGG - Intergenic
921669154 1:217907222-217907244 TTCCAGTTCAGATTGGCCCAAGG + Intergenic
922926584 1:229351982-229352004 TTCCAGTTCAGATTTGCGCATGG + Intergenic
923667931 1:236015126-236015148 CTGCAGGTCAGAATGGGGCAAGG - Intronic
924379338 1:243447277-243447299 TGCCTTTTAAGAATGAGGCATGG - Intronic
1063867314 10:10379880-10379902 TTAGATTTTAGACTGGGGCAGGG - Intergenic
1065480036 10:26183721-26183743 GTGCAGTTCAGAATGGGGCTGGG + Intronic
1066079246 10:31913334-31913356 TTCTCTTTCATAATGGGCCAGGG - Intronic
1067167458 10:43877132-43877154 TTCCATTTCAGTTTGTGGGAGGG - Intergenic
1071288689 10:84172637-84172659 TTCCCTTTAATAATGGTGCATGG - Intergenic
1072226131 10:93370843-93370865 TCCAATTTGAGTATGGGGCAAGG + Intronic
1072774229 10:98173409-98173431 TTTCACTTCAGACTGGGGGAGGG + Intronic
1075015545 10:118907776-118907798 CTCCCTTTCATAATGGGGGAGGG + Intergenic
1075392186 10:122100344-122100366 TTCCTTCTCAGAAAGGAGCAGGG - Intronic
1075813250 10:125244313-125244335 TGCCATTTCAGACTTGGGAATGG - Intergenic
1076195735 10:128516553-128516575 GTGCATTTCAGGATGGGCCATGG - Intergenic
1080208429 11:29756884-29756906 TGCCAACTCAGAAAGGGGCAGGG + Intergenic
1081637403 11:44729632-44729654 TACCATTTCAGACTGGGGTTGGG - Intronic
1081775049 11:45670953-45670975 ATCCAGCTCAGAATGTGGCAAGG + Intergenic
1081983707 11:47286516-47286538 TTACCTTTCAGACTGGGGAAGGG - Exonic
1085292869 11:75412491-75412513 TTCCATTTCAAAATAGGGTTTGG + Intronic
1085545674 11:77315907-77315929 TTCCATTTCAGAATTGAGTAAGG + Intergenic
1087339051 11:96878842-96878864 TGCCAGTTCAGAAGGGTGCAGGG + Intergenic
1087495010 11:98880261-98880283 TTCCATCTCACAGTGGGACAAGG - Intergenic
1087642572 11:100771243-100771265 TTCTGTTTCAGAAAGGAGCATGG - Intronic
1089001867 11:115058802-115058824 TCACATTGCAGAAGGGGGCAAGG - Intergenic
1089323798 11:117643896-117643918 TTCTGTCTGAGAATGGGGCATGG - Intronic
1090164510 11:124533494-124533516 TTCCATGTCAGAAGGTGGCCAGG + Intergenic
1090233480 11:125127581-125127603 TGCCATCTCAGAAAGGGACACGG + Intergenic
1090399208 11:126438053-126438075 TTCCATCCCAGAAAGGGGCCTGG + Intronic
1090444714 11:126753961-126753983 TTCCTTTTCAGACTGGGACTGGG + Intronic
1091815457 12:3434571-3434593 TTCCCTCTCACAATGGGACATGG + Intronic
1095336119 12:41028389-41028411 TTCCATTTCAAAATGTATCATGG - Intronic
1097219467 12:57439233-57439255 TTCCTGTTCAAAATGGGGTATGG + Intronic
1097291275 12:57917609-57917631 TTCCAATACAGAATGGGGAAAGG + Intergenic
1097530917 12:60798876-60798898 TTCCTTCTTACAATGGGGCAAGG + Intergenic
1099380697 12:81949052-81949074 TTCCATTTCAGAGTTGAGGATGG + Intergenic
1101679276 12:106949026-106949048 TTCCATTTCACCTTGGAGCAAGG - Intergenic
1102553795 12:113712476-113712498 TTCAACTTGAGAATGGGGCCTGG + Intergenic
1103266800 12:119637408-119637430 TCCCAGTACAGAATGGGTCAAGG - Intronic
1105318565 13:19292811-19292833 CTCCAGTTGAGAATGGAGCATGG + Intergenic
1105771432 13:23616109-23616131 TTCCAGTTTAGAATGGAACAAGG - Intronic
1106862818 13:33928997-33929019 GTCCATTTTAGAATGGGCAAAGG - Intronic
1107088173 13:36448043-36448065 TTCCATTGCAGACTGAAGCAAGG - Intergenic
1108615708 13:52129555-52129577 TGCAAATCCAGAATGGGGCAGGG - Intergenic
1108726128 13:53183454-53183476 TTCCCTTTCAGAATGTGACAGGG + Intergenic
1110078934 13:71286717-71286739 TTCTATTTGAGAATAGGACAGGG - Intergenic
1110342814 13:74413395-74413417 TGCCAATTCAGAAGGGGGCAGGG - Intergenic
1110709284 13:78632289-78632311 TTCCACATCAGAATTTGGCAGGG - Intronic
1111382934 13:87482747-87482769 AAACATTTCAGAATGGGGAAGGG + Intergenic
1113800603 13:113084477-113084499 TTGCACTTCACAATGGGGCTAGG + Intronic
1114897907 14:27015228-27015250 TTCTATTGCAACATGGGGCAAGG + Intergenic
1116514541 14:45789101-45789123 TGCCATTTTACAATGGCGCACGG + Intergenic
1120558410 14:85958975-85958997 TTTCATTTCCAAATGGGGAAGGG + Intergenic
1121323470 14:93006396-93006418 CTCCATTTCAGATTGGGGGAAGG + Intronic
1122162083 14:99792287-99792309 TACCATTTCAGATTTTGGCATGG + Intronic
1124346286 15:28923636-28923658 TTCCATATGAGAAGAGGGCAGGG - Intronic
1126245378 15:46498881-46498903 TTCCATCTCAGATTGGGGGATGG - Intergenic
1129294933 15:74594993-74595015 TTCCCTCTCAGAATGAGGAAGGG + Intronic
1129561451 15:76575214-76575236 TTCCATTTCTGAACCTGGCAGGG + Intronic
1129764244 15:78151278-78151300 TTCCATTTCAGGTTGTGGCCAGG + Intronic
1130406648 15:83608859-83608881 TCCCATTCCTGACTGGGGCATGG + Intronic
1130787565 15:87117017-87117039 TTTCATTTCAGCCTGGGCCACGG + Intergenic
1133027440 16:2994929-2994951 TTCCAGTACAGAATTGGGCTGGG + Intergenic
1137068880 16:35880876-35880898 TTCTATTTAAAAATGGGGGATGG - Intergenic
1138115544 16:54357849-54357871 TAACATCTCAGAATGGGGCTTGG - Intergenic
1138170493 16:54844759-54844781 TTGCATTTAAGAAATGGGCAGGG + Intergenic
1139486666 16:67260866-67260888 TCCCATTTTAGAAAGGTGCAAGG - Intronic
1140103371 16:71938032-71938054 CTCCAACTCAGAAGGGGGCAGGG - Intronic
1140924995 16:79573988-79574010 ATCCTTTCCAGAATGCGGCACGG - Intergenic
1141166715 16:81665730-81665752 TTCCATTCCTGACTGGGGAAGGG - Intronic
1141851429 16:86649007-86649029 CTCCACCTCAGAGTGGGGCATGG - Intergenic
1141956664 16:87376568-87376590 TGCCATTTAATAATGGGGCCAGG - Intronic
1142912539 17:3107594-3107616 TTACATGTCAGAAGGGGACAAGG - Intergenic
1143550713 17:7628752-7628774 TTGCATTTTAAAATGGGTCATGG + Intronic
1148007876 17:44448947-44448969 TTGCATTAAAAAATGGGGCAAGG + Intronic
1149952495 17:61004792-61004814 TACTATTTCAGAATGGACCAAGG + Intronic
1153517602 18:5918704-5918726 TCCCATTCCAGATTGAGGCAGGG - Intergenic
1153978113 18:10287203-10287225 CCCCATTTCAGAATGGGGTCTGG - Intergenic
1156004862 18:32428330-32428352 TTCAATGTGAGACTGGGGCAAGG - Intronic
1156471861 18:37382169-37382191 TTCCACTTCACTATGAGGCAGGG + Intronic
1156999269 18:43504738-43504760 TTCCATTCAATAATGGGCCAAGG - Intergenic
1157838446 18:50930982-50931004 TTCCATTTCAAAATGATACAAGG - Intronic
1158736404 18:60086926-60086948 TCCCATGACAGCATGGGGCAAGG - Intergenic
1161203897 19:3030248-3030270 TTCCAGTTCTGAGTGGGACACGG - Intronic
1164289511 19:23854505-23854527 TTCCATTTGATATTGGGGCCTGG + Intergenic
925837911 2:7963910-7963932 TTCCACTTGAGATTTGGGCAAGG + Intergenic
925927472 2:8680576-8680598 TTGCATTTCAGAAAGCGGAAGGG - Intronic
926958929 2:18332652-18332674 TTCCATCTCCGAGTGGGGCTGGG - Intronic
927815700 2:26215276-26215298 TTCCATTTCAGACTGGAGACTGG + Intronic
929929716 2:46243779-46243801 TTACATTTCATGGTGGGGCATGG + Intergenic
930092069 2:47538200-47538222 TTACATTTCAGTATGGGAGATGG + Intronic
930664524 2:54088782-54088804 TTTCATTTCAGATTGGGGAAAGG + Intronic
930893628 2:56420915-56420937 TTCCATTTAAAAATGGGCAAAGG - Intergenic
931282291 2:60804794-60804816 TTCCAATTCAGAAGTGGGCAGGG + Intergenic
934602094 2:95665497-95665519 TTCCATCCCAGAGTGGGGCCCGG + Intergenic
935300844 2:101692808-101692830 TTCAACCTCAAAATGGGGCAGGG - Intergenic
936479959 2:112877050-112877072 TTCCAAATGACAATGGGGCATGG + Intergenic
936535450 2:113307652-113307674 TTCCATCCCAGAGTGGGGCCCGG + Intergenic
937232304 2:120405328-120405350 TTACATATCAGCATGGGGCGTGG + Intergenic
940250104 2:151665560-151665582 TTTCATTTCAGAAAGAGTCAGGG + Intronic
945660882 2:212683845-212683867 GTCTATTTCAGATTGGGGAAAGG + Intergenic
947019781 2:225662361-225662383 TTTCTTTTCAGAATGTGGAAAGG - Intergenic
1170133016 20:13043196-13043218 TTCCATTTCAGAAAGGAACATGG + Intronic
1170614746 20:17939502-17939524 TTGCTTTTCAGAGTGGGGGAGGG + Intergenic
1170864324 20:20139655-20139677 CTGCATTTCAGAACTGGGCAAGG - Intronic
1170881715 20:20302707-20302729 TTCAAATTAAGAATGGGGCAAGG - Intronic
1171283298 20:23918920-23918942 TATCATTTCAGAGTGGGGCAAGG + Intergenic
1173182668 20:40816442-40816464 CTGCATATCTGAATGGGGCATGG + Intergenic
1173364940 20:42376589-42376611 TTCCCTTTCAGAAGGGGCCATGG - Intronic
1173485291 20:43436662-43436684 TTCCATCCCATACTGGGGCAAGG - Intergenic
1176026307 20:62987251-62987273 TTCCATTTTCTACTGGGGCAAGG + Intergenic
1176368984 21:6051280-6051302 TTCCATTTAAGAGTGAGGTATGG - Intergenic
1177357942 21:20032232-20032254 TGCCAATTCAGAAGCGGGCAGGG + Intergenic
1179754535 21:43487261-43487283 TTCCATTTAAGAGTGAGGTATGG + Intergenic
1181891901 22:26070531-26070553 ATCCATTCCAGAATGAGGGAGGG - Intergenic
1182311428 22:29411395-29411417 TACCTATTCAGAATGGAGCAGGG - Intronic
1182505626 22:30780263-30780285 TTTCCTCTCAGAATGTGGCACGG + Intronic
1182689554 22:32148894-32148916 TACCTATTCAGAATGGAGCAGGG + Intergenic
1183725556 22:39587271-39587293 ATCCTTTTCAGGAGGGGGCAAGG - Intronic
1184088662 22:42281153-42281175 TTCCAGCTCAGAATGTGGCCTGG + Intronic
1184616238 22:45640376-45640398 TTCCTTTTCAGAATGGGTGGGGG + Intergenic
949462983 3:4313894-4313916 TTCTATTACAGAAAGGGGAAAGG - Intronic
950873650 3:16250724-16250746 TTCTATTCTAGAATGTGGCATGG - Intergenic
952063819 3:29542660-29542682 TTCCATTTAAAAATTGGGGATGG - Intronic
953899517 3:46831839-46831861 TGCCATCTGAGAATGGGGAAAGG + Intronic
954112417 3:48441929-48441951 TTCCTTTTCAGAATGGTGTAAGG + Intronic
956060403 3:65342901-65342923 TTCCTTTTCTGAAAAGGGCAGGG + Intergenic
959276417 3:104282557-104282579 TTGCATTGCAGAATAGGCCAAGG - Intergenic
961017903 3:123481713-123481735 TTCCCTGTCACAGTGGGGCAGGG + Intergenic
961154315 3:124666017-124666039 TTCCTTTGCAGTATGGGCCAAGG - Intronic
963002331 3:140694084-140694106 TTCCATTTGAGCATGGTGCAGGG - Intronic
964808362 3:160636401-160636423 TTCCATTTTACAGTGGGGAAAGG - Intergenic
964848140 3:161065994-161066016 TTCCATGTCACACTGTGGCAAGG + Intronic
966483587 3:180442064-180442086 TTCCACTTAAGAATGGAGCAAGG + Intergenic
967340172 3:188388584-188388606 TTCCTTTTCGGAATGTAGCAAGG - Intronic
967589314 3:191254111-191254133 TCCCATTCCAGAAGGTGGCATGG + Intronic
967637448 3:191819903-191819925 CTCCTTTTCACAATGGGTCAAGG - Intergenic
968081045 3:195847274-195847296 TTCCATTTCGGAGTGTGGCCTGG + Intergenic
970177543 4:13354648-13354670 TTCCATTTAAGGATGAGGTAGGG + Intergenic
970567073 4:17341927-17341949 TTCCATGTGAGATTTGGGCAGGG - Intergenic
973123320 4:46551346-46551368 TTCCATTTTAGAAGTGTGCAAGG + Intergenic
974179071 4:58360952-58360974 CTCCAACTCAGAAGGGGGCAAGG + Intergenic
974988991 4:69061895-69061917 TACCTTTTCAGGATGGGTCATGG + Intronic
975000458 4:69219266-69219288 CTCCATTAAAAAATGGGGCAGGG - Intergenic
975005310 4:69275936-69275958 CTCCATTAAAAAATGGGGCAGGG + Intergenic
975013730 4:69384925-69384947 CTCCATTAAAAAATGGGGCAGGG + Intronic
975014989 4:69404276-69404298 CTCCATTAAAAAATGGGGCAGGG + Intronic
976804868 4:89035588-89035610 TTCCACATGAGATTGGGGCAGGG - Intronic
980270782 4:130581335-130581357 TTCCTTTTTGGTATGGGGCATGG - Intergenic
982694307 4:158582143-158582165 TTACATTTCAGCATGGGGTTGGG + Intronic
983169814 4:164522758-164522780 TTCAATATGAGATTGGGGCAGGG - Intergenic
984945120 4:184964977-184964999 TTCCATTACAGATTGAGACAGGG - Intergenic
985028647 4:185766117-185766139 TTCTACTTCAGAATGAGGCGTGG + Intronic
985792044 5:1934181-1934203 AACCAAGTCAGAATGGGGCATGG + Intergenic
985851555 5:2392180-2392202 TTCCATTAGAGAATGGGGAATGG - Intergenic
986625373 5:9718965-9718987 GTTCAGTTCAGAATTGGGCATGG - Intergenic
987946345 5:24613911-24613933 ATTCATTTAAGAATGGGACAAGG + Intronic
988497039 5:31754262-31754284 TTCCATATCAGGATGGGGTGGGG - Intronic
989094809 5:37771987-37772009 TTGGATTTCAGAAGGGGGAAGGG - Intergenic
991469063 5:66948197-66948219 ATCCAATTCGGAATGTGGCACGG - Intronic
992146059 5:73849781-73849803 TTACATTTCAAAATGGGGGCAGG - Intronic
992410354 5:76499416-76499438 TTTTATTTCTGAATGGGGAAAGG - Intronic
992482905 5:77168795-77168817 TTCCATTTCAGAGTGGGAGGAGG - Intergenic
992994497 5:82319031-82319053 TTCCATTTGGGAAGGGGCCAGGG + Intronic
993816603 5:92556348-92556370 TTCAATATGAGATTGGGGCAGGG - Intergenic
997129718 5:131264332-131264354 TTCCATTTCAGGTTTGGGCGAGG + Intronic
998085308 5:139316839-139316861 TTAATTTTCAGAATGGGGCCGGG - Intronic
998591207 5:143480303-143480325 TTACATTGAAGAATGGGGTAGGG + Intergenic
998970575 5:147586966-147586988 TTCCATTTCAGAATGGGGCAGGG - Intronic
999852547 5:155558451-155558473 TTCAATTTAAGAATGGGCAAAGG - Intergenic
1001140013 5:169136705-169136727 TCCCATTGGAGAATGGGCCAGGG + Intronic
1001749211 5:174116030-174116052 TTTCATTTGTGTATGGGGCAGGG - Intronic
1003530329 6:6931479-6931501 TTCTATATCAGAGAGGGGCACGG - Intergenic
1004790054 6:19015492-19015514 TTCCATTTCAGAAAAGAGGAAGG - Intergenic
1005775383 6:29125713-29125735 TTAAAGTTCAGAATGGGGCCAGG + Intergenic
1005821914 6:29605772-29605794 TTCCATTTCAGAGTAGGTGAAGG - Intronic
1007026567 6:38581736-38581758 TTCCATTTCTCAATGGGGTGGGG + Intronic
1009401158 6:63257602-63257624 TTCTATTTCAGCATATGGCAAGG + Intergenic
1009534440 6:64861602-64861624 TGCCATCTCAGAAAAGGGCAGGG + Intronic
1010340466 6:74745538-74745560 TTAGTTTTCAGAATGAGGCAAGG - Intergenic
1011659455 6:89581722-89581744 TTCCATTTCGGAATGGAGGATGG - Intronic
1016396973 6:143634629-143634651 TTCCATTGGAGAATGAGGCTTGG + Intronic
1016828041 6:148406048-148406070 ACCGATTTCAGAATGGGGCAGGG + Intronic
1017998432 6:159555730-159555752 GTCCATTTCCTCATGGGGCATGG + Intergenic
1019595119 7:1854836-1854858 TCCCATTTCAAAAGGGGGAAAGG + Intronic
1020494102 7:8825182-8825204 TTACCTTTGAGAATGGGGGAAGG - Intergenic
1020507088 7:9004645-9004667 TTATATTTCAGAAAGTGGCAAGG - Intergenic
1022559772 7:31336349-31336371 GTCCTTTGCAGAATGGGGCGCGG + Intergenic
1023052345 7:36263935-36263957 CTTCATTTCAGGATGTGGCAGGG + Intronic
1023185482 7:37528804-37528826 TTCCATGGCAGAATGGGCCAGGG + Intergenic
1024242425 7:47445776-47445798 TTCCAGTTCAGTATGGGGCCTGG - Intronic
1024565810 7:50679638-50679660 TTCCATATGAAAATGGGGGAAGG - Intronic
1027535910 7:79401234-79401256 TTCCATTTGAGCATAGGCCATGG + Intronic
1028208287 7:88041856-88041878 TTGCATTTCAAAATGTGGCTTGG - Intronic
1031688163 7:124758198-124758220 CTCCATTTCTGAATGGTGTATGG - Intronic
1032718626 7:134532126-134532148 TTGCATTTCATAATTGGGAATGG + Intronic
1033969890 7:147025607-147025629 TTCCATATGAGATTTGGGCAGGG + Intronic
1034231035 7:149528748-149528770 TTCCATTTCACTAGGTGGCATGG - Intergenic
1034902006 7:154913810-154913832 TTCAAGTTCAGCAGGGGGCAAGG - Intergenic
1036988124 8:13559937-13559959 TTCAATTTCAGAATGGTTCTGGG - Intergenic
1037014271 8:13883073-13883095 GACCATTTCAGAATGAGGTATGG - Intergenic
1038162958 8:25057620-25057642 CTCCATTTAAAAATGGGCCAAGG - Intergenic
1038695945 8:29806232-29806254 CTCCATTTCTTAATGTGGCAGGG - Intergenic
1040672445 8:49708364-49708386 TTCAATTTAAGAATGGTGAATGG + Intergenic
1041013953 8:53572010-53572032 TTCCATATGAGATTTGGGCAGGG - Intergenic
1041248995 8:55916740-55916762 TGCCATTGCAGTATTGGGCATGG - Intronic
1041990172 8:63978726-63978748 TTGCATTTCTGTATGGGGTAGGG - Intergenic
1042469013 8:69161905-69161927 TTCCATTTCACAGTGGAGAATGG - Intergenic
1042674930 8:71309751-71309773 TCCCACTTCATAATGAGGCAGGG + Intronic
1042955908 8:74250486-74250508 TTCCTTTCCAGGAAGGGGCAGGG + Intronic
1043381371 8:79705767-79705789 TTCCATTTCAGAACTTGGGATGG - Intergenic
1044824803 8:96185675-96185697 TTCCACTTCAGGGTTGGGCATGG + Intergenic
1045875358 8:106975292-106975314 TTCCTTCTGAGTATGGGGCAGGG + Intergenic
1046311482 8:112442756-112442778 TTTCTTTTAAGAATGGGACACGG - Intronic
1046742605 8:117845122-117845144 ATCCATTTCAGCATAGGGAAGGG + Intronic
1046743904 8:117856670-117856692 TTCCATATCATAATAGCGCAAGG + Intronic
1049161855 8:141103036-141103058 TGCCTTTTCAGGAAGGGGCATGG - Intergenic
1049188418 8:141271603-141271625 CCCCATTTCAGAAGGGGCCAGGG + Intronic
1050005581 9:1126228-1126250 TTAAAGTTCAGAATGAGGCAAGG + Intergenic
1050043357 9:1518556-1518578 TTCCATTTCAGAATAGAACAGGG - Intergenic
1051734790 9:20187177-20187199 TTCCATTATAGAATGGTGCTAGG - Intergenic
1052026067 9:23574362-23574384 TTTCATTTAAGAATGAGGCAGGG + Intergenic
1052613312 9:30804125-30804147 TTCCATTTCAGAATTATGAAGGG - Intergenic
1057270313 9:93646703-93646725 TTCAATTTCAGCAGGGGGCTGGG + Intronic
1058613711 9:106803180-106803202 TTCAATTTTAGATTGGGCCAAGG + Intergenic
1060807080 9:126584580-126584602 TTCCAGTTCAGTGGGGGGCAAGG + Intergenic
1060943163 9:127555163-127555185 TTACATTACAGCATGGGGGATGG - Intronic
1062028237 9:134350362-134350384 TTCCTTTTCTGTAAGGGGCATGG + Intronic
1062280080 9:135747862-135747884 CTCCTCTTCAGCATGGGGCAAGG + Intronic
1186556879 X:10569116-10569138 TGCTATTTCAGAAGGGGTCAGGG - Intronic
1186686394 X:11929320-11929342 TACTTTTTCAGAATGGGGCTAGG + Intergenic
1187214410 X:17262580-17262602 TTCCATTTTTAAATGGAGCAAGG + Intergenic
1187808119 X:23143614-23143636 TTCTGTTTAATAATGGGGCAAGG + Intergenic
1189777023 X:44479571-44479593 TTGCATGTCACAATGTGGCATGG - Intergenic
1191705090 X:64085798-64085820 TTCCATATCACAATGGTGCCTGG + Intergenic
1192351467 X:70360116-70360138 TTCCAATTCACCCTGGGGCAGGG + Intronic
1193211560 X:78811732-78811754 TGTCATCTCAGAAAGGGGCAGGG + Intergenic
1195964850 X:110420628-110420650 ATCCTTTGCAGAATGAGGCAGGG + Intronic
1196254480 X:113500163-113500185 TGCCATTGCAGAATATGGCAAGG - Intergenic
1196500616 X:116377012-116377034 TACTACTTGAGAATGGGGCATGG - Intergenic
1196577827 X:117340692-117340714 TTCCATTACAAAATGGGCAAAGG + Intergenic
1199171920 X:144742933-144742955 TTGCCTTTCAGTTTGGGGCAGGG - Intergenic
1199895674 X:152125408-152125430 TTACATTTTTGTATGGGGCAAGG + Intergenic
1200037792 X:153344615-153344637 ATCTATTTTAGAATGAGGCAGGG - Intronic
1200639953 Y:5704337-5704359 TTCCACTTGAGATTTGGGCAGGG + Intronic