ID: 998975483

View in Genome Browser
Species Human (GRCh38)
Location 5:147641614-147641636
Sequence CTGATTCATCACATCTTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 221}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998975479_998975483 8 Left 998975479 5:147641583-147641605 CCCATGGTTTGCTGCAACAGTTC 0: 1
1: 0
2: 0
3: 3
4: 94
Right 998975483 5:147641614-147641636 CTGATTCATCACATCTTTGTAGG 0: 1
1: 0
2: 3
3: 17
4: 221
998975480_998975483 7 Left 998975480 5:147641584-147641606 CCATGGTTTGCTGCAACAGTTCT 0: 1
1: 0
2: 1
3: 17
4: 164
Right 998975483 5:147641614-147641636 CTGATTCATCACATCTTTGTAGG 0: 1
1: 0
2: 3
3: 17
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998975483 Original CRISPR CTGATTCATCACATCTTTGT AGG Intronic
902322238 1:15676042-15676064 CTGATTCAACACAATTATGTTGG - Intergenic
902959289 1:19950995-19951017 CTGATTCATTCGATCTGTGTTGG + Intergenic
904588194 1:31591870-31591892 CTGATGCCTCACATCTTCTTGGG + Intergenic
907714342 1:56913548-56913570 CTAATTGTTCACATCTTTCTGGG + Intronic
908628164 1:66070647-66070669 CTGCTTCCTAATATCTTTGTTGG - Intronic
909777371 1:79498676-79498698 TTCATTCATCCCATATTTGTAGG - Intergenic
910615757 1:89196806-89196828 CTCATTCATCACTTTTGTGTAGG - Intronic
911604432 1:99886843-99886865 CTGCTTCATCACAGATTTTTTGG - Intronic
912064867 1:105724933-105724955 CTTATTTATCACATTTTGGTTGG + Intergenic
913063993 1:115232836-115232858 CAGATTCATGACCTCTTTCTTGG + Intergenic
915775117 1:158474602-158474624 CTGATTCATAACATCTTTATTGG - Intergenic
916092359 1:161317454-161317476 CATATGCATTACATCTTTGTGGG + Intronic
916882718 1:169035660-169035682 CTGATTTATCTGATCTATGTTGG + Intergenic
917977029 1:180246395-180246417 TTGATTCATATCATATTTGTTGG - Intronic
918715432 1:187780296-187780318 CTCATTCATCACATTTTTAATGG + Intergenic
921313785 1:213871553-213871575 GGGTTTCTTCACATCTTTGTGGG - Intergenic
922050678 1:221987652-221987674 CTGGTTCATGACAGCTTTGAGGG + Intergenic
924012562 1:239681590-239681612 CTAATTTATAACATCTTTATTGG - Intronic
924304789 1:242676466-242676488 ATAATTCATCACTTCTTTATGGG + Intergenic
1063653957 10:7968392-7968414 TTAATTAATCACATCTTTATTGG - Intronic
1065392356 10:25195935-25195957 CTGATTTATTATACCTTTGTAGG + Intronic
1066589927 10:36983819-36983841 ATGATTCATAAAATATTTGTGGG + Intergenic
1067841264 10:49681183-49681205 CTGATTCAGCACCTCTGTCTAGG - Intronic
1068027000 10:51658482-51658504 GGGATTCATGACATGTTTGTTGG - Intronic
1068294128 10:55045481-55045503 CTGTTTCACAAGATCTTTGTGGG + Intronic
1069671190 10:70205569-70205591 CTTATTTATCTCAACTTTGTCGG + Intronic
1074993612 10:118735455-118735477 CTGATTCAGCAGGTCTGTGTTGG - Intronic
1075126480 10:119704096-119704118 CTGAAGCATCACATCATTGGGGG - Intergenic
1075873529 10:125788480-125788502 CTGATTCATAGCAGGTTTGTGGG + Intronic
1076916554 10:133425253-133425275 CTTATTCATCACATATTTGCAGG - Intergenic
1076936658 10:133570048-133570070 CTTATTCATCACATATTTGCAGG - Intergenic
1077847035 11:6036851-6036873 TTGACTTATCTCATCTTTGTGGG - Intergenic
1078461038 11:11515571-11515593 CTGACTCATCTCATCATTGTGGG - Intronic
1085077362 11:73603241-73603263 CTGAATGATCCCATCTTTGCTGG - Intergenic
1085898151 11:80664229-80664251 CTGATTCATAAAATATTTATGGG - Intergenic
1087174868 11:95087555-95087577 CTCAGTCATCTCATCCTTGTAGG - Intergenic
1087186307 11:95200925-95200947 CTGAATCATCAGTTCTTTGTAGG + Intronic
1088749756 11:112833826-112833848 CTGAGTCAATACATCTGTGTTGG + Intergenic
1090244245 11:125204346-125204368 CTGATTCAGCAGGTCTGTGTGGG + Intronic
1091767428 12:3130688-3130710 CTGACTCTGCACATCTCTGTGGG - Intronic
1091846039 12:3657012-3657034 CTGCTTCAGCACCTCTCTGTGGG - Intronic
1092055013 12:5501497-5501519 CTGATTCATCACGTCTGGGGTGG + Intronic
1092311153 12:7355245-7355267 CTAATTGATCAATTCTTTGTGGG - Intronic
1095860671 12:46914329-46914351 CTGTTTCTTCACATCCTTGCTGG - Intergenic
1097047426 12:56197621-56197643 CTGACTAAACACATCTATGTGGG + Intergenic
1097462620 12:59881064-59881086 CTGGTTGATCACATCTGTGATGG - Intergenic
1098104142 12:67051839-67051861 CCAAATCATCACATCTTTGCAGG + Intergenic
1100982749 12:100174688-100174710 CTGATTCATCACTTCTAGGGTGG - Intergenic
1101506238 12:105349325-105349347 CTGATTCACCACATCTCAGGAGG + Intronic
1104874880 12:132026843-132026865 CTCTTTGACCACATCTTTGTAGG + Intronic
1109260117 13:60135399-60135421 GTGATTCATCACATGTTCTTTGG - Intronic
1110763234 13:79253345-79253367 CAGATTGCTCACATCTTTATTGG - Intergenic
1111847946 13:93535021-93535043 CTTATTCATCAAATCTTTATTGG - Intronic
1112215735 13:97429987-97430009 CTGATTCATCCCAGCTTCTTTGG + Intergenic
1112288013 13:98121173-98121195 CTGTCTCGTCACTTCTTTGTTGG - Intergenic
1112577200 13:100646090-100646112 CTGATTCATCAGATCTCAGTGGG - Intronic
1114380318 14:22197101-22197123 CTGGTTCTTCACATGTTTGAAGG - Intergenic
1114406626 14:22462880-22462902 ATGATTATTCACAACTTTGTGGG - Intergenic
1115057278 14:29144742-29144764 CTGAGTCATCATCTCATTGTGGG - Intergenic
1115070383 14:29315533-29315555 GTTAATCATCACATCTTTCTTGG - Intergenic
1119102949 14:71896934-71896956 TTGATTCCTCACACCTGTGTAGG + Intergenic
1121641616 14:95488429-95488451 AGTATTCATCACAGCTTTGTTGG - Intergenic
1121931258 14:97974438-97974460 CTGTTTCATCAAATGTATGTGGG + Intronic
1122132923 14:99616063-99616085 CTGCTCCATCACATTTTAGTCGG + Intergenic
1123902442 15:24890276-24890298 CTGTTTGTTCAGATCTTTGTTGG - Intronic
1124166851 15:27334871-27334893 CTCATTTATCACTTTTTTGTGGG - Intronic
1125003972 15:34797554-34797576 TTGATTCAGCAAATCTTTGCAGG + Intergenic
1125591879 15:40859351-40859373 CTGAGTCCTCACATCCTTGCAGG - Intergenic
1126456240 15:48865210-48865232 CTGTGTCATCACCTCTTTGCGGG + Intronic
1128530778 15:68445938-68445960 TTTATTCATCACATATTTGTTGG + Intergenic
1130434366 15:83882791-83882813 CTGATTTTTCACATTTTTCTAGG + Intronic
1130642916 15:85696172-85696194 TTGATTCATGACTTCTTTGAAGG + Intronic
1131246170 15:90795631-90795653 CTCATTCAACAGATATTTGTTGG + Intronic
1131309947 15:91281271-91281293 CTATTTCCCCACATCTTTGTTGG + Intronic
1132401017 15:101505453-101505475 CTGACTCATCAACACTTTGTCGG + Intronic
1133152101 16:3841852-3841874 CTGATTCAGCAGATTTTGGTTGG - Intronic
1133162757 16:3922792-3922814 CTGCTTCCTCTCAGCTTTGTGGG - Intergenic
1133974035 16:10587570-10587592 CTCATTCATCAAATATTTATTGG - Intergenic
1134849011 16:17465376-17465398 CTGATTTCTCCCAACTTTGTGGG - Intronic
1135688938 16:24520916-24520938 CTGATTCAGCAGGTCTTTGAGGG - Intergenic
1138877183 16:60966267-60966289 CTCATTAATCACATCTTTAAAGG - Intergenic
1139320146 16:66107605-66107627 CTGGGTCATCTCATCTTTGAAGG + Intergenic
1141994776 16:87629400-87629422 TTGGTCCATCCCATCTTTGTGGG + Intronic
1143645872 17:8229765-8229787 CTGACTCAACACATCTTGTTGGG + Intronic
1145211243 17:21014937-21014959 CTGATTCAGCAGATCTGTGGGGG - Intronic
1146188069 17:30738830-30738852 CTAATTCATCACCTCCTTTTTGG - Intergenic
1147836404 17:43335214-43335236 CTGCTTCACCACCTCCTTGTGGG - Intergenic
1149402506 17:56312682-56312704 GTCGTTCATCACATATTTGTAGG + Intronic
1152249725 17:79205643-79205665 CTGATTCATCTGGTTTTTGTAGG - Intronic
1153730117 18:8002653-8002675 CTGATTCAATACATCTGAGTTGG - Intronic
1155353318 18:24927701-24927723 CTGACTCCTCACATCTTCGTGGG + Intergenic
1157111097 18:44821045-44821067 CAGAGTCAATACATCTTTGTGGG - Intronic
1158197332 18:54903382-54903404 CTGATACATGCCTTCTTTGTAGG - Exonic
1158758460 18:60355275-60355297 CTGACTCACTACATCTGTGTGGG - Intergenic
1159041459 18:63326792-63326814 CTCATCCATCATATATTTGTTGG - Intergenic
1159348258 18:67235813-67235835 ATCATTCATCACATTTCTGTAGG - Intergenic
1159793838 18:72817447-72817469 ATTATTTATCACATCTTTGTTGG - Intronic
1161150166 19:2703261-2703283 CTGGTTCATTCCATCTGTGTTGG - Intergenic
1164242273 19:23399947-23399969 CTGATTCTTCTCTTCTTTCTAGG - Intergenic
1165964876 19:39568217-39568239 CTGATTTCTCCCAGCTTTGTAGG - Intergenic
1168325062 19:55534392-55534414 CTGTTTCCTCACAGCTTTGGAGG - Intronic
926441859 2:12897471-12897493 CTGAATCATCACATTATTCTGGG + Intergenic
926667167 2:15538469-15538491 CTGATTCATTTGATCTTTGTGGG - Intronic
928447873 2:31349079-31349101 CTGACTGTTCTCATCTTTGTGGG - Intronic
928860140 2:35847428-35847450 ATGATTAATCACATCTATGAAGG + Intergenic
929578759 2:43068870-43068892 TTCATTCATCACATAATTGTTGG - Intergenic
930175326 2:48295616-48295638 TTGATTCAACAAATATTTGTTGG + Intergenic
930606739 2:53500754-53500776 CTGCTTCATGAGATTTTTGTGGG - Intergenic
931110377 2:59104196-59104218 CTGTTTCAACACACTTTTGTGGG + Intergenic
932348961 2:71016509-71016531 ATTATTCATCACAGTTTTGTGGG - Intergenic
932479818 2:72032510-72032532 CTGATTCATCCCAGCTCTCTTGG - Intergenic
934031454 2:88051818-88051840 CTGATTTAACACATCTGTGTTGG - Intronic
935469336 2:103438139-103438161 TTGATTCATCACCTCTTTCTTGG - Intergenic
939675944 2:145072009-145072031 CTCAGTCATCACATCTTAGGGGG + Intergenic
939952994 2:148497935-148497957 ATAATTCTGCACATCTTTGTGGG - Intronic
941039239 2:160601736-160601758 CTGATTCTTCACCTCAGTGTTGG + Intergenic
941887053 2:170538811-170538833 ATAATTCATCACATATTTCTAGG - Intronic
944556781 2:200894999-200895021 CTGATTCATTATATCTAGGTGGG - Intronic
946813622 2:223553154-223553176 CTCATTCAGCACATATTTATTGG + Intergenic
948083309 2:235225520-235225542 CTGATTCAGCCCAGCTGTGTCGG + Intergenic
1169815180 20:9649034-9649056 CTAATTCATGACAGCTGTGTAGG + Intronic
1170823619 20:19774919-19774941 CTAATTCACCACAGCTTTGCTGG - Intergenic
1178117206 21:29429494-29429516 CTGATTCATCAAGTCTTGGGTGG + Intronic
1179991538 21:44950733-44950755 CTGTTTCCTCCCATCTTAGTGGG + Intronic
1185195948 22:49469739-49469761 CTGATTCTCCACATCTCTGGGGG - Intronic
951082519 3:18468580-18468602 CTGATTCAGCACATCTGAGGTGG + Intergenic
951620010 3:24591388-24591410 CTGATTCAGCAGATCTGGGTTGG - Intergenic
952490192 3:33863163-33863185 GATATTCATCACATATTTGTGGG + Intronic
953707129 3:45239781-45239803 CTGATTCAGCACATCTGGGTGGG + Intergenic
954480619 3:50796698-50796720 CTGATTCTTTTTATCTTTGTGGG + Intronic
954990866 3:54839699-54839721 CTGATTCACCACAGCTGTGAGGG + Intronic
955759733 3:62266337-62266359 CAGATTCATCACAACTTTCAAGG + Intronic
955981518 3:64532046-64532068 CCGATTCAGCTCATCTGTGTGGG + Intronic
957274266 3:78069584-78069606 CTTAGTCATCACATCTTCTTAGG - Intergenic
957380582 3:79423603-79423625 GTGACTCATCACATTTTTTTTGG + Intronic
957835464 3:85582861-85582883 CTGCTTCACCACATCCTTGTTGG + Intronic
958758952 3:98284238-98284260 CTGATTCCTGAGATCTTTATCGG - Intergenic
959337301 3:105081941-105081963 CTGATACATTACATATTTATGGG + Intergenic
960186379 3:114645532-114645554 CTGTTTCCTTACATCTTTCTGGG + Intronic
960669890 3:120145740-120145762 CTGATTCAGCAGATCTGGGTGGG + Intergenic
962814223 3:138983985-138984007 TTGATTAATCACATCTTTAGTGG - Intergenic
966083920 3:176043382-176043404 TTAATTCAACAGATCTTTGTGGG - Intergenic
966237860 3:177722299-177722321 CTGATCCCTCAAATCTTTTTGGG + Intergenic
966598080 3:181745651-181745673 CAGATTGATAACAGCTTTGTGGG - Intergenic
967300212 3:188005159-188005181 CTGATTCAGGCCATCTTTTTTGG + Intergenic
969971943 4:11056899-11056921 CTAATTAATAACCTCTTTGTTGG + Intergenic
970450056 4:16157411-16157433 CTGATTCAGCACATCTGGGCAGG + Intergenic
970589911 4:17550530-17550552 ATAATTCCTCACATCTGTGTCGG - Intergenic
971091281 4:23348605-23348627 CTGATTCAGCAGATCTTGGATGG + Intergenic
972327431 4:38030145-38030167 CTGATTCATCACACTGTTTTAGG - Intronic
973055967 4:45657959-45657981 ATGAATCATCACATCTATATTGG + Intergenic
975767821 4:77687588-77687610 CTCATTCTTCACAGCTTTATTGG - Intergenic
976264514 4:83177930-83177952 CTGTTTCTTCACATCTTTCTTGG + Intergenic
976466850 4:85379850-85379872 TTTAATCCTCACATCTTTGTTGG + Intergenic
978566433 4:110087205-110087227 GTAATTCATCAAATCCTTGTGGG - Intronic
981437142 4:144737672-144737694 CTTATTCAGCAAATATTTGTTGG + Intronic
982480820 4:155908037-155908059 ATCATTTATAACATCTTTGTGGG - Intronic
983145757 4:164212873-164212895 CTGACTCATAACATATTGGTTGG - Intronic
985142959 4:186861964-186861986 CTGATCCATCACACCTTTGCTGG - Intergenic
988203424 5:28099517-28099539 CTGTTTCATCACATCATAGAAGG - Intergenic
988930129 5:36029187-36029209 CAGCTTGTTCACATCTTTGTGGG - Intergenic
989009441 5:36853482-36853504 CTGTTTCATCAGATGTTTATAGG + Intergenic
990551322 5:56882697-56882719 ATGATTCACATCATCTTTGTAGG - Exonic
990962142 5:61405246-61405268 TTGATTAATCCCATCTTTGGTGG - Intronic
991050074 5:62263348-62263370 CTGATTCATTTCATCTCTGCAGG + Intergenic
991502504 5:67290936-67290958 CTGCTTCCTCACATCATTATGGG + Intergenic
992593645 5:78323515-78323537 AGGAATCATCAAATCTTTGTTGG - Intergenic
992721114 5:79562003-79562025 TTGATTCAACACTTCTTTTTAGG - Intergenic
993220054 5:85083045-85083067 CTGAATGATGAAATCTTTGTCGG + Intergenic
993438592 5:87926680-87926702 CTGTTTTTTCTCATCTTTGTGGG - Intergenic
995300959 5:110581764-110581786 TAGATTCATCAGACCTTTGTTGG - Intronic
996067779 5:119099014-119099036 CTGAATCTTTACATATTTGTTGG + Intronic
998784203 5:145691000-145691022 CTATTTCATCATAACTTTGTTGG - Intronic
998975483 5:147641614-147641636 CTGATTCATCACATCTTTGTAGG + Intronic
999852425 5:155556883-155556905 CTGATTCATTACATCATGGCTGG + Intergenic
1000403780 5:160863963-160863985 CTGATTCTGCACTTTTTTGTTGG - Intergenic
1001236230 5:170031930-170031952 CTGATTCATCACATCTGGGCTGG - Intronic
1001810921 5:174627685-174627707 CTGACTCTTCACACCTTTCTGGG + Intergenic
1003981035 6:11389957-11389979 TTTATTCATCAAATATTTGTTGG - Intergenic
1004195748 6:13503087-13503109 CTGAAACATCACCTCTTTCTGGG + Intergenic
1012534183 6:100275814-100275836 CTTATTTATCACATTTCTGTGGG - Intergenic
1013914758 6:115322351-115322373 ATGATAAATGACATCTTTGTGGG + Intergenic
1014242168 6:119029381-119029403 CTGATTCATCAAAGCTTCGAGGG - Intronic
1015246964 6:131085624-131085646 CTGGTTTTTCTCATCTTTGTGGG - Intergenic
1015998547 6:139019304-139019326 CTCATTCATCAAATATTTATTGG - Intergenic
1020795863 7:12678008-12678030 CTGCTTTATAACATGTTTGTGGG + Intergenic
1021052037 7:15997775-15997797 CTGTTTCATCCTTTCTTTGTTGG - Intergenic
1021241638 7:18209180-18209202 CTGATTCAACAAAACTTTATTGG + Intronic
1023496337 7:40801274-40801296 CTGATTCAGCAAGTCTTAGTGGG + Intronic
1024421694 7:49174918-49174940 CTCATTGATCACATCTCTCTGGG + Intergenic
1024890816 7:54200735-54200757 CTGACTCAACACATCTGTATTGG - Intergenic
1025935674 7:66034688-66034710 CTCATGCATCACATCATTATTGG - Intergenic
1026565546 7:71487058-71487080 CTGATTCAGGACATCTCTGCAGG + Intronic
1031192574 7:118572998-118573020 CTGCTGCAGAACATCTTTGTTGG - Intergenic
1031273075 7:119679160-119679182 CAAATTCAGCACATTTTTGTTGG - Intergenic
1033204364 7:139404805-139404827 CTCATTTCTCACAACTTTGTGGG + Intronic
1034009797 7:147517164-147517186 CGAATTCATTACATCTTGGTGGG - Intronic
1035916804 8:3634046-3634068 CTGACTCAGCACATCTGGGTAGG + Intronic
1037690223 8:21175574-21175596 CTTAATCATCACATCTTCTTAGG + Intergenic
1038092367 8:24268729-24268751 TTGAATCATCACATCATTTTAGG - Intergenic
1039222772 8:35353584-35353606 GTAATTCATCACAACATTGTTGG + Intronic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1039637000 8:39178627-39178649 TTGATTTTTCTCATCTTTGTGGG + Intronic
1042762831 8:72289562-72289584 CTGATTCATTGCTACTTTGTGGG + Intergenic
1043580528 8:81707348-81707370 TTCACTCATCACATCCTTGTGGG + Intronic
1043691216 8:83154821-83154843 TTTATTCATCAAATATTTGTAGG - Intergenic
1046676171 8:117111106-117111128 GTGATAAAACACATCTTTGTAGG + Intronic
1052413951 9:28153991-28154013 ATTATTCATCTCATCTCTGTGGG - Intronic
1052823462 9:33158241-33158263 CTAATTCATTACATCATTTTAGG - Intronic
1053549363 9:39059554-39059576 CTGATTCATTATCTCTTTCTGGG + Intergenic
1053780533 9:41601777-41601799 CAGATTCATCTCTTCTCTGTAGG - Intergenic
1053813480 9:41879614-41879636 CTGATTCATTATCTCTTTCTGGG + Intergenic
1054168476 9:61811934-61811956 CAGATTCATCTCTTCTCTGTAGG - Intergenic
1054617116 9:67307825-67307847 CTGATTCATTATCTCTTTCTGGG - Intergenic
1054669053 9:67768884-67768906 CAGATTCATCTCTTCTCTGTAGG + Intergenic
1054775895 9:69123039-69123061 CTGATTCAGCAGATCTGGGTGGG - Intronic
1057919361 9:99084008-99084030 TTTATTCAGCACATATTTGTGGG - Intergenic
1058234888 9:102477350-102477372 TTGATTGATCACATCTTTGTAGG + Intergenic
1059856369 9:118402211-118402233 TTTATTCATCAAATGTTTGTAGG - Intergenic
1060009684 9:120032558-120032580 CTGACTCATCACGTCTTCTTGGG + Intergenic
1185689144 X:2138926-2138948 CTGTATCTTCACAGCTTTGTTGG - Intergenic
1186547163 X:10462025-10462047 CTGAAACATAAAATCTTTGTTGG - Intronic
1186904841 X:14100124-14100146 CTGATTCAGTACATCTGGGTGGG - Intergenic
1187027669 X:15452777-15452799 CTGATTCAGCACATCTGAGATGG - Intronic
1187777396 X:22777384-22777406 ATGATTCATCTCAACTCTGTTGG + Intergenic
1187891448 X:23938975-23938997 TTGATTCAGCACATCTCTGATGG + Intronic
1188043280 X:25395615-25395637 CTGATTCTTCTGTTCTTTGTTGG + Intergenic
1190154624 X:47979355-47979377 CAGATTCAGCAGATCTTTGGTGG - Intronic
1190826056 X:54019065-54019087 CTGATTTATAACAGCTTTCTTGG - Intronic
1193635264 X:83943036-83943058 CTGGTTCTTCACATCTTTGTGGG + Intergenic
1194266597 X:91761085-91761107 GTGATTCAACACACCTTTGCTGG - Intergenic
1194635506 X:96341856-96341878 CTGATCTTTCTCATCTTTGTGGG + Intergenic
1194657749 X:96594075-96594097 ATGATTCATTACATCTTGGGCGG - Intergenic
1194805720 X:98325325-98325347 CTAATTCATCAGTTCTTTGGAGG - Intergenic
1195298282 X:103501554-103501576 TTATTTCAACACATCTTTGTTGG - Exonic
1196133182 X:112179634-112179656 TTTATTCATCACATTTTTGAGGG + Intergenic
1197897884 X:131335585-131335607 CTGTTTCCTCACATTCTTGTTGG + Intronic
1198427766 X:136536827-136536849 CTCATTCAACAAATCCTTGTTGG - Intronic
1199010247 X:142749818-142749840 TTGATTCTTCCCATCTTTGCAGG + Intergenic
1200271050 X:154683799-154683821 CCAATTCTTCATATCTTTGTGGG + Intronic
1200583802 Y:4981999-4982021 GTGATTCAACACACCTTTGCAGG - Intergenic
1202081053 Y:21084718-21084740 GTGACTCTTCACATCTTTCTAGG + Intergenic