ID: 998983425

View in Genome Browser
Species Human (GRCh38)
Location 5:147729166-147729188
Sequence GTCAGCCAACTCTTAATTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998983425_998983427 8 Left 998983425 5:147729166-147729188 CCCTGAATTAAGAGTTGGCTGAC 0: 1
1: 0
2: 0
3: 9
4: 110
Right 998983427 5:147729197-147729219 TTGTCACAGATGCATGACCTTGG 0: 1
1: 0
2: 1
3: 7
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998983425 Original CRISPR GTCAGCCAACTCTTAATTCA GGG (reversed) Intronic
900882088 1:5389696-5389718 TTCAGCCAACTCAGAATTCTGGG - Intergenic
903697409 1:25218073-25218095 GTCAGCCATTGCTTATTTCAAGG - Intergenic
904968940 1:34403629-34403651 GTCATACATCACTTAATTCAGGG + Intergenic
904981079 1:34502318-34502340 GTCTGCCATATCTTTATTCAAGG - Intergenic
905333480 1:37226281-37226303 GTCATCCATGTCTTATTTCAAGG - Intergenic
908730025 1:67216461-67216483 CTCAGCAAACTTTTTATTCAAGG + Intronic
913608335 1:120487417-120487439 GTCAGCCCACTTTGAATTCCTGG - Intergenic
913987327 1:143576681-143576703 GTCAGCCCACTTTGAATTCCTGG + Intergenic
914370092 1:147017207-147017229 GTCAGCCCACTTTGAATTCCTGG - Intergenic
914484604 1:148096208-148096230 GTCAGCCCACTTTGAATTCCTGG + Intergenic
914582867 1:149034420-149034442 GTCAGCCCACTTTGAATTCCTGG + Intronic
919361352 1:196599502-196599524 GTAATACAACTCTGAATTCAAGG + Intronic
919539783 1:198831888-198831910 TTGGGTCAACTCTTAATTCATGG - Intergenic
920754478 1:208716078-208716100 GTGAACCAACTACTAATTCAAGG + Intergenic
921062137 1:211594200-211594222 GTCAGCCAGCTCTTAGTAGAGGG - Intergenic
924279296 1:242419878-242419900 ATCAGCCAGCTTTTAATCCAAGG + Intronic
1063820890 10:9833901-9833923 GTCATCCTGCTCCTAATTCAAGG - Intergenic
1070771869 10:79087307-79087329 GTCAGCCTACTCCTAATCCAAGG - Intronic
1071140317 10:82501712-82501734 GTCAACCAACACTTGATGCATGG - Intronic
1071980954 10:91003991-91004013 GGCAGCCAAATCTTAAATCTCGG + Intergenic
1072312994 10:94174698-94174720 ATCAGGCAACTCTAAATTGAAGG + Intronic
1072498965 10:95992864-95992886 CTCAGAAAACTCTTAATACATGG - Intronic
1076694697 10:132241704-132241726 GTCAGCGAACCCTTCATTCAGGG + Intronic
1077005123 11:351388-351410 GAAAGCCCACTCTTAATACAAGG - Intergenic
1080115198 11:28614402-28614424 ATCAGCCAACTATCAACTCAGGG - Intergenic
1080763073 11:35271432-35271454 GTCAACCAACTTTTAATGAATGG + Intronic
1081424500 11:42910425-42910447 TTAAGCCAACGCCTAATTCAGGG + Intergenic
1081439330 11:43063172-43063194 GTCAGCAAATTTTTGATTCATGG - Intergenic
1088747113 11:112813178-112813200 GGCAGGCATCTCATAATTCAAGG - Intergenic
1088899339 11:114103360-114103382 TTCAGCCAACTGCTAATTCTGGG - Intronic
1098096878 12:66966678-66966700 GTCAGACAAATTTTAATTGATGG - Intergenic
1098943470 12:76563859-76563881 GTCAGCCAACTTTTATCTCAAGG + Intergenic
1100956439 12:99914490-99914512 GTAAGCCATCTATCAATTCAGGG + Intronic
1104201138 12:126590403-126590425 GTGAGCCTGCTCTTAATTGAGGG - Intergenic
1104502697 12:129301833-129301855 ATCAGCCTACTCTGATTTCAAGG + Intronic
1107530634 13:41279283-41279305 CCCAGCCAACTCTTAAGTCTTGG + Intergenic
1108467470 13:50731126-50731148 GTCGGCCAAGTCTTCATTTATGG + Intronic
1109776195 13:67043998-67044020 GCCAGCCAATTCCTAATTCAAGG + Intronic
1110381206 13:74853494-74853516 TTCAACCAATTCTTAATACATGG + Intergenic
1112617602 13:101021210-101021232 ATCAGCCAACTGTCAACTCAAGG + Intergenic
1116058701 14:39895447-39895469 ATCAGCCTCCTCTTCATTCAGGG - Intergenic
1120611032 14:86641650-86641672 GTGGGCTAACTCTTAATACAAGG + Intergenic
1121362372 14:93273345-93273367 GTTAGCCAACCCTTAAATCTAGG + Intronic
1130846741 15:87754777-87754799 GTCTGCTAACTCATAATCCAAGG + Intergenic
1138154337 16:54688593-54688615 GTCAGCCAACTAATAAGTGAAGG - Intergenic
1140482556 16:75269676-75269698 GTCAGACAAATCCTAATTGAGGG - Intergenic
1143017976 17:3901595-3901617 GTCAGCAAACTTTTTTTTCAAGG - Intronic
1151240757 17:72755906-72755928 GTCAGCCAACTATTAGCTCCCGG - Intronic
1157084879 18:44569654-44569676 GTCAGCCAACTTTTAAATAATGG + Intergenic
1157142102 18:45120025-45120047 GACAGCCAACACTTGATTGATGG - Intergenic
1157680823 18:49604314-49604336 GTCAGCCAATTCTGCCTTCATGG - Intergenic
1162145052 19:8608477-8608499 GTCAGCCAACTCCCAGATCAAGG + Intronic
926456026 2:13069621-13069643 GTGAGCAAACTCTTAACACATGG + Intergenic
926917821 2:17909752-17909774 GTGAGCCATATCCTAATTCAGGG - Intronic
930859128 2:56051657-56051679 TTCTCCCAAATCTTAATTCATGG - Intergenic
930906468 2:56574340-56574362 GCCAGCCATGTCTAAATTCAAGG - Intergenic
936641035 2:114313198-114313220 GCCAGCCTCCTCTTCATTCAAGG - Intergenic
937028894 2:118721766-118721788 GTCAGCCACCTCTGAAGCCAAGG + Intergenic
937048731 2:118870405-118870427 GTCCGTCAAATCTAAATTCAAGG + Intergenic
938617429 2:133013680-133013702 ATCAGCAAGCTCCTAATTCAGGG + Intronic
943230769 2:185248104-185248126 GTCAGACAAATCTTTGTTCAAGG + Intergenic
945159852 2:206878266-206878288 ATCAGCCAACACTTACTACAGGG - Intergenic
946528072 2:220541473-220541495 CTCAGCCTCCTCTTCATTCAAGG + Intergenic
1168977426 20:1977963-1977985 TTCAGCAAACTCTTAATTAAAGG - Intergenic
1177060882 21:16372877-16372899 GTCAGCCAAATCCAAATCCAAGG - Intergenic
951105314 3:18735372-18735394 GACAGCCAATTTTTAATCCATGG + Intergenic
951436530 3:22671187-22671209 CTCAGCAATCTCTTCATTCATGG - Intergenic
952736433 3:36695930-36695952 CTCAGCCAACTCATGATACATGG + Intergenic
953114474 3:39978166-39978188 GTCACCCCAGTCTCAATTCAAGG - Intronic
953435782 3:42875996-42876018 GTCAGCCAAGTGTTAAGTCCAGG - Exonic
956807239 3:72827635-72827657 TTCATGAAACTCTTAATTCATGG - Intronic
962278278 3:134031497-134031519 GTCAGACAAGGCTGAATTCAGGG - Intronic
964182976 3:153909810-153909832 GTCCCCCAACTCTTAATAGATGG - Intergenic
965055925 3:163716425-163716447 GTCAGCAAATTCTTACTTAAAGG + Intergenic
971823818 4:31595450-31595472 GTCAACCCATTCTCAATTCATGG + Intergenic
982046058 4:151447257-151447279 GTCTTCCAAATGTTAATTCAAGG + Intronic
984113848 4:175653463-175653485 GTCTGCCAAATCTTAGTTTAAGG - Intronic
984222585 4:176995781-176995803 ATCAGCCAACTGTCAATTGAGGG - Intergenic
989610554 5:43286618-43286640 GTCAGCCAACTGTCAGTTTAAGG - Intergenic
990561818 5:56991072-56991094 GTCAGGCCACTCTGAACTCATGG + Intergenic
991607556 5:68418927-68418949 GTCAGCCAACTCTCATATGAGGG - Intergenic
992230604 5:74659722-74659744 ATCAGCCAACACTTAACTCTAGG + Intronic
993021206 5:82593588-82593610 GTCAGCAAACTCTCTATTAAAGG - Intergenic
996488810 5:124068062-124068084 CTCAGCCTCCTCTTCATTCAAGG + Intergenic
996895539 5:128477429-128477451 GCTAGCCAACTCGTAATTCCAGG - Intronic
998598019 5:143554598-143554620 GGAAGCCAACTATTAATCCATGG - Intergenic
998983425 5:147729166-147729188 GTCAGCCAACTCTTAATTCAGGG - Intronic
999644572 5:153705140-153705162 TTCAGGCAACTGTAAATTCAGGG - Intronic
1001949629 5:175807254-175807276 TTCTGCCCACTCTTCATTCATGG + Intronic
1007544634 6:42684104-42684126 GTCAGAAAACTCTTAATAAATGG + Intronic
1017525969 6:155241541-155241563 GTGTGCCAAGCCTTAATTCATGG - Intronic
1017780395 6:157711161-157711183 TTCAGGCAGCTCTGAATTCAAGG + Intronic
1017983639 6:159423778-159423800 CTCAGTCAAGTCTGAATTCAGGG + Intergenic
1018338314 6:162820240-162820262 GTCAGTCAACACATAATTAAAGG - Intronic
1028024378 7:85819300-85819322 TTCAGTCAACTCTTCATTCTTGG - Intergenic
1031808609 7:126338084-126338106 GTGAGTCAACTACTAATTCAAGG - Intergenic
1034473379 7:151268533-151268555 GACAGCCACCCCTTTATTCAGGG - Intronic
1036241353 8:7083913-7083935 GCCAACCAACTCAGAATTCAGGG - Intergenic
1036661236 8:10710462-10710484 GTCAGCCTCTGCTTAATTCAGGG - Intronic
1040706040 8:50128594-50128616 GTCATCCCACTTTTAAGTCACGG - Intronic
1040737253 8:50523172-50523194 TTAAGCCAAATCTTAATCCAGGG - Intronic
1045725208 8:105164666-105164688 GTTAGCCAACTCTCAAATCAGGG + Intronic
1050937405 9:11415200-11415222 GTCAGCCAACCCTTATCTCAGGG - Intergenic
1052244002 9:26311679-26311701 ATCAGCCATCTTTTATTTCAAGG + Intergenic
1055057142 9:72034390-72034412 GTCAGCCAACTATTAACTTAAGG + Intergenic
1055385275 9:75755010-75755032 GTCAGGCATTTCTGAATTCAAGG - Intergenic
1058449110 9:105079743-105079765 GTCAAACAACAATTAATTCAAGG - Intergenic
1059117217 9:111610397-111610419 CTCAGCCAACTCATGATTCCTGG - Intergenic
1060160986 9:121363754-121363776 GTCAGCCAACTATTTATTTGAGG + Intronic
1187750992 X:22464709-22464731 TTCAGCAAACTTTTACTTCAAGG + Intergenic
1188306099 X:28561349-28561371 GTCAGCCAACTATCAGCTCAAGG - Intergenic
1190554051 X:51615878-51615900 TTCAGGCATCTCTTACTTCAAGG - Intergenic
1190992586 X:55566987-55567009 GTCAGCCTACTCTTTCCTCAGGG - Intergenic
1192074486 X:67978853-67978875 TTGAGCCAACTTTTAATTCCTGG - Intergenic
1193908548 X:87273375-87273397 GTAAACCAACTCTTATATCAAGG - Intergenic
1193915016 X:87353437-87353459 GCCAGCCTCCTCTTTATTCAAGG + Intergenic
1197201927 X:123755763-123755785 GTTAGCCAGCTATTAACTCAAGG + Intergenic
1197276990 X:124490958-124490980 GTCAGCTAAGTCATAATTGATGG + Intronic
1198038469 X:132824913-132824935 GAAATCCATCTCTTAATTCAGGG + Intronic
1200322725 X:155206613-155206635 CTCAGCACACTCTTACTTCAAGG - Intronic