ID: 998986137

View in Genome Browser
Species Human (GRCh38)
Location 5:147759597-147759619
Sequence ACCTGGTGGCTCCTCTAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998986137 Original CRISPR ACCTGGTGGCTCCTCTAGAC TGG Intronic