ID: 998986139

View in Genome Browser
Species Human (GRCh38)
Location 5:147759601-147759623
Sequence GGTGGCTCCTCTAGACTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998986139 Original CRISPR GGTGGCTCCTCTAGACTGGA TGG Intronic
900076431 1:821414-821436 GGTGGCTCTGCTGGACAGGAAGG - Intergenic
900553043 1:3265979-3266001 GGTGGCGTCGCTAGGCTGGAGGG - Intronic
905301000 1:36986083-36986105 GAGGGCTCCTCTAGGCTGAAGGG - Intronic
905894112 1:41534204-41534226 AGTGGGACCTCTAGGCTGGAAGG - Intronic
907153001 1:52306402-52306424 GGTGGCTCCTCTCTACAGGCAGG - Intronic
907703889 1:56816256-56816278 AGTGGCTGGTCTAGTCTGGAGGG + Intronic
908437479 1:64120877-64120899 AGAGCCTCCTCTAGACTGGAGGG - Intronic
910215901 1:84843930-84843952 GGAGGCTGCTTTAGACTGGGTGG - Intronic
912925355 1:113908026-113908048 GCTGGCTCCTTTAGCATGGATGG - Exonic
915603740 1:156938214-156938236 GGTGGCTTCTTAAGGCTGGATGG + Intronic
919969582 1:202565658-202565680 GGTGGCTCTTCTAAACTGACAGG - Intronic
920985458 1:210884849-210884871 GGTGTCTCCTCCAGAAGGGATGG - Intronic
922249799 1:223838085-223838107 GATGGCTACTTTAGATTGGATGG - Intronic
924331418 1:242944332-242944354 GATGGCTCTTTTAGACTGGGTGG - Intergenic
1063093651 10:2890300-2890322 GCTGTCTCCTCTAGCATGGAGGG + Intergenic
1069740035 10:70681632-70681654 GGGGGCTGCTCTTGACTGGCTGG + Intronic
1069849140 10:71393786-71393808 TGTGCCACCCCTAGACTGGAGGG - Intergenic
1072475776 10:95758492-95758514 GGGGGCTAATCTAGACTTGAAGG - Intronic
1074553767 10:114469558-114469580 GGTTGCTCCTCTGGACAGAATGG - Intronic
1074902465 10:117830859-117830881 AGTGGCGACTCTAGAGTGGAAGG - Intergenic
1075012518 10:118886921-118886943 GGTGGCTCCTTCTAACTGGAAGG - Intergenic
1076697931 10:132256049-132256071 GTTGGCTCCCCGAGGCTGGAAGG - Intronic
1076898815 10:133327087-133327109 GGTGGGGCATCAAGACTGGAGGG - Intronic
1077265261 11:1645399-1645421 GGTGGCTCCTGTTTTCTGGACGG - Intergenic
1078042749 11:7883845-7883867 GGTGGCTCCTCTCTGCTGGCAGG + Intergenic
1079184079 11:18220918-18220940 GGTGGCTCCTCTCCACAGGCAGG + Intronic
1081578984 11:44339092-44339114 GGTGCCTTCTTTAGACTGGGGGG + Intergenic
1081776376 11:45678482-45678504 AGTGGCTCCTCTAAAATGGATGG - Intergenic
1084376575 11:68782287-68782309 GGTGGTTCCTGTAGAGGGGAGGG - Intronic
1084460351 11:69293554-69293576 GGTGGACCCCATAGACTGGAGGG - Intergenic
1089257191 11:117200209-117200231 GGTGGCTCCTCTCCACTCCACGG - Intronic
1089679560 11:120111732-120111754 GGTGGCTTCTCCTGACTGGCAGG - Exonic
1096477514 12:51917443-51917465 GGTGGGTCGTCTAGACTGGTGGG + Intronic
1097224193 12:57467519-57467541 GGTGGCTTCTCAAGAGGGGAGGG - Intronic
1101923472 12:108952091-108952113 GGTGGCTCCTCTAGACTCCATGG - Intronic
1102495382 12:113315765-113315787 GGTGGCTCCTGGAAGCTGGAAGG - Intronic
1102980854 12:117239949-117239971 GGTGCCTCCTCTGGATTGGTGGG + Intronic
1106874936 13:34061253-34061275 GGTGGCTGCTCCAGTCTAGAGGG + Intergenic
1108559378 13:51627798-51627820 GGTGGCTCCTCTCCATTGGTGGG + Intronic
1109024190 13:57139651-57139673 GGTGTGTACTCTAGACAGGATGG + Intergenic
1109025085 13:57145751-57145773 GGTGTGTACTCTAGACAGGATGG + Intronic
1109026072 13:57152321-57152343 GGTGTGTACTCTAGACAGGATGG + Intronic
1109027062 13:57158894-57158916 GGTGTGTACTCTAGACAGGATGG + Intergenic
1109028054 13:57165465-57165487 GGTGTGTACTCTAGACAGGATGG + Intergenic
1109029040 13:57172030-57172052 GGTGTGTACTCTAGACAGGATGG + Intergenic
1110999655 13:82164001-82164023 GGTAGCTCCTCTCTACTGGTAGG + Intergenic
1111595428 13:90404453-90404475 GGTGGCTCCTTTCCACAGGAAGG - Intergenic
1113608715 13:111628243-111628265 GATGACCCCTCTGGACTGGAAGG - Intronic
1113747688 13:112756416-112756438 GGTGCCTCTCCTGGACTGGAAGG - Intronic
1114473896 14:22981329-22981351 GGTGGCTCCTCCAGACCCGACGG + Exonic
1117680830 14:58200818-58200840 GTTGGCTCCCCTAAACTCGAAGG + Intronic
1118774334 14:68964308-68964330 GGTGGCTCAGGTAGAATGGAGGG - Intronic
1119126194 14:72129607-72129629 GGTGGCTCCGCTTGACTACAGGG + Intronic
1119307057 14:73615949-73615971 GGTGGCTTCTTGAGGCTGGAGGG + Intronic
1122143865 14:99677392-99677414 GGGGGCTCCTCTTGCCTGGCAGG + Exonic
1126913702 15:53442073-53442095 TGTAGCTCACCTAGACTGGAAGG + Intergenic
1130334638 15:82948606-82948628 GGTGGGTGCTCTAGACAGGATGG + Intronic
1132748172 16:1445578-1445600 GGAGGCTCCTCTGGCCTGGCTGG - Exonic
1137675730 16:50302950-50302972 GTGGGCTCCTGTGGACTGGATGG + Intronic
1203118413 16_KI270728v1_random:1514298-1514320 GGTGGCTGCTCTGGTCTGCAGGG + Intergenic
1144027458 17:11291259-11291281 GGTGGCTTCTTGAGACTGGATGG + Intronic
1144735670 17:17553973-17553995 GGGGGCTCCTCTGGGCAGGAGGG + Intronic
1145233844 17:21194800-21194822 TGTGGCCCCTCTACACTGCATGG - Intergenic
1145359535 17:22200874-22200896 GTTCACTCCTCAAGACTGGAAGG - Intergenic
1147669834 17:42170601-42170623 GGTGGAACCTATAGCCTGGAGGG + Intronic
1149642079 17:58209493-58209515 GGAGGCTCATTTAGACTGGGTGG + Intronic
1153475762 18:5496973-5496995 GCTGGCTGCTCTAGACTGGATGG + Intronic
1154337182 18:13475026-13475048 GGTGGCTCCTCTTGATTGCTGGG + Intronic
1155155920 18:23157348-23157370 GGTGGCTTCTCTAGATTGAGGGG + Intronic
1157143548 18:45137369-45137391 TCTGGCTGCTCTAAACTGGAAGG - Intergenic
1157710874 18:49848854-49848876 TCCTGCTCCTCTAGACTGGAAGG - Intronic
1157911727 18:51622984-51623006 GGTGGCTGCCTCAGACTGGAGGG + Intergenic
1163627426 19:18398159-18398181 AGTGGCACCTCTATGCTGGAGGG + Intergenic
924963918 2:58235-58257 GGTGGCTCCTCTATGCAGGCAGG - Intergenic
929597964 2:43187863-43187885 AGTGGCTATTCTAGACTGGATGG - Intergenic
937993595 2:127677395-127677417 GGTGGCTGCTTTAGAGTGAAGGG + Intronic
938246240 2:129779993-129780015 GGAGGCTCCTCTGAACAGGAAGG - Intergenic
942951815 2:181729947-181729969 AATGGCTTCTCTAGAATGGACGG + Intergenic
944383814 2:199141810-199141832 GGTGGCTCCTCTCTACTGGCAGG - Intergenic
946419694 2:219557860-219557882 GGGGGCTGCTCCAGACTGGCAGG + Exonic
1169354105 20:4893536-4893558 GGTGGCTCCAGGAGACTTGAAGG - Intronic
1171016070 20:21543181-21543203 AGTGGCTACTCTGGTCTGGAGGG + Intergenic
1174604653 20:51752100-51752122 GGTGGCTCCTACAGAGTGAATGG + Intronic
1174901707 20:54507627-54507649 GGTGTCTGCTTTAGACTGAATGG + Intronic
1176089465 20:63312513-63312535 GGTGGCTCCTCTACGCTGACTGG + Exonic
1176430183 21:6570756-6570778 GGGGGCTCCCCTAAGCTGGAGGG - Intergenic
1178695074 21:34785860-34785882 TTTGGATCCTCTAGGCTGGAGGG + Intergenic
1179440783 21:41392488-41392510 GGTGGTTGCCCAAGACTGGAGGG + Intronic
1179705577 21:43178218-43178240 GGGGGCTCCCCTAAGCTGGAGGG - Intergenic
1180832775 22:18914535-18914557 GGTGCCTGCTTTAGACTGGGTGG - Intronic
1181067046 22:20311717-20311739 GGTGCCTGCTTTAGACTGGGTGG + Intergenic
1203282860 22_KI270734v1_random:139839-139861 GGTGCCTGCTTTAGACTGGGTGG - Intergenic
950607772 3:14098536-14098558 GGTGGTACCTCTAGAGTGGGAGG - Intergenic
951416020 3:22422391-22422413 CAGGGCTCATCTAGACTGGAGGG + Intergenic
952257647 3:31709283-31709305 CTTGGCTCTTATAGACTGGAAGG + Intronic
953676650 3:45007753-45007775 GGTGGATACTCTGGACTGGGAGG + Intronic
954339395 3:49940665-49940687 GGAGGCTCCGCTGGACCGGAGGG + Intronic
955136353 3:56222617-56222639 TTTGGCTCCCCTAGAATGGAAGG + Intronic
955482630 3:59404861-59404883 GGTGGCTCCTCCAGCCAGAATGG - Intergenic
959950644 3:112176150-112176172 AGTGGGTCCTCCTGACTGGAGGG + Intronic
961493641 3:127274905-127274927 GGTGGCTCCTCTCTGCTGGCGGG - Intergenic
963061319 3:141229543-141229565 GATGCCTCCTCTAGAATGGAAGG + Intronic
963140376 3:141941889-141941911 AGTGGCTCCTCTAGGCCGGGAGG + Intergenic
965542093 3:169880526-169880548 GGTGGCTCCTCTTGGCAGGCAGG - Intergenic
966491524 3:180532366-180532388 GGTGGCTCCTCTCTGCTGGCAGG - Intergenic
967705337 3:192643175-192643197 GGTGGATCATTTAGAATGGATGG + Intronic
969285195 4:6198795-6198817 GGTGGCTCCACTAGCTGGGATGG - Intronic
969454917 4:7295227-7295249 GGTGTCTCCTCTGGAGGGGAAGG - Intronic
971181393 4:24331367-24331389 CGTGGCTCCTTTAGACAGGGTGG - Intergenic
972264865 4:37450532-37450554 TGTGTCTCTTCTAGACTGTAGGG - Intergenic
976299280 4:83502653-83502675 GGTGGCTGCTCTTGACTGGGGGG + Intronic
977414329 4:96712254-96712276 TCTGACACCTCTAGACTGGATGG - Intergenic
978620383 4:110630912-110630934 GGGAGCTCCTCTAGTCTGGCCGG + Intronic
978758069 4:112325684-112325706 AGTGGCTCATGAAGACTGGAAGG - Intronic
981061167 4:140427178-140427200 GGTGGCTCCTCAAGCCCGCAGGG + Intronic
983125832 4:163949857-163949879 GGTAGCTCCTCTAGGCAGGCAGG + Intronic
983521800 4:168717009-168717031 GGTGGCTGCTTTAGACTGGGTGG - Intronic
984844272 4:184096814-184096836 GGTGGGTGCTCGAGACGGGAAGG + Intronic
986514984 5:8551818-8551840 GGTGGTTTCTCTAGAGTGGAGGG - Intergenic
986668760 5:10125629-10125651 AGTGGCTCCTGTGGACTGGACGG + Intergenic
991034644 5:62116462-62116484 GGTGGGTCCTTTAGGGTGGAAGG - Intergenic
998986139 5:147759601-147759623 GGTGGCTCCTCTAGACTGGATGG + Intronic
1000465447 5:161570007-161570029 GGAGACTCCTCTAGCCTAGAAGG + Intronic
1006374112 6:33662468-33662490 GGTGGGTCCTTGAGCCTGGAGGG + Intronic
1006384905 6:33725320-33725342 TGTGGCTCCTCCAGAGTGAAGGG + Intronic
1006947253 6:37792979-37793001 AGTGCCTCCCCTTGACTGGAGGG + Intergenic
1015886243 6:137921699-137921721 GGTCCCTCCTTTAGACTGAAGGG + Intergenic
1017520378 6:155196467-155196489 GGTCTTTCCTCTAGATTGGATGG + Intronic
1021901585 7:25290901-25290923 GCTGCCTCCTATACACTGGAAGG - Intergenic
1022043456 7:26602689-26602711 GGTGGCTCCTCTGGTCAAGATGG + Intergenic
1028257444 7:88617114-88617136 ATTGGCTCTTCTAGAATGGAAGG + Intergenic
1030484450 7:110148728-110148750 GGTAGCTCCTCTACACAGGCAGG + Intergenic
1032128916 7:129213310-129213332 GATGGGTCCTCTAGACTTGAGGG + Exonic
1033929603 7:146506265-146506287 GGTGGATGCTCTTGACTAGATGG - Intronic
1035714446 8:1743370-1743392 GGTGGCTGGTTTGGACTGGAAGG + Intergenic
1037651366 8:20841838-20841860 AGTGGCTGCTCTAGACAGGAGGG + Intergenic
1037880873 8:22572821-22572843 GCTGGCTCCTCCAGCCTGGGAGG + Intronic
1038456034 8:27672441-27672463 GGGGGCTCCTCTGGAGTGGTGGG + Exonic
1041457597 8:58077153-58077175 GGGGGCTCCTGTTGGCTGGAAGG + Intronic
1043775232 8:84258983-84259005 TCTGTCTCCTCTAGACTGCAAGG + Intronic
1043926142 8:86039426-86039448 GGTGGCTTCTCCACTCTGGAGGG + Intronic
1044564430 8:93647895-93647917 GGGGGCTCCTGTGCACTGGAGGG - Intergenic
1049775384 8:144401555-144401577 GGTGTCTCCCCTAGAGGGGAAGG - Exonic
1049824055 8:144655549-144655571 GGTGGCTCCTCTCTGCTGGCAGG - Intergenic
1051366433 9:16324569-16324591 GGTGACACTTCTAGACTGCATGG - Intergenic
1052270927 9:26627204-26627226 GGTGGTTCCTATTGACTAGATGG - Intergenic
1055048370 9:71954284-71954306 AGGGGGTCCTCTAGACTGTAGGG + Intronic
1055625801 9:78176138-78176160 TGTAGCTCCTCTAGGCTGGTGGG + Intergenic
1060116048 9:120941737-120941759 AGTGGCTGCTCTAGATTGCATGG - Intergenic
1060796257 9:126514621-126514643 GGTGGCTCCCATAGACTGCGGGG + Intergenic
1186375046 X:8989682-8989704 GATGGCTCCGCTAGAAAGGAAGG + Intergenic
1188588685 X:31807525-31807547 TTTGGCTCCTCTAGAATAGAAGG - Intronic
1189288021 X:39865982-39866004 TGTGGCTTCTCTAGACAGGGTGG + Intergenic
1196334419 X:114514632-114514654 GCTGGCTCCTCTAGCATAGATGG + Intergenic
1196636975 X:118013260-118013282 GGTGGCCACTTTAGATTGGATGG + Intronic
1197871165 X:131064014-131064036 GGTGGCTGCTAGAAACTGGATGG + Intronic
1200922238 Y:8623594-8623616 AGTGGCTCCTTTGGACAGGAAGG - Intergenic
1201228762 Y:11843519-11843541 GATGGCTCTTTTAGACTGGATGG - Intergenic