ID: 998986379

View in Genome Browser
Species Human (GRCh38)
Location 5:147762558-147762580
Sequence TTTCTCTGTGGTGCACAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 455
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 430}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998986374_998986379 4 Left 998986374 5:147762531-147762553 CCTTCTTGCTGTGTCCTCACATG 0: 269
1: 876
2: 1855
3: 2757
4: 3452
Right 998986379 5:147762558-147762580 TTTCTCTGTGGTGCACAATCTGG 0: 1
1: 0
2: 1
3: 23
4: 430
998986373_998986379 22 Left 998986373 5:147762513-147762535 CCTTTCAGACAGCAGCTACCTTC 0: 1
1: 0
2: 3
3: 14
4: 160
Right 998986379 5:147762558-147762580 TTTCTCTGTGGTGCACAATCTGG 0: 1
1: 0
2: 1
3: 23
4: 430
998986376_998986379 -10 Left 998986376 5:147762545-147762567 CCTCACATGGCCTTTTCTCTGTG 0: 40
1: 187
2: 399
3: 667
4: 1329
Right 998986379 5:147762558-147762580 TTTCTCTGTGGTGCACAATCTGG 0: 1
1: 0
2: 1
3: 23
4: 430
998986372_998986379 27 Left 998986372 5:147762508-147762530 CCTTGCCTTTCAGACAGCAGCTA 0: 1
1: 0
2: 0
3: 23
4: 373
Right 998986379 5:147762558-147762580 TTTCTCTGTGGTGCACAATCTGG 0: 1
1: 0
2: 1
3: 23
4: 430

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998986379 Original CRISPR TTTCTCTGTGGTGCACAATC TGG Intronic
901072252 1:6527048-6527070 TTTCACTGTGTTGCCCAAGCTGG - Intronic
901294342 1:8148761-8148783 TCTCTCTCTGTTGCCCAATCTGG - Intergenic
901407793 1:9061405-9061427 TTTCCCTATGTTGCCCAATCTGG - Intronic
902349822 1:15846409-15846431 TTTCTCTGTGTTGGTCAAGCTGG - Intergenic
902903702 1:19538547-19538569 TTTCGCTGTGTTGCCCAAGCTGG + Intergenic
903993563 1:27290277-27290299 TTTCTCTGTGTTGCCCAGGCAGG + Intronic
904190520 1:28739493-28739515 TTTCACTATGTTGCCCAATCTGG + Intronic
904663942 1:32105749-32105771 TTTCTCTGTGTTGCCCAGGCTGG + Intergenic
904708758 1:32412572-32412594 TTTCACTGTGTTGCCCAAGCTGG - Intergenic
905245686 1:36611832-36611854 GTTATCTGTGGTCCCCAATCTGG + Intergenic
906229423 1:44148390-44148412 TTTCACTGTGTTGCCCAAGCTGG + Intergenic
906406267 1:45544886-45544908 TTTTGCTTTGGTGCATAATCAGG + Intergenic
906852319 1:49264738-49264760 TTTCTCTGTGTTGCCCAGGCTGG + Intronic
907723227 1:56993641-56993663 TTTCACTGTGCTGCTCAAGCTGG - Intergenic
908127813 1:61048600-61048622 TTTCTCTGTGTTGCTCAGGCTGG + Intronic
908772023 1:67606185-67606207 TCTCCCTGTGTTGCACAAACTGG + Intergenic
909190872 1:72548877-72548899 TTTCTATGTGGTGCCTAAGCAGG + Intergenic
909699623 1:78508554-78508576 TTTCTCTGAGGTGCACAGCAGGG - Intronic
910576877 1:88775157-88775179 TTTCTCTGTGTTGCCCAGGCTGG + Intronic
911603244 1:99869853-99869875 TTTCACTGTGTTGCCCAAGCTGG + Intronic
911638061 1:100257936-100257958 TCTCTCTGTGGTGCTCAGGCTGG + Intergenic
912332477 1:108832243-108832265 TTTCTCTGTGTTGCCCAGGCTGG + Intronic
912355025 1:109047911-109047933 TCTCTCTGTGTTGCCCAAACTGG - Intergenic
912403812 1:109419470-109419492 TTTCGCTGTGTTGCACAGGCTGG - Intronic
913349304 1:117840754-117840776 TCTCTCTGTGGTCCTCAACCAGG + Intergenic
913372880 1:118120208-118120230 TTTATCTGTAGTGTACAATATGG + Intronic
913614294 1:120541681-120541703 TTTCGCTGTGTTGCACAGGCTGG - Intergenic
914575975 1:148969219-148969241 TTTCGCTGTGTTGCACAGGCTGG + Intronic
914867936 1:151448414-151448436 TCTCTCTCTGTTGCACAAGCTGG - Intronic
915934119 1:160080786-160080808 TTTCTCTCTGGTGGACATTTGGG + Intergenic
916324605 1:163542763-163542785 TTTCTCAGTGTTGCTCAATCTGG + Intergenic
917013230 1:170499004-170499026 TTTCCCTGTTGTACACAATTGGG - Intergenic
917309669 1:173665811-173665833 TTTCGCTGTGTTGCCCAAGCTGG - Intronic
917503109 1:175603908-175603930 TTTCTCTGTGTTGACCAAGCTGG - Intronic
918587127 1:186201085-186201107 TTTCACTGTGTTGCCCACTCTGG - Intergenic
918601493 1:186368414-186368436 TTTCGCTGTGTTGCCCAAGCTGG - Intronic
918989827 1:191684523-191684545 TTTCTCTGTGCTGAGCAACCTGG + Intergenic
919364641 1:196642172-196642194 TTTCACTGTGTTGCCCAAGCTGG - Intergenic
919375505 1:196788905-196788927 TTTCTCTGTAGTAAACAATAGGG - Intronic
919385182 1:196913429-196913451 TTTCTCTGTAGTAAACAATAGGG - Intronic
920498212 1:206470302-206470324 CTTCTCTGTGGCTCACACTCTGG + Intergenic
923923909 1:238601619-238601641 TTCCTTTTTGGTGCAGAATCTGG - Intergenic
1063128552 10:3157644-3157666 TTTCTCTGTGTTGCCCAAGCTGG - Intronic
1063478923 10:6353834-6353856 TTTCTCTGTGTGGCAGAATTTGG + Intergenic
1063563511 10:7150844-7150866 CTTGTCTGTGCCGCACAATCAGG - Intergenic
1063612644 10:7576220-7576242 TCTCTCTGTGTTGCCCAAGCTGG + Intronic
1064019738 10:11799458-11799480 TTTCTCTGTGTTGCCCAGGCTGG + Intergenic
1064945841 10:20788624-20788646 TTTCTCTTTGGTCCCCTATCTGG - Intronic
1065207041 10:23366721-23366743 TCTCACTGTGTTGCACAAGCTGG + Intergenic
1065305505 10:24364817-24364839 TTTCTCTCTGTTGCCCAAGCTGG + Intronic
1065731770 10:28716081-28716103 TTTCACTGTGTTGCCCAAGCTGG + Intergenic
1065998652 10:31083815-31083837 TTGCTCTGGGGTGCCCAACCTGG + Intergenic
1066107097 10:32165723-32165745 TTTCTCTGTGTTGGTCAAGCTGG + Intergenic
1066524742 10:36264410-36264432 TTACTCTGTAGTTCACAAGCTGG + Intergenic
1066758377 10:38732351-38732373 TTTCTCTGTGTTGCCCAGGCTGG + Intergenic
1068696417 10:59972528-59972550 TTTCGCTGTGTTGCCCAAGCTGG + Intergenic
1069276365 10:66595842-66595864 TTTCACTGTGTTGCACAGACTGG + Intronic
1070214163 10:74358963-74358985 AGTCTCTGTGGTGCCCAGTCTGG + Intronic
1072259565 10:93656223-93656245 ATTCTCTATGGTCCAGAATCTGG + Intronic
1073362426 10:102910475-102910497 TTTCACTGTGTTGCCCAGTCTGG + Intergenic
1073392081 10:103187218-103187240 TCTCTCTGTGTTGCCCAAGCTGG - Intronic
1075366890 10:121898534-121898556 TTGTTCTGTGGTGCACAGTCTGG + Intronic
1075530324 10:123223609-123223631 TTTCTCTCTGGTCCTCATTCTGG + Intergenic
1076015207 10:127022199-127022221 TCTCTCTGTGGTCCCCATTCGGG + Intronic
1077371400 11:2183298-2183320 TTTCTCTGTGTTGCCCATGCTGG + Intergenic
1078696573 11:13638576-13638598 TCTCTCTGTGTTGCCCAACCTGG + Intergenic
1080547123 11:33331572-33331594 TTTCTCTATGTTGCCCAAGCTGG + Intronic
1081274717 11:41134297-41134319 TCTCTCTGTGCTGAACAAGCTGG + Intronic
1081855747 11:46302416-46302438 TTTCTAAGTGGGGCACAATGTGG - Intronic
1083055147 11:59812053-59812075 TTTCTCTGTCTTGCCCAGTCTGG - Intergenic
1083916314 11:65746121-65746143 TTTCACTTTGCTGCACAAGCTGG + Intergenic
1084278205 11:68067405-68067427 TTTCTCTGTGTTGCCCAGGCTGG - Intronic
1084851596 11:71945915-71945937 TTTCTCTATGTTGCCCAAGCTGG - Intronic
1085374301 11:76044574-76044596 TTTCACTGTGTTGCCCAAGCTGG - Intronic
1086207149 11:84273014-84273036 TTTCTCTGTAGTTCTCATTCAGG - Intronic
1087118826 11:94551602-94551624 TTTCTCTGTGTTGCCCAGGCTGG - Intronic
1087631961 11:100660915-100660937 TTTCTCTGTGTTGGTCAAGCTGG + Intergenic
1087769701 11:102194951-102194973 TATCTCTGTGTTGCTCAGTCTGG + Intronic
1088451601 11:109987243-109987265 TTTCTCTCTGTTGCCCAAGCTGG - Intergenic
1088640292 11:111866338-111866360 TTTCTCTGAAGTGTACACTCAGG - Intronic
1089483556 11:118827243-118827265 TCTCTCTGTGTTGCACAGTCTGG + Intergenic
1089823828 11:121253531-121253553 TTTCTCTCTGCTTCACAGTCTGG - Intergenic
1090070494 11:123540273-123540295 TTTCACTGTGTTGCCCAAACTGG + Intronic
1090120841 11:124026177-124026199 TTTCACTGTGTTGCCCAAGCTGG + Intergenic
1090266800 11:125358564-125358586 TTGCTCAGTGGTGTACAATGGGG - Intronic
1091289713 11:134431335-134431357 TTTCCCTGTGGTACATATTCAGG - Intergenic
1092259053 12:6942654-6942676 TTTCTCTATGTTGCCCAAGCTGG - Intergenic
1092622622 12:10289209-10289231 TTTCTCTGTGGTGAACTGTTGGG - Intergenic
1092687333 12:11064862-11064884 TTTCGCTGTGTTGCACAGGCTGG - Intronic
1092740383 12:11623064-11623086 GTTCTCAGTGGTGCCAAATCAGG - Intergenic
1094304062 12:28998004-28998026 CTTCCCTGTTGTGTACAATCAGG - Intergenic
1095223300 12:39645795-39645817 TTTCACTGTGTTGCCCAAGCTGG + Intronic
1096300966 12:50426931-50426953 TTTCTCTGTGTTGCCCAGGCTGG + Intronic
1097698761 12:62799776-62799798 TTTTGCTGTGTTGCACAAGCTGG + Intronic
1097972961 12:65654364-65654386 TCTCACTGTGTTGCTCAATCTGG + Intergenic
1098121583 12:67246340-67246362 TTTCACTGTGTTGCCCAGTCTGG + Intergenic
1099352745 12:81592951-81592973 TTTCTCTGTGTTGCCTAAGCTGG + Intronic
1099383142 12:81980299-81980321 TTTCTCTGTCTTTCACAATCTGG + Intergenic
1100469366 12:94876219-94876241 TTGCTCTGTCGTGCCCAGTCTGG + Intergenic
1102391167 12:112549939-112549961 TTTCTCTGTGTTGCCCAGGCTGG + Intergenic
1103361587 12:120357699-120357721 TTTCACTGTGTTGGCCAATCTGG + Intronic
1103455959 12:121065626-121065648 TTTCACTCTGGTGCCCAAGCTGG + Intergenic
1103913952 12:124366711-124366733 TTTCTCTATGTTGCCCAAGCTGG + Intronic
1104076171 12:125391959-125391981 TTTCTCTGTGTTGCCCAGGCTGG + Intronic
1104163065 12:126199364-126199386 TTTCTGTCTGGTGCACATTATGG + Intergenic
1105491195 13:20890252-20890274 TTTGTCTGTGTTGCACAGGCTGG - Intronic
1105619252 13:22051224-22051246 CTTCTCAATGGTGCAAAATCTGG - Intergenic
1107085821 13:36427200-36427222 TTTTTCCTTGGTGCAGAATCTGG + Intergenic
1107549696 13:41463395-41463417 TTTCCGTGAGGTGTACAATCTGG - Intronic
1108746559 13:53401242-53401264 TTTCTCTGAGGTTCTCAATCTGG + Intergenic
1109237877 13:59846878-59846900 TTTCACTGTGTTGCCCAGTCTGG - Intronic
1111520695 13:89399375-89399397 TTTCTCTAGGGTAAACAATCAGG + Intergenic
1111660132 13:91199478-91199500 TTTCTCTGTGTTGGCCAAGCTGG + Intergenic
1111913786 13:94339956-94339978 TTTCTCTGTGTTGGTCAGTCTGG + Intronic
1112037821 13:95514060-95514082 TTTCTCTGTGTTGCCCAGGCTGG - Intronic
1113172132 13:107516721-107516743 TTTCCCTGTAGTGCTCAATTTGG - Intronic
1114561489 14:23594794-23594816 TTTCTCTGTGTTGCCCAAGCTGG + Intergenic
1115207572 14:30927106-30927128 TTTCTCTGTATTGCCCAAGCTGG - Intronic
1116211139 14:41946368-41946390 TTTTTCTGAGCTTCACAATCAGG - Intergenic
1117085958 14:52201487-52201509 TTTCACTGTGTTGCACAGGCTGG - Intergenic
1117234094 14:53753017-53753039 TTTCTCTGTGCTGAGCCATCTGG - Intergenic
1118406580 14:65430224-65430246 TTTCTCTGTGTTGCCCAGGCTGG + Intronic
1119250759 14:73151762-73151784 TTTCACCGTGTTGCACAGTCTGG + Intronic
1120918971 14:89737531-89737553 TTTCTCTGTGTTGGACAGGCTGG + Intergenic
1121398227 14:93646871-93646893 TCCCTCCGTGGTGCACAAGCTGG - Intronic
1122469267 14:101955260-101955282 TTTCACTGTGTTGCCCAAGCTGG - Intergenic
1202829629 14_GL000009v2_random:13330-13352 TTTCTCTGCGTTGAACATTCTGG + Intergenic
1124003401 15:25777805-25777827 TTTCTCTGTGTTGCCCAGGCTGG + Intronic
1124234333 15:27974570-27974592 TTTCACTGTGTTGCCCAAGCTGG - Intronic
1124276349 15:28328775-28328797 TCTCTCTGTGTTGCCCAAGCTGG - Intergenic
1126031811 15:44506608-44506630 TTTCTCTGTGTTGCCCAGGCTGG + Intronic
1126776816 15:52107524-52107546 TTTCACTGTGTTGCCCAGTCTGG + Intergenic
1127422966 15:58826422-58826444 TTTCTCTGTGTTGGTCAAGCTGG + Intronic
1127471457 15:59294315-59294337 ATTCTCTGAGGTCCAAAATCAGG + Intronic
1128954827 15:71928861-71928883 TTTCTCTGTGTTGCCCAGGCTGG - Intronic
1129093471 15:73177734-73177756 TTTCACTGTGTTGCTCAGTCTGG + Intronic
1130772646 15:86940102-86940124 TTTCTCTGTGTTGCTCAGCCTGG + Intronic
1130943081 15:88527759-88527781 TTTCTTTGTGGTGTACAATATGG - Exonic
1131134273 15:89921381-89921403 TTTCACTGTGTTGCCCAAGCTGG - Intergenic
1132372246 15:101307139-101307161 TTTCTCTTTGGAGCACGAGCTGG + Intronic
1132721570 16:1318969-1318991 TTTCACTGTGGTGCCCAGGCTGG - Intronic
1135467165 16:22697184-22697206 TTTCTCTGTGTTGCCCAGGCTGG + Intergenic
1135826764 16:25735584-25735606 TTTCACTGTGTTGCCCAGTCTGG + Intronic
1136421039 16:30133247-30133269 TTTCACTATGTTGCACAAGCTGG - Intergenic
1136651470 16:31676948-31676970 TTACTCTGTAGTTCTCAATCAGG - Intergenic
1137738969 16:50746231-50746253 TTTCACTGTGTTGCACAGGCTGG + Intronic
1139095500 16:63700068-63700090 TTCCTCTGGGTTGCACCATCTGG + Intergenic
1139342145 16:66274492-66274514 CTTCTCTGTGGTGGCCATTCAGG - Intergenic
1139708221 16:68756806-68756828 TTTCCCTTTGTTGCCCAATCTGG - Intronic
1139931053 16:70526401-70526423 TTTCACTGTGTTGCCCAAGCTGG + Intronic
1140400173 16:74665249-74665271 TTTCACTGTGTTGCCCAAGCTGG - Intronic
1140425406 16:74857028-74857050 TTTCTCTGTGTTGGTCAGTCTGG - Intergenic
1142293631 16:89205058-89205080 TTTCACTGTGTTGCCCAAGCTGG + Intergenic
1143643136 17:8210992-8211014 TTTCGCTGTGTTGGCCAATCTGG + Intergenic
1144007327 17:11112942-11112964 TTTCTCTGTGATGCCCAGGCTGG + Intergenic
1144459231 17:15444466-15444488 TTTCTCTGTGCAGCAAAATTTGG + Intronic
1146781762 17:35680564-35680586 TTTCTCTATGTTGCCCAAGCTGG + Intronic
1148288249 17:46415852-46415874 TTTCACTGTGTTGCCCAGTCTGG + Intergenic
1148310418 17:46633436-46633458 TTTCACTGTGTTGCCCAGTCTGG + Intronic
1148610072 17:48959181-48959203 TCTCACTGTGGTGCCCAAGCTGG + Intronic
1149151385 17:53568363-53568385 TTTCACTATGTTGCACAAGCTGG - Intergenic
1149176187 17:53873649-53873671 TTTCACTGTGTTGCCCAGTCTGG + Intergenic
1149572846 17:57685893-57685915 TTTCTCTGAGCTGAGCAATCAGG - Intergenic
1149931408 17:60759860-60759882 TTTCTCTGTGTTGCCCAAGCTGG + Intronic
1149953698 17:61021253-61021275 TTTCTCTATGTTGCCCAAGCTGG + Intronic
1150136652 17:62699434-62699456 TTTCGCTGTGTTGCCCAAGCTGG + Intergenic
1150461557 17:65357920-65357942 TTTCTCTGTGATGCCCAGGCTGG - Intergenic
1151298000 17:73199767-73199789 TTTCACTGTGTTGCCCAAGCTGG + Intronic
1153715996 18:7848574-7848596 TTTCACCGTGTTGCACAGTCTGG - Intronic
1154988957 18:21581882-21581904 TTTCACTGTGTTGCCCAGTCTGG - Intronic
1155294116 18:24370024-24370046 TTTCTCTATGTTGCCCAGTCTGG - Intronic
1155963123 18:32012117-32012139 TTTCTCTATGATGAACATTCGGG + Intergenic
1155979204 18:32163299-32163321 TTTCTCTGTGTTGCCCAGGCTGG - Intronic
1156678205 18:39557080-39557102 TCTCGCTGTGATGCCCAATCTGG + Intergenic
1156857714 18:41801960-41801982 TTTTTTTGGGGTACACAATCTGG + Intergenic
1157693498 18:49702248-49702270 TTTATCTGTGATGGACATTCGGG - Intergenic
1157828203 18:50831762-50831784 TTTCTCTGTTGTGCACAAGATGG + Intergenic
1157906796 18:51576504-51576526 TTTTCCTGTGGTGCAAAATGAGG + Intergenic
1158195882 18:54884516-54884538 TTAATCTGTGGTACCCAATCTGG - Intronic
1158454015 18:57590986-57591008 TTTCTCTGTGTTGCTCAGGCTGG - Intergenic
1159052806 18:63437279-63437301 TTTCACTGTGTTGCCCAAGCTGG + Intergenic
1161060003 19:2210114-2210136 TTTCTCTGTGGCTCACAGTCTGG + Intronic
1161670638 19:5606428-5606450 TTTCTCTGTGTTGCCCAGGCTGG - Intronic
1162525842 19:11205818-11205840 TTTCTCTATGTTGCCCAAGCTGG + Intronic
1163292989 19:16392856-16392878 TTTCTCTGTGTTGCCCATGCTGG - Intronic
1163293334 19:16395022-16395044 TTTCACTGTGTTGCCCAGTCTGG - Intronic
1163409459 19:17144771-17144793 TTTCACTGTGTTGCCCAGTCTGG - Intronic
1164992321 19:32693065-32693087 TCTCTCTGTGTTGCACACCCAGG + Intronic
1166535511 19:43571697-43571719 TTTCCCTGTGTTGCCCAAGCTGG + Intronic
1166559483 19:43722614-43722636 TTTCACTGTGTTGGCCAATCTGG + Intergenic
1166859879 19:45803795-45803817 TTTCACTGTGTTGCCCAAGCTGG - Intronic
1167052432 19:47087681-47087703 TTTCACTGTGTTGCCCAATCTGG - Intronic
1167651608 19:50733648-50733670 TTTCACTGTGCTGCCCAAGCTGG - Intergenic
1167800269 19:51736103-51736125 ACTCTCTGTGCTGCACAGTCTGG - Intergenic
1168329204 19:55556606-55556628 TTTCTCTGTGTTGCCCAGGCTGG - Intergenic
1168502020 19:56900722-56900744 TTCCTCTGAGTTGCAAAATCAGG + Intergenic
1202643064 1_KI270706v1_random:114454-114476 TTTCTCTGCGTTGAACATTCTGG - Intergenic
925051761 2:821020-821042 CTCCTCTGTGGTGCACCAGCGGG - Intergenic
925481820 2:4283878-4283900 TTGTTCTGTGGTGCACCCTCAGG + Intergenic
926218547 2:10920238-10920260 TGGCTCTGTGGGGCAGAATCTGG + Intergenic
926846902 2:17151525-17151547 TTTCTCTCTGGTGCCCAGGCTGG + Intergenic
927032659 2:19138577-19138599 TTTCTCTGAGCTGCAAACTCAGG + Intergenic
929144106 2:38691482-38691504 TCTCACTGTGTTGCACAGTCTGG - Intronic
929502734 2:42504123-42504145 TTTCGCTGTGTTGGACAGTCTGG + Intronic
929781107 2:44957692-44957714 TTTCACTATGTTGCACAAGCTGG + Intergenic
929863118 2:45696149-45696171 TCTCTCTGTGTTGCACAGGCTGG + Intronic
930569971 2:53073992-53074014 TTTGTATGTGGTGTAGAATCGGG + Intergenic
931406795 2:61987544-61987566 TTTCTCTGTGCTGGACTACCTGG + Intronic
932117211 2:69062970-69062992 CTTTTCTGTGGTGTTCAATCTGG - Intronic
932374432 2:71223096-71223118 TTAATCTGTGGTGAACAAGCTGG - Intronic
933590092 2:84223314-84223336 TTTCTCTGTGGTGAGCCAGCTGG + Intergenic
933940020 2:87237364-87237386 TTTCTCTTTGGTTCATATTCAGG + Intergenic
935807067 2:106759803-106759825 TTTCTCTGTGTTGCCCAGGCTGG + Intergenic
936353120 2:111728414-111728436 TTTCTCTTTGGTTCATATTCAGG - Intergenic
936732705 2:115403593-115403615 TTTCACTGTGTTGCCCATTCTGG + Intronic
937088508 2:119188862-119188884 TCTCTCTGTGTTGCCCAAGCTGG - Intergenic
938275622 2:130018981-130019003 TTTCACTCTGTTGCCCAATCTGG + Intergenic
938290603 2:130147683-130147705 TCTCTCTGTGTTGCCCAAGCTGG - Intergenic
938707914 2:133949620-133949642 TTTCCCTGTGATGGACAATGGGG + Intergenic
938870769 2:135473987-135474009 TTTCACTGTGTTGCACAGGCTGG - Intronic
939273708 2:139971760-139971782 TTTCTCTGTGCTGAACCACCTGG - Intergenic
943855349 2:192783253-192783275 TTTCTCTGTGTTGCCCAGGCTGG - Intergenic
943862367 2:192884249-192884271 TTTCTCTATGTTGCCCAGTCTGG - Intergenic
944780437 2:203012221-203012243 TCTCACTGTGGTGCTCAGTCTGG + Intronic
944801792 2:203243883-203243905 TTTCCCCGTGTTGCACAAGCTGG + Intronic
946357515 2:219197550-219197572 TTTCACTATGTTGCTCAATCTGG + Intronic
946864257 2:224028543-224028565 TCTCTCTGTGGTGGACACTTTGG - Intronic
947710504 2:232311279-232311301 TTTTTCTGTAGTGCACATACTGG + Intronic
948406007 2:237720140-237720162 TTTCCCTATGTTGCCCAATCCGG + Intronic
948978072 2:241476175-241476197 TTTCCCTGTGTTGCTCAGTCTGG - Intronic
1168752666 20:294264-294286 TTTCTCTATGTTGCTCAAGCTGG + Intergenic
1168796602 20:613969-613991 TTTCTCTGGGATGTACACTCGGG + Intergenic
1169431329 20:5538961-5538983 TTTCCCTGTGGGGCACTATTTGG - Intergenic
1169721085 20:8677196-8677218 TTTCTCTGTGTTGGTCAAGCTGG - Intronic
1170321909 20:15109506-15109528 TTTCTTTCTGGGGCACAGTCAGG - Intronic
1170387948 20:15841109-15841131 TTTCTCTGTGTTTCACATGCTGG + Intronic
1170440837 20:16377362-16377384 TTTCCCTGTGTTGCCCAGTCTGG - Intronic
1172032153 20:31989806-31989828 TTTCTCTGTGATGCCCAGGCTGG + Intronic
1172660784 20:36567117-36567139 TTTCGCTGTGTTGCCCAAGCTGG - Intergenic
1173815983 20:45988357-45988379 TTTCACTGTGTTGCCCAAGCTGG + Intergenic
1173935433 20:46858033-46858055 TCTCTCTGTGTTGCCCAAGCTGG - Intergenic
1174589421 20:51633548-51633570 TCTCTCTGTGTTGCACAGGCTGG - Intronic
1174812895 20:53662592-53662614 TTTCACTGTGTTGCCCAAGCTGG + Intergenic
1174995660 20:55565463-55565485 TCTCTCTGTGCTAGACAATCAGG + Intergenic
1175386957 20:58603377-58603399 TTTCTCTTAGGTGCTCACTCAGG - Intergenic
1176608814 21:8858171-8858193 TTTCTCTGCGTTGAACATTCTGG + Intergenic
1176637601 21:9262982-9263004 TTTCTCTGTCTCTCACAATCTGG - Intergenic
1177150019 21:17445919-17445941 TCTCTCTGTGGTGCTCAGGCTGG + Intronic
1178561873 21:33645443-33645465 TTTCCCTGTGTTGCCCAAGCTGG - Intronic
1178868152 21:36347732-36347754 TTTCACTGTGCTGCAAAGTCTGG + Intronic
1180421641 22:12870479-12870501 TTTCTCTGTCTCTCACAATCTGG - Intergenic
1180732799 22:17994515-17994537 TCTCTCTGTGTTGCCCAGTCTGG - Intronic
1181118151 22:20646988-20647010 TTTCACTGTGTTGCCCAAGCTGG + Intergenic
1181517548 22:23423852-23423874 TCTCTCTGTGTTGCCCAGTCTGG - Intergenic
1182205136 22:28616654-28616676 TTTCACTGTGTTGCCCAAGCTGG - Intronic
1182396448 22:30039909-30039931 TTTGTCTGCTGTGCACAAGCAGG - Intergenic
1182611135 22:31548438-31548460 TTTCTCTGTGTTGTACAGGCTGG - Intronic
1183240509 22:36654425-36654447 TTTCCCTATGTTGCACAGTCTGG + Intronic
1183501709 22:38183836-38183858 TTTCTCCATGTTGCACAAGCTGG - Intronic
1184181061 22:42826593-42826615 TTTCGCTGTGTTGCCCAAGCTGG + Intronic
1185098901 22:48827026-48827048 TTTCACTGTGTTGCCCAAGCTGG - Intronic
950078307 3:10203190-10203212 TTTCGCTGTGTTGCACAGGCTGG + Intronic
950347565 3:12311297-12311319 TTTCGCTGTGGTGCTCAGGCTGG + Intronic
950389914 3:12688494-12688516 TCTCTCTGTGTTGCCCAGTCTGG - Intergenic
950403493 3:12789041-12789063 TTTCACTGTGTTGCCCAAGCTGG - Intergenic
951641336 3:24839502-24839524 TTTCTCTGTGTTGCCCAGGCTGG - Intergenic
953062701 3:39440492-39440514 TTTCCCTGTGTTGCCCAAGCTGG - Intergenic
953935765 3:47040766-47040788 TTTCACTATGGTGCCCAAGCTGG + Intronic
953985186 3:47436435-47436457 TTTCACTGTGTTGCTCAGTCTGG - Intronic
954259921 3:49431259-49431281 TTTCCCTGTGTTGCCCAAGCTGG + Intergenic
954310830 3:49765845-49765867 TTTCGCTGTGTTGCCCAGTCTGG - Intronic
954568466 3:51620292-51620314 TTTCTCTATGTTGCCCAGTCTGG + Intronic
956495081 3:69816335-69816357 CTTCTCTCTGCTGCACCATCTGG + Intronic
958908252 3:99965356-99965378 TTTCTCTCTGTTGCCCAGTCAGG + Intronic
958924940 3:100147466-100147488 TTTCTCTGTGTTGCCCAGGCTGG + Intronic
959358141 3:105358094-105358116 GGTCCCTGTTGTGCACAATCTGG + Intergenic
960497871 3:118396977-118396999 TTTCCCTGTGTTGCTCAATCAGG - Intergenic
963313390 3:143732796-143732818 TTTCTCTGGAGTTCACAAACTGG - Intronic
963892021 3:150646637-150646659 TTTGTCTGTGTTGCACAGGCTGG + Intergenic
964444940 3:156748854-156748876 TTTCACTGTGTTGCCCAAGCTGG - Intergenic
965231355 3:166056915-166056937 TTTCCTTGTGGTGCTCAATCTGG + Intergenic
965490542 3:169330053-169330075 TTTCTCTCTGTTGCACAGGCTGG + Intronic
966162905 3:176986508-176986530 TTTCTCTAGGGCTCACAATCAGG + Intergenic
966961970 3:184949108-184949130 TTTCACTGTGTTGCCCAAACTGG - Intronic
968016449 3:195338514-195338536 TCTCACTGTGTTGCACAGTCTGG + Intronic
968314233 3:197709408-197709430 TTTCTCTCTGTTGCCCAAGCTGG + Intronic
968352811 3:198075371-198075393 CTACTCTGTGGTTCTCAATCAGG + Intergenic
1202749294 3_GL000221v1_random:142039-142061 TTTCTCTGTCTCTCACAATCTGG + Intergenic
969218180 4:5739868-5739890 TTTCTCTGTGTTGCCCAGGCTGG - Intronic
970594712 4:17589653-17589675 TTTCACTGTGTTGCCCAAACTGG + Intronic
972111142 4:35560854-35560876 TTTCTCTCTGTTGCCCAAGCTGG - Intergenic
973296473 4:48527990-48528012 TCTCTCTGTGGTCCAGAATCTGG - Exonic
974107810 4:57490635-57490657 TTTCTCTTTGTTGCACAAGTTGG - Intergenic
974683091 4:65189770-65189792 TTTCTCTGTGATGAACACCCAGG - Intergenic
975873615 4:78809573-78809595 TTTCACTGTGTTGCCCAGTCTGG + Intronic
976388876 4:84489411-84489433 TTTCTCTTTGGTTCACATTCAGG - Intergenic
976799386 4:88971703-88971725 TCTCACTGTGTTGCCCAATCTGG + Intronic
977398648 4:96503174-96503196 TTTCACTGTGTTGCACAGGCTGG + Intergenic
978627063 4:110698558-110698580 TTTCTATGTGGTGTAAAATAAGG + Intergenic
979117821 4:116849957-116849979 TCTCTCTGTGCTGCAGTATCTGG + Intergenic
979230588 4:118344992-118345014 CTTCCCTGTGGTGCATGATCTGG - Intronic
979688093 4:123533080-123533102 TTTCCCTGTGGTGTACAAGTGGG + Intergenic
980116877 4:128687708-128687730 TTTCCCTGTGTTGCACAGGCTGG - Intergenic
980205394 4:129713252-129713274 TTTCTCCGTGGTCCAGGATCAGG - Intergenic
980303339 4:131023168-131023190 TTTCGCTGTGTTGCCCAAGCTGG - Intergenic
980581555 4:134761249-134761271 TTTCTCTATGTTGCCCAAACTGG - Intergenic
980769031 4:137348087-137348109 TTTCTCTCTGTTGCCCAAGCTGG + Intergenic
983627340 4:169815126-169815148 TTTCTCTGTGTTGCCCAGGCTGG + Intergenic
984553130 4:181184233-181184255 TTTCTCTGTGTTACACAGGCTGG - Intergenic
1202752499 4_GL000008v2_random:21398-21420 TTTCTCTGTCTCTCACAATCTGG - Intergenic
985761219 5:1749928-1749950 TTTCTCTGTGTTGCCCAGGCTGG - Intergenic
986283184 5:6339978-6340000 TTTCACTGTGTTGCACAGGCTGG - Intergenic
986367586 5:7048860-7048882 TTTCTCTGTTCTGGACAATGAGG + Intergenic
986473201 5:8095733-8095755 TGTCTCTGTGTTGCCCAAGCTGG + Intergenic
986677501 5:10199531-10199553 TTTCTCTATGGAGCACAAGGAGG + Intergenic
986726176 5:10598855-10598877 TTTCTCTGTGTTGCTCAGGCTGG - Intronic
986965752 5:13268473-13268495 TTTTTCCGTGCTGCAGAATCTGG + Intergenic
989267860 5:39498334-39498356 TTTCACTGTTCTGCAAAATCAGG + Intergenic
990323293 5:54649798-54649820 TTTCTCTGTGGTGTTAAAGCAGG - Intergenic
990910405 5:60845948-60845970 TTTCACTGTATTGCACAGTCTGG - Intergenic
991907559 5:71527114-71527136 TTTCGCTATGTTGCACAGTCTGG + Intronic
992371455 5:76148477-76148499 TTTCACTGTGTTGCCCAAGCTGG + Intronic
992378529 5:76214204-76214226 TTTATCTGTGGTGCAAAAGGAGG + Intronic
992536150 5:77705799-77705821 TCTCTCTGTGATGCCCAAGCTGG - Intronic
993946376 5:94121289-94121311 TTTCCCTCTGTTGCACAAGCTGG - Intergenic
996186395 5:120481324-120481346 TTTCACTGTGTTGCCCAGTCTGG + Intronic
996786910 5:127247733-127247755 TTTCTCTGTGCCCCACATTCAGG - Intergenic
998986379 5:147762558-147762580 TTTCTCTGTGGTGCACAATCTGG + Intronic
1000005124 5:157176182-157176204 TTTCCCTGTGTTGCCCAAGCTGG + Intronic
1000076766 5:157795994-157796016 TCTCACTGTGTTGCCCAATCTGG - Intronic
1001034966 5:168291334-168291356 CTTTTCTGTGGTGTAGAATCAGG - Intergenic
1001044021 5:168357409-168357431 TTTCCGTGTGGTTCACCATCTGG + Intronic
1001194426 5:169659045-169659067 TTTCTCTTTGTTGCCCAGTCTGG + Intronic
1001466512 5:171971785-171971807 TTTCACTGTGTTGCCCAAGCTGG - Intronic
1001642922 5:173257950-173257972 TTTCTCTGTGTTGCCCAGGCTGG + Intergenic
1003069142 6:2930784-2930806 TTTCTCTGTGTTGCCCAGGCTGG + Intergenic
1003325765 6:5088947-5088969 TTTCTCTGTGCTTCAAAATGTGG + Exonic
1005224216 6:23622785-23622807 TTTCACTGTGTTGCCCAAGCTGG - Intergenic
1005386548 6:25290813-25290835 TCTCACTGTGTTGCACAAGCTGG + Intronic
1006675787 6:35762050-35762072 TTTCTTTGTGGTGTAGAAGCTGG - Intergenic
1007467377 6:42063660-42063682 TCTTTCTGTGGTGCTCAAGCTGG + Intronic
1008701931 6:54111114-54111136 CTTCTCATTGCTGCACAATCTGG + Intronic
1010424521 6:75712479-75712501 TCTCACTGTGTTGCACAAGCTGG - Intronic
1011044389 6:83065893-83065915 CTTCTCGGTGGTGCACTCTCCGG - Intergenic
1012211779 6:96528050-96528072 TTTCCCTATGTTGCAGAATCTGG + Intronic
1012408547 6:98929374-98929396 TTTCTCTGTGTTGGTCAAGCTGG - Intronic
1013618660 6:111868379-111868401 TCTTTCTGTGGTACACAATTAGG - Intronic
1013705629 6:112830561-112830583 TTTATTTCTGGTGCTCAATCTGG - Intergenic
1014195519 6:118554090-118554112 TTTCACTGTGCTGCACAGGCTGG - Intronic
1014234068 6:118935440-118935462 TTTGTCTGTGGTGCAAAGTATGG + Intergenic
1014731565 6:125037672-125037694 TTACTTTGAGGTGCACCATCAGG - Intronic
1015627230 6:135192120-135192142 TTTCTCTTAGTTACACAATCTGG - Intronic
1015940714 6:138448855-138448877 TTTCTCTGTGTTGCTCAGGCTGG - Intronic
1016223282 6:141703232-141703254 CTTTTCTGTGAGGCACAATCTGG - Intergenic
1016460634 6:144277347-144277369 TTTCTCTGTGTTTCAAATTCAGG - Intergenic
1017687205 6:156925476-156925498 TCTCACTGTGGTGCCCAAGCTGG - Intronic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1018407401 6:163502125-163502147 TTTCGCTGTGTTGCCCAGTCTGG - Intronic
1018666111 6:166140054-166140076 TTTCTCTGTGTTGCTCAGGCTGG + Intergenic
1018904350 6:168066301-168066323 TTTCTCTGTGTTGGTCAAGCTGG - Intronic
1019258683 7:67715-67737 TGTCACTGTGGTTCACAGTCAGG - Intergenic
1019363773 7:620047-620069 TTTCTCTGTGTTGCCCAGGCTGG + Intronic
1021494610 7:21260472-21260494 TTTCTCTATGTTGCCCAAGCTGG + Intergenic
1022551915 7:31248825-31248847 TGTCTTTGTGGAGTACAATCTGG - Intergenic
1022990071 7:35697983-35698005 TTTCTCCGTGTTGCCCAGTCTGG - Intergenic
1023424404 7:40020261-40020283 TTTCTCTGTGTTGCCCAAACTGG + Intronic
1023645848 7:42313919-42313941 TTTCACTGTGTTGCCCAAGCTGG + Intergenic
1024427207 7:49239982-49240004 CTTCTCTGTGTTTCACAAGCAGG + Intergenic
1025005800 7:55353720-55353742 TTTCTCTGTGCTGCAGAACTTGG - Intergenic
1025937832 7:66051240-66051262 TCTCACTGTGTTGCACCATCTGG - Intergenic
1025988763 7:66478718-66478740 TTTCACTGTGTTGGACAAGCTGG - Intergenic
1026191420 7:68131797-68131819 TTTCTCTGTGTTGCCCAGGCTGG + Intergenic
1026339073 7:69419965-69419987 TTTCTCTCTGTTACCCAATCTGG - Intergenic
1026350307 7:69509828-69509850 TTTCTCTGTGTTGCCCAGGCTGG - Intergenic
1026472375 7:70704842-70704864 TTTCTTTTTGCTTCACAATCTGG + Intronic
1026498982 7:70926681-70926703 TTTCTCTGTGGTGTAGATACTGG - Intergenic
1026738224 7:72962337-72962359 TTTCACTGTGTTGCCCAGTCTGG - Intronic
1026852388 7:73733170-73733192 TCTCTCTGTGGTGCCCAGGCTGG - Intergenic
1027105510 7:75402731-75402753 TTTCACTGTGTTGCCCAGTCTGG + Intronic
1027752952 7:82174241-82174263 TTTCTGTGTGGTGCTCAGTCTGG - Intronic
1028122399 7:87070946-87070968 TTTCACTGTGTTGCCCAGTCTGG + Intergenic
1028486866 7:91368742-91368764 TTTCTCTGGGATGAACATTCAGG + Intergenic
1028876403 7:95828035-95828057 TTCCTTTGTGCTGCACAATTAGG + Exonic
1029305399 7:99616244-99616266 TCTCTCTATGTTGCCCAATCTGG - Intergenic
1030930101 7:115512291-115512313 TGTCTCTGGGGAGCAGAATCAGG + Intergenic
1031969949 7:128057208-128057230 ATACTCTGTGGTGCACAACTGGG + Intronic
1032558944 7:132867925-132867947 TTTCTCTGTGGTACGAAATATGG - Intronic
1032596342 7:133244856-133244878 TGTCTCTCTGTTGCACAAGCTGG + Intergenic
1032932911 7:136694944-136694966 TTTCTCTGTGGTGGTCAGGCTGG + Intergenic
1035098163 7:156373895-156373917 TTTCACTGTGTTGCACAGGCTGG - Intergenic
1035332836 7:158107522-158107544 TTTCCCTGTGGCTCACAATGGGG - Intronic
1037558307 8:20048652-20048674 TTTCACTGTGTTGCCCAAGCTGG + Intergenic
1038039959 8:23716132-23716154 TTTCACTCTGGTGCCCAAGCTGG - Intergenic
1038204144 8:25448717-25448739 TTTCACTGTGTTGCCCAAGCTGG - Intronic
1038837403 8:31141977-31141999 TCTCTCTGTGTTGCTCAAGCTGG + Intronic
1038851277 8:31279442-31279464 GTTCTCAGAGGTGCACAATCAGG - Intergenic
1039490342 8:37942854-37942876 TTTCTCTCTGTTGCTCAAGCTGG - Intergenic
1039961288 8:42249879-42249901 TTTCACTGTGTTGCTCAAGCTGG - Intergenic
1040811422 8:51458205-51458227 CTTCTCTGAGGTGCACCATTTGG + Intronic
1042379991 8:68102899-68102921 TTTCTCTGTGGAGCAGGATTTGG + Intronic
1044044179 8:87409825-87409847 TTTCACTGTGTTGCACAGGCTGG - Intronic
1044217873 8:89634258-89634280 TTTCACTGTGTTGCCCAAGCTGG + Intergenic
1044379571 8:91518345-91518367 TTTCTCTGGGTTTCACATTCTGG + Intergenic
1044391796 8:91660896-91660918 TTTCTCTGTGTTGCCCAGGCTGG - Intergenic
1044905590 8:96998419-96998441 TTTCTCTGTTTTGCACAGTTTGG - Intronic
1045283251 8:100767848-100767870 TTTCACTGTGTTGGACAAGCTGG + Intergenic
1045330834 8:101154447-101154469 TTGCTCTGTGGTGCCCAATAGGG + Intergenic
1045389344 8:101700257-101700279 TTTCTCTATGTTGCCCAAGCTGG + Intronic
1046147547 8:110180745-110180767 TTTCACTGTGTTGCCCAGTCTGG - Intergenic
1047570592 8:126094706-126094728 TTGCCCTGTGGTTCACACTCAGG + Intergenic
1047980180 8:130173114-130173136 TTTCTCTGGGATGAACAATTTGG + Intronic
1048198261 8:132350606-132350628 TTGCTCTGTGGTGCACTCTGAGG - Intronic
1048354491 8:133642073-133642095 TTTCTCTGTGGTGTAGACCCTGG - Intergenic
1049950941 9:643578-643600 TCTCTCTGTGTTGCCCAAGCTGG + Intronic
1052411553 9:28128220-28128242 TTTTTCTGTGGCTCACAAGCTGG - Intronic
1052946509 9:34172813-34172835 TCTCTCTATGGTGCACAGGCTGG - Intergenic
1053182693 9:35987233-35987255 TTTCGCTGTGGTGCCCAGGCTGG - Intergenic
1055036576 9:71824470-71824492 CTCCTCTGTCATGCACAATCTGG + Intergenic
1055083815 9:72293892-72293914 TTTCTCTCTGTTGCACAGGCTGG - Intergenic
1057375137 9:94514453-94514475 TTTCTCTGTGTTGCCCAGGCCGG + Intergenic
1058059305 9:100477820-100477842 TTTCACTGTGTTGCCCATTCTGG + Intronic
1059029383 9:110674805-110674827 TTTCTCTGTGCTGCCCAGCCTGG + Intronic
1059966234 9:119617021-119617043 TATCTCTGTGATGCACACTGGGG + Intergenic
1060238789 9:121885756-121885778 TTTCACTCTGTTGCACAAGCTGG + Intronic
1060960027 9:127674010-127674032 TTTCACTGTGTTGCCCAAGCTGG - Intronic
1061171524 9:128959560-128959582 TTTCCCTGTGTTGCTCAAGCTGG + Intronic
1061413173 9:130431926-130431948 TTTCCCTGGTGTGCACAAACGGG + Intronic
1062668339 9:137691371-137691393 TTTCTCTGTGTTGCCTAGTCTGG + Intronic
1203717933 Un_KI270742v1:172129-172151 TTTCTCTGTCTCTCACAATCTGG + Intergenic
1203533287 Un_KI270743v1:6100-6122 TTTCTCTGTCTCTCACAATCTGG - Intergenic
1185706170 X:2267748-2267770 TTTCACTGTGGTGCACAGCCTGG - Intronic
1185980156 X:4770581-4770603 TCTCACTGTGTTGCACAAGCTGG + Intergenic
1186077772 X:5899012-5899034 TTTCACTGTCGGGCACAGTCTGG - Intronic
1186449337 X:9659018-9659040 TCTCACTGTGTTGCCCAATCTGG + Intronic
1186842342 X:13496254-13496276 TTTCTCTTTGTTGTAAAATCAGG - Intergenic
1187344174 X:18447945-18447967 TTTCTCTGTGTTGCCCAGGCTGG + Intronic
1187520479 X:20009466-20009488 TTTCACTGTGTTGCCCAAGCTGG - Intronic
1188164721 X:26847815-26847837 TTTCTCTATGATGCACTTTCAGG + Intergenic
1189355237 X:40305414-40305436 TCTCTCTGTGGTGCCCAGGCTGG + Intergenic
1189383475 X:40518405-40518427 TTTCCCTGTGGTGTACAATCTGG + Intergenic
1189703736 X:43738623-43738645 TTTCTCTATGTTGCCCAAGCTGG - Intronic
1190025985 X:46923608-46923630 TTTCCCTGTGTTGCCCAGTCTGG + Intronic
1190650060 X:52560370-52560392 TCTCGCTGTGTTGCTCAATCTGG + Intergenic
1191145088 X:57157174-57157196 TTTCTCTGAGCTGCACTATGTGG + Intergenic
1192333135 X:70195695-70195717 TCTCTCTGTGCTGCCCAAGCTGG - Intronic
1192911254 X:75606887-75606909 TGTCTCTGCGGTTCACAATAAGG + Intergenic
1193787387 X:85775746-85775768 TTTATCTGTGGTGGAAAATTAGG + Intergenic
1194301531 X:92192766-92192788 TTTCTCTGTGTTGCCCAGGCTGG + Intronic
1196420889 X:115520063-115520085 TTTCTCTATTGTGGAAAATCAGG - Intergenic
1196832752 X:119789067-119789089 TCTCTCTGTGTTGCCCAAGCTGG - Intronic
1197999208 X:132414445-132414467 GTTGTCTGTGGTACACACTCTGG - Intronic
1198644052 X:138787264-138787286 TTTCTCTGTGCAGCAAAATCTGG - Intronic
1199198641 X:145061265-145061287 TTTCTCTGTGTTGCTCAAGCTGG - Intergenic
1200840770 Y:7779353-7779375 TCTCTCTCTGGTGCCCAAGCTGG + Intergenic
1202589158 Y:26464484-26464506 TTTCTCTGTGTTGCCCAGGCTGG + Intergenic