ID: 998986915

View in Genome Browser
Species Human (GRCh38)
Location 5:147769049-147769071
Sequence CCTCAAATACAGAAGTTAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 291}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998986912_998986915 2 Left 998986912 5:147769024-147769046 CCTTAACATTTCTCTGTCTTAGT 0: 1
1: 0
2: 0
3: 44
4: 364
Right 998986915 5:147769049-147769071 CCTCAAATACAGAAGTTAAAGGG 0: 1
1: 0
2: 2
3: 24
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998986915 Original CRISPR CCTCAAATACAGAAGTTAAA GGG Intronic
900267768 1:1767874-1767896 CCTCTAAGAAAGGAGTTAAATGG + Intronic
902913771 1:19622870-19622892 ACTGATATAGAGAAGTTAAAAGG + Intronic
903429187 1:23279185-23279207 ACTAAAATACAGAAGTCAAATGG - Intergenic
904061545 1:27714926-27714948 CCTCAAAAAAAAAAGTAAAAAGG + Intergenic
907892986 1:58653363-58653385 TCTCAAGTACAGTAGTTTAAAGG + Intergenic
908239878 1:62179877-62179899 ACTCAAATACAAAAGCAAAAGGG - Intergenic
908309712 1:62867558-62867580 ACTCAGATACAGAACTGAAAAGG + Intergenic
914733417 1:150393073-150393095 TCTAAAATAGAAAAGTTAAAAGG + Intronic
916388176 1:164300645-164300667 CCTCAAACACAGAAGAAGAAAGG - Intergenic
917583483 1:176400041-176400063 CCTAAAAAACTGAAGATAAAAGG - Intergenic
917645183 1:177022822-177022844 CCTCAAACACATAATTTTAATGG - Intronic
918013178 1:180606658-180606680 ACTGAAAGAGAGAAGTTAAAGGG - Intergenic
919025153 1:192159072-192159094 CCACAAATACAATATTTAAATGG + Intronic
919100475 1:193090844-193090866 TCTGAAATACAGAACTCAAAGGG + Intronic
920221452 1:204405647-204405669 CCCAAAATTCAGAAGTTAATGGG - Exonic
920228940 1:204457720-204457742 CCTAAAATTCAGAAGGTAAAGGG - Exonic
921464118 1:215464832-215464854 TCTTAAGTACAGAAGATAAATGG + Intergenic
921667399 1:217889304-217889326 CCTTGAATAAGGAAGTTAAATGG - Intergenic
922643211 1:227257586-227257608 CCAAAAATACAAAAATTAAATGG + Intronic
923885850 1:238154657-238154679 CCTAAAATAATGAAATTAAAAGG + Intergenic
923887463 1:238175151-238175173 ACTCAAATACAGAAGTGCAGAGG - Intergenic
924137009 1:240978320-240978342 CCTAAAATACTCAACTTAAATGG + Intronic
924202738 1:241676496-241676518 CCTCAAAAACAGAACTAAGATGG + Intronic
1063409696 10:5827885-5827907 CCTGAAAGACAGAAGGTAGACGG + Intronic
1063605274 10:7518114-7518136 CCACGAATACATAAATTAAATGG - Intergenic
1064023966 10:11832070-11832092 CCTTAAACACAGATTTTAAAAGG - Intronic
1064263557 10:13806017-13806039 CTAAAAATACAGAAATTAAATGG - Intronic
1064659657 10:17593475-17593497 ACTAAAATACAGAAATTAACTGG - Intronic
1064668611 10:17684803-17684825 GCACAAAATCAGAAGTTAAAGGG - Intronic
1065172664 10:23047596-23047618 CCCCAACTACAGAATCTAAAAGG - Intergenic
1065232178 10:23609680-23609702 CCCTCAAAACAGAAGTTAAAGGG + Intergenic
1065246488 10:23764069-23764091 CCTAATATCCAGAATTTAAAAGG + Intronic
1066240259 10:33526802-33526824 CCTCAAAAATAAAAATTAAATGG + Intergenic
1068326277 10:55491856-55491878 TCTCAAACACTGAAGTTGAATGG - Intronic
1069164764 10:65139782-65139804 GCACACCTACAGAAGTTAAAAGG - Intergenic
1070007876 10:72442916-72442938 CCAAAAATACAAAAATTAAACGG - Intronic
1070090045 10:73275718-73275740 CCTCAACTTCAAAAGGTAAAGGG + Intronic
1070148385 10:73790881-73790903 CCCAAAATACAGAAGATAGAGGG - Intronic
1070340968 10:75498285-75498307 CCTGCCATACAGAACTTAAAAGG - Intronic
1073738775 10:106382286-106382308 CCTTAAATAGAAAAGTGAAATGG + Intergenic
1074093877 10:110290284-110290306 CTTTATATACATAAGTTAAAAGG + Intergenic
1074893316 10:117753540-117753562 CATCAAGTAGAGAAGTGAAAAGG - Intergenic
1074933107 10:118149263-118149285 CCACAAACTCAGAAGTTACATGG - Intergenic
1074960063 10:118436253-118436275 CATGAAATACACAAGTAAAAAGG + Intergenic
1078165396 11:8878844-8878866 CCACAGAGACAGAAGATAAATGG + Intronic
1079779184 11:24577455-24577477 CATGAAATACAGAATTTACAAGG - Intronic
1080278788 11:30532449-30532471 TCCCAAAAGCAGAAGTTAAAAGG - Intronic
1081010779 11:37810198-37810220 CCCCAAATACTTAAGATAAATGG - Intergenic
1081779446 11:45699805-45699827 CCTCAAATTCAGAACCCAAATGG + Intergenic
1081795631 11:45817396-45817418 CTTCAAAAGCAGAAGTGAAAGGG - Intergenic
1082669855 11:56022256-56022278 GCTGATAAACAGAAGTTAAAAGG + Intergenic
1083031728 11:59598749-59598771 CTAAAAATACAAAAGTTAAACGG - Intronic
1083946930 11:65928859-65928881 CCTGAAAAACGGAAGATAAAGGG - Intergenic
1085754744 11:79193110-79193132 CCTCAAATACTGAAAGAAAATGG - Intronic
1086682369 11:89688289-89688311 CAACAAATACAGATGATAAATGG + Intergenic
1086756377 11:90568299-90568321 TCTCACTCACAGAAGTTAAATGG - Intergenic
1090103023 11:123821808-123821830 CCACAATTAAAAAAGTTAAATGG - Intergenic
1090184971 11:124732129-124732151 CCTCATAAACAGCAGTGAAAAGG + Intergenic
1090954698 11:131503865-131503887 CCTCTAATAGAGAAGCCAAATGG - Intronic
1094118843 12:26947413-26947435 CCTCCAAAAAAAAAGTTAAAAGG - Intronic
1094419083 12:30251555-30251577 CCTGAAATACAGAAGTCACGTGG + Intergenic
1094429203 12:30348237-30348259 CCTGAAATACAGAAGTCACGTGG - Intergenic
1096446932 12:51701882-51701904 AGTCTAATACAGAAATTAAATGG - Intronic
1097230164 12:57506094-57506116 CAAAAAATACAGAAGTTAACTGG + Intronic
1098713442 12:73798418-73798440 CCTCAGATACAGAAATCTAATGG + Intergenic
1098934955 12:76467950-76467972 CCTCACAGAAAGAAGTTAAGTGG - Intronic
1100763644 12:97837824-97837846 CAACAAATACAGGACTTAAATGG + Intergenic
1101110287 12:101479976-101479998 CTAAAAATACAGAAGTTAACTGG - Intronic
1101166826 12:102045937-102045959 TCACAGATACAGAAGTTAAATGG + Intronic
1101271692 12:103153367-103153389 ACACAAATACAACAGTTAAAAGG + Intronic
1101773319 12:107771612-107771634 CCTCAGAGACAGAATTTACAAGG + Intergenic
1102138433 12:110594597-110594619 ACTAAAATACAGAAATTAACTGG + Intergenic
1105449021 13:20482249-20482271 GCTGAAATCGAGAAGTTAAATGG - Intronic
1106645285 13:31627883-31627905 CCAGAAATACAGAACTTGAAAGG + Intergenic
1106805212 13:33299447-33299469 CCTCAAATTCAAATTTTAAAAGG + Intronic
1107237452 13:38189611-38189633 CCAAAAATACAGAAATTAACTGG + Intergenic
1107281573 13:38742356-38742378 CCTCATATAGAGAAATTATATGG + Intronic
1107425482 13:40288691-40288713 CCTCAAGTGCAAAATTTAAAAGG + Intergenic
1107801635 13:44113799-44113821 CCTCAGACACAAAATTTAAAAGG - Intergenic
1108005933 13:45946484-45946506 CCTCTAACTCAGAATTTAAAAGG + Intergenic
1108804886 13:54142212-54142234 CCTGAGATATCGAAGTTAAAGGG - Intergenic
1109737924 13:66511032-66511054 CCACAAATACACGAGATAAATGG + Intronic
1109927651 13:69167452-69167474 CCTCAAATACACAAAATAAAAGG - Intergenic
1111122626 13:83873650-83873672 CCTCAAATATAGATGATAAATGG - Intergenic
1111668035 13:91294495-91294517 ACTAAAATACAAAAGTTAGACGG - Intergenic
1112775040 13:102834565-102834587 CCTCAATTAAAGAAAATAAAGGG - Intronic
1116010823 14:39349907-39349929 CTTCAAATACAGATGATTAAAGG - Intronic
1116160927 14:41265803-41265825 TCTCAAATACAGAATTCAGATGG + Intergenic
1116635540 14:47390071-47390093 CCTCAAATGCTGAAGTTCTACGG - Intronic
1116664398 14:47756628-47756650 CCTTAACTACAGAAGGAAAAGGG + Intergenic
1118668776 14:68100178-68100200 CCTCAACTATAGAAGGTAGAAGG + Intronic
1118870576 14:69737692-69737714 CCTCAAATTCAGTAGTTGAGTGG - Intronic
1119268740 14:73282229-73282251 CATCAAATAGAGAAATTAATGGG + Intronic
1120760109 14:88277191-88277213 CCTCCTATACAAAACTTAAATGG + Intronic
1124590075 15:31046126-31046148 TCGCAAATACAGAACTTAAAAGG + Intronic
1125898557 15:43324252-43324274 CCTTCATTACTGAAGTTAAAAGG + Exonic
1125986324 15:44056671-44056693 CTTCAAATACACTAGTTAAGGGG + Intronic
1126133633 15:45369023-45369045 CCTCAAGAACAGAAATTAAAAGG - Intronic
1126365977 15:47894949-47894971 CCCCACATCCAGAAATTAAAGGG + Intergenic
1126913472 15:53439447-53439469 TTTCAAAGACAGAAGTCAAAAGG + Intergenic
1127163968 15:56223818-56223840 CTTCAAATTCATATGTTAAATGG - Intronic
1131951151 15:97683255-97683277 TATCAAATACAGAAGTTCATAGG + Intergenic
1131981255 15:97996915-97996937 CTAAAAATACAGAAGTTAACTGG + Intergenic
1132008981 15:98257505-98257527 CCTCAAATTCAGAAGGGAAATGG - Intergenic
1133210072 16:4258571-4258593 CCAAAAATACAGAAGTTAGCTGG - Intronic
1133436586 16:5785253-5785275 CCTCAACTAAGGAACTTAAATGG + Intergenic
1136273791 16:29165989-29166011 TCTCAAATACAGAATTCAGATGG - Intergenic
1137754858 16:50893230-50893252 AGTCAATTACAGAAGTTAACAGG - Intergenic
1139241775 16:65399630-65399652 ATGAAAATACAGAAGTTAAAAGG - Intergenic
1139717084 16:68822350-68822372 CCTCAAAGACAGAAGGGACAAGG - Intronic
1140417444 16:74786108-74786130 CCTCACAATCAGAAGGTAAAAGG + Intergenic
1140563850 16:76016791-76016813 TCTCAAAAACAGAAATTAAGTGG - Intergenic
1142077334 16:88127734-88127756 TCTCAAATACAGAATTCAGATGG - Intergenic
1142786872 17:2231364-2231386 CCTGAATTACAGAAGGTAGAGGG - Intronic
1146334077 17:31954222-31954244 CCAAAAATACAAAAGTTAACCGG - Intronic
1147355646 17:39894193-39894215 CCTCAAACAAAGCAGTTTAATGG + Intergenic
1149545019 17:57496976-57496998 TCTCAAATAAAAAAATTAAAGGG - Intronic
1149894306 17:60417309-60417331 CCAAAAATACAGAACATAAAAGG - Intronic
1153188997 18:2517412-2517434 ACTAAAATACAAAAGTTAACAGG - Intergenic
1153936497 18:9929792-9929814 TCTCAAATTCAGTAGTTAAGTGG + Intronic
1155493530 18:26421923-26421945 TCACAAATCCAGAGGTTAAAAGG - Intergenic
1158699552 18:59733992-59734014 CCACAAATATACAAGATAAATGG + Intergenic
1159061938 18:63524004-63524026 CCTTAAATAGGGAAATTAAATGG + Intergenic
1159211893 18:65333903-65333925 ACTCAAATATTGAAGTAAAATGG - Intergenic
1159378824 18:67630121-67630143 CCTGAAATAGAGAAGTAAAATGG + Intergenic
1159519321 18:69497295-69497317 ACTCTAATAGAGAAGCTAAAGGG + Intronic
1160062033 18:75539157-75539179 CTTTAAGTACAGAAGTGAAAGGG - Intergenic
1164022603 19:21321871-21321893 AATCAAAAATAGAAGTTAAAAGG + Intronic
1164262712 19:23582145-23582167 ACCTAAATACAGAAGATAAAAGG - Intronic
1165140543 19:33697391-33697413 CCAAAAATACAAAAGTTAGACGG - Intronic
1166260492 19:41637111-41637133 CTTCAAATCCAGAAGTTATGAGG + Intronic
1166422186 19:42646061-42646083 CCTCCTATACAGAAGAGAAACGG - Intronic
925777209 2:7347249-7347271 CCTCAACTCCCTAAGTTAAAGGG + Intergenic
926824644 2:16892239-16892261 TCTTATATACAGAAGTGAAATGG + Intergenic
927428197 2:23004517-23004539 CCCCACATACAAAAATTAAAGGG - Intergenic
928173574 2:29019330-29019352 ACTAAAATACAGAAATTAATCGG - Intronic
929289804 2:40177145-40177167 CATCAAATACAACATTTAAAAGG - Intronic
931600539 2:63998795-63998817 CCTTAATTAGAGAAATTAAAAGG - Intronic
931956421 2:67431032-67431054 CCTGAAATACAGAAGTTCAGAGG - Intergenic
932172783 2:69572685-69572707 CCTCAAGTGCAGAATTTAAGGGG - Intronic
933673431 2:85031125-85031147 TCTAAAATACAGAAATGAAACGG - Intronic
934705553 2:96475720-96475742 CTTCAAAAGCAGAAGTTATAAGG - Intergenic
936341291 2:111634642-111634664 CCTTCAATACAAAAGTGAAAGGG + Intergenic
937401493 2:121587667-121587689 CCACAAATACAAAAATTAGATGG + Intronic
937610101 2:123850732-123850754 CCTCAAAAAAAGAAATTCAAAGG + Intergenic
938235889 2:129707182-129707204 CCTCAAATACAATAGTGATAGGG + Intergenic
939026687 2:137022630-137022652 CATCAAAAAAAAAAGTTAAAAGG - Intronic
939049700 2:137293298-137293320 CCCAAAATACAAAAGTTAATTGG - Intronic
939075170 2:137592435-137592457 GCTAAAATACAGAAATTAAAGGG - Intronic
939583267 2:143976865-143976887 CCTCAAAAAGCAAAGTTAAAGGG - Intronic
939599611 2:144172989-144173011 ACTCAAAAACAAAAGTAAAATGG - Intronic
940039077 2:149340841-149340863 CCTCTAATAAATAATTTAAAAGG + Intronic
940497082 2:154444822-154444844 CTGCAAATAAAAAAGTTAAATGG + Intronic
943282481 2:185954376-185954398 CCTCAAATAAAAAAATAAAAAGG - Intergenic
943431344 2:187805771-187805793 CCCCAAATACTGGATTTAAAAGG - Intergenic
943505745 2:188755191-188755213 CCTAATATACAGAATTTATAAGG - Intronic
943974802 2:194460697-194460719 TCTGAAATACTGAAATTAAAGGG + Intergenic
945119991 2:206447548-206447570 GCTTAAAAACAGAAGTAAAAGGG - Intronic
945186772 2:207147514-207147536 CCTCATTTACAGAAGATAATTGG + Intronic
945614501 2:212051125-212051147 CCTCCTATTCAGAAATTAAAAGG + Intronic
945645873 2:212492751-212492773 ACTCAAATTGAGAAATTAAATGG - Intronic
945896770 2:215491906-215491928 CTTCCAATAGAGAGGTTAAAGGG - Intergenic
945966547 2:216193567-216193589 TCTCCAGTGCAGAAGTTAAAGGG - Intronic
1169312096 20:4551849-4551871 CATAGAATTCAGAAGTTAAATGG + Intergenic
1169918786 20:10710920-10710942 GATCAAATACTGAAGTAAAATGG + Intergenic
1170787270 20:19478483-19478505 CCTCAAAGACAGTTTTTAAAAGG + Intronic
1171173390 20:23034666-23034688 GCTCGGACACAGAAGTTAAAAGG + Intergenic
1171383935 20:24754459-24754481 TCTCAAAGACAGAAGTAAATCGG + Intergenic
1173088650 20:39949588-39949610 CTTCAAATAGAGAAGTAATATGG - Intergenic
1173965444 20:47109073-47109095 CCACAGATAAAGAAGGTAAAGGG + Intronic
1177113060 21:17051767-17051789 CCTCAAATACACACGTGAATTGG + Intergenic
1178619646 21:34162298-34162320 AGACAAAAACAGAAGTTAAAAGG - Intergenic
1179007177 21:37525797-37525819 CCTGTAATACAGCAGTTCAATGG + Intergenic
1179279900 21:39925298-39925320 CCTCACAGACTGAAGTTAAATGG + Intronic
949169125 3:977645-977667 CCTCCAATACTGAATGTAAAAGG - Intergenic
949373457 3:3361109-3361131 TCTCAAATTTAGAAGCTAAAAGG - Intergenic
949734459 3:7155390-7155412 CCTGGAATACACAAGTAAAAAGG + Intronic
951292117 3:20884059-20884081 CATCAAATTCAGTAGTTCAAGGG - Intergenic
951351819 3:21615559-21615581 AATAAAATACAGAAGTTAAATGG - Intronic
953308032 3:41848502-41848524 CCTCAAATACAAAACCTGAAAGG + Intronic
953341418 3:42137298-42137320 CCTGATATCCAGAAGTAAAAGGG - Intronic
954009731 3:47625394-47625416 CCAAAAATACAAAAGTTAACTGG - Intronic
955048278 3:55381832-55381854 CCATGAACACAGAAGTTAAAAGG + Intergenic
955291644 3:57697646-57697668 GCTCAAATACAGATTTTGAAGGG + Intergenic
956519690 3:70090081-70090103 CCTCAAAGACAGATGTAAAAAGG + Intergenic
959267267 3:104158200-104158222 CCTCAAACTCAGAAGATTAAAGG + Intergenic
959401891 3:105912966-105912988 GCTTAACTACAGAAGTTAAGTGG + Intergenic
959901197 3:111663478-111663500 CCTAATATCCAGAATTTAAAGGG + Intronic
961071722 3:123936038-123936060 CTGCAGATACAGAAGATAAAGGG - Intronic
962883829 3:139604495-139604517 CCTTTCATACAGGAGTTAAAAGG - Intronic
962892373 3:139683527-139683549 CTTCAACTGCAGAAGTTGAAAGG + Intergenic
963230732 3:142906509-142906531 CCCCAAATCAAGAAGTCAAACGG + Intergenic
963307553 3:143670094-143670116 TTCCAAATACAGAAGTTCAAGGG - Intronic
963665025 3:148172812-148172834 TCTCAAATACAAAACTTAATGGG + Intergenic
963948438 3:151171438-151171460 CCCCAAAGAGAGAAGTGAAAAGG - Intronic
964628782 3:158785895-158785917 CACCATATACAGAAGTTAACTGG + Intronic
965351065 3:167611611-167611633 ACTGAAACACAGAAGATAAAAGG + Intronic
965407555 3:168289088-168289110 TCACAAATACAGTAGTTAAAGGG + Intergenic
966191367 3:177274422-177274444 GCTCAAAGACAGAAGAGAAAGGG + Intergenic
966695059 3:182781026-182781048 CCTCAAATTCTGAAACTAAAGGG - Intergenic
967029622 3:185593571-185593593 CCTCAAATAAATAACTGAAAAGG - Intronic
967506783 3:190261521-190261543 GCTTAAATACAAAAGTTAGAGGG + Intergenic
967656083 3:192051484-192051506 CCTCATATACTGAGGATAAAAGG + Intergenic
970071762 4:12167293-12167315 TCTCAGATAAAGAATTTAAAGGG + Intergenic
970324037 4:14904510-14904532 GCTGAAATGCAGAGGTTAAATGG - Intergenic
970331428 4:14988812-14988834 ATTCAAATACATAAGTTGAAAGG + Intergenic
970362620 4:15324932-15324954 ACTGATACACAGAAGTTAAAAGG - Intergenic
970620697 4:17814877-17814899 ATTCAAATCCAGAAGTTAGACGG + Exonic
970869734 4:20801531-20801553 CATCAAAAACATAAGTTATAGGG + Intronic
971171110 4:24233844-24233866 AATCAAAAACAGAATTTAAATGG + Intergenic
972026669 4:34387728-34387750 CCTCCATTAGAGAAGTAAAATGG + Intergenic
972773438 4:42219432-42219454 ACTAAAATACAAAAATTAAACGG + Intergenic
973830089 4:54750341-54750363 GCTAATATACAGAATTTAAAAGG + Intergenic
973954140 4:56046827-56046849 CCTCTCACACAGCAGTTAAATGG + Intergenic
974018355 4:56670558-56670580 CCTAAACAAAAGAAGTTAAATGG - Intronic
974329500 4:60459103-60459125 CCTCAAATGTAGTAATTAAAGGG - Intergenic
974467344 4:62274137-62274159 CTACAAATACAAAAGTTAACTGG - Intergenic
976286105 4:83372712-83372734 CCTCAACTACAGAACATAAGAGG + Intergenic
978306395 4:107333270-107333292 ACTCAAATACAAAAGCAAAAGGG + Intergenic
979459609 4:120966850-120966872 TTTCAAAAACAGAAATTAAAAGG - Intergenic
979999228 4:127469066-127469088 CCTAAAATATAGAAATTAACTGG + Intergenic
980524588 4:133972927-133972949 CCTCAAACACAGAAGCGAGATGG + Intergenic
981267614 4:142805253-142805275 ATTCCACTACAGAAGTTAAAAGG + Intronic
982595502 4:157378813-157378835 CCTCAGATGCATAATTTAAAAGG - Intergenic
984570930 4:181392560-181392582 CCTCAAAAACAGATGCTAAATGG + Intergenic
986637349 5:9836169-9836191 CCTCACAAGCAGAAGGTAAAAGG - Intergenic
988647047 5:33105974-33105996 ACTTAAATTCAGAAGGTAAATGG - Intergenic
988773706 5:34456360-34456382 CCTCAAATACCTAAGCTAAAGGG - Intergenic
988925644 5:35989044-35989066 ACAGAAATACAGAAGTTACAAGG + Intronic
990259946 5:54011603-54011625 CCTAAGACACCGAAGTTAAAAGG + Intronic
990662187 5:58028281-58028303 CCAGAAAAGCAGAAGTTAAATGG - Intergenic
990863776 5:60357849-60357871 CCTCAAATACTGAACTTAGGTGG + Intronic
992297899 5:75344762-75344784 CCAAAAATACACAAATTAAATGG - Intronic
992691833 5:79248189-79248211 CTAAAAATACAAAAGTTAAAAGG - Intronic
994685935 5:102952250-102952272 CCTCACAGACAGAACTCAAAAGG - Intronic
995044408 5:107628933-107628955 CTGCAAATACAGAAAATAAATGG + Intronic
996973609 5:129403301-129403323 CCTAAAGTACAGAAGAGAAATGG + Intergenic
997923463 5:138005073-138005095 CCTAAAATACAAAAGTTAGCTGG + Intronic
998986915 5:147769049-147769071 CCTCAAATACAGAAGTTAAAGGG + Intronic
1003139652 6:3459350-3459372 CCTCTAAAACTGAAGCTAAAAGG + Intergenic
1003355721 6:5368159-5368181 CCTAAAATACAGAACTTAATTGG - Intronic
1003812078 6:9795552-9795574 GCACAAATACAGAGGATAAATGG + Intronic
1005144294 6:22669829-22669851 CCTCAAATATATAAATTAACTGG + Intergenic
1006422454 6:33943859-33943881 CTTCAAATGAAGAACTTAAAAGG + Intergenic
1006529063 6:34634619-34634641 CATCAAACATAGATGTTAAAAGG + Intronic
1008287891 6:49676565-49676587 ACACAAACACAGAAATTAAAAGG - Intergenic
1008558382 6:52697854-52697876 CCTCAACTTCAGGTGTTAAATGG - Intergenic
1010094105 6:72019513-72019535 CCTCAAATAGAAAATGTAAAAGG - Intronic
1011242199 6:85284867-85284889 CCTGAATTCCAAAAGTTAAACGG + Intergenic
1011469211 6:87690809-87690831 CTAAAAATACAAAAGTTAAACGG + Intronic
1012553962 6:100489956-100489978 TCTGAAACACAGAAGTTACAGGG + Intergenic
1013195768 6:107844297-107844319 CCTCAAGTACAGAAGTAGAATGG + Intergenic
1015681142 6:135809848-135809870 CCCCAACTACAGAAGATAAGAGG + Intergenic
1016608858 6:145964968-145964990 CCTCAAAAACAGACTTTAAAGGG + Intergenic
1017347589 6:153402943-153402965 CCTGAAATACAGCAGTTTAAAGG - Intergenic
1017565181 6:155676391-155676413 CCTATTATACAGAAGTCAAAGGG + Intergenic
1017684243 6:156896109-156896131 ACTCTAAGACAGAAGGTAAATGG - Intronic
1021194614 7:17661445-17661467 CTTCTAATACAGAAGAAAAAAGG - Intergenic
1021587120 7:22221331-22221353 CCTCACAGATTGAAGTTAAATGG - Intronic
1021677298 7:23094180-23094202 CATCATATACAAAAATTAAATGG - Intergenic
1022226220 7:28366411-28366433 CCTCACATACACAAGTTAAATGG - Intronic
1022435280 7:30377507-30377529 CCTCAAAAATAGGGGTTAAAGGG + Intronic
1024429619 7:49271572-49271594 GCACAAATACAGCAGTTTAAAGG - Intergenic
1024906059 7:54381802-54381824 CCTAAAATGTAGAAGTAAAAGGG + Intergenic
1024994639 7:55263118-55263140 GGTCAAATACAAAATTTAAAGGG + Intergenic
1027556112 7:79666722-79666744 TCTCAAATAGAAAAGATAAAAGG - Intergenic
1028800719 7:94962851-94962873 CCACAGATACAGAAATTCAAAGG - Intronic
1028980654 7:96964542-96964564 CCTGAAATAGAGAAAATAAAGGG - Intergenic
1029856613 7:103523837-103523859 CCTAAAATACAAAAATTAACTGG - Intronic
1029982622 7:104893350-104893372 CCAAAAATACAAAAATTAAAGGG + Intronic
1030919153 7:115358432-115358454 CATAAAATACAGAAAATAAATGG + Intergenic
1031551814 7:123123892-123123914 CCTGTTATACACAAGTTAAATGG - Intronic
1033086215 7:138344417-138344439 ACTCAAATACAAAAGCAAAAGGG + Intergenic
1033124420 7:138695348-138695370 CCTCAAATACAGAAATTCAGTGG + Intronic
1034293286 7:149949013-149949035 AATCAAATACAGAAATTAATAGG + Intergenic
1034812780 7:154147842-154147864 AATCAAATACAGAAATTAATAGG - Intronic
1041267403 8:56078386-56078408 CCTGAAATACAAAAGTTAGCCGG - Intergenic
1041402066 8:57456675-57456697 CCCCAAAAACAGAGGTGAAAAGG + Intergenic
1041471860 8:58219105-58219127 CTTAAAAGAGAGAAGTTAAAAGG + Intergenic
1043034915 8:75184479-75184501 CCTCAAATAAAGGAGGTGAAAGG + Intergenic
1044439899 8:92210695-92210717 TCTGAAATACAGATGTAAAAGGG + Intergenic
1045814043 8:106258748-106258770 CAAAAAATACAGAAGATAAATGG - Intergenic
1048159494 8:132001161-132001183 CTTGAAAGACATAAGTTAAAAGG + Intronic
1049974889 9:852097-852119 ACTAAAATACAAAAATTAAACGG - Intronic
1051545953 9:18275194-18275216 CCTCTAATAATGAAGTTAAAAGG + Intergenic
1051585507 9:18722728-18722750 CTTCAAATACAGAAGTTAAGAGG + Intronic
1052561199 9:30086940-30086962 CTTAAAATACAGAAATTAACTGG + Intergenic
1055178278 9:73348732-73348754 CCTCAAATATAGTTGTTAACAGG + Intergenic
1055355989 9:75437386-75437408 CCTGAAATACAGAGAGTAAAAGG - Intergenic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1059000399 9:110342622-110342644 CCCCAAATCCAGAAACTAAAAGG - Intergenic
1059852256 9:118355761-118355783 TCTCCATTACAGAAGATAAAAGG + Intergenic
1061173093 9:128973542-128973564 CCAAAAATACAGAAATTAACTGG - Intronic
1061951571 9:133939205-133939227 CTTCAAACACAGAAACTAAAGGG + Exonic
1187084440 X:16027560-16027582 CCACAAATACAGAAGGCCAACGG - Intergenic
1187509671 X:19906404-19906426 CCCCAAAGACAGAAGGTATATGG - Intergenic
1189107201 X:38249260-38249282 CCTAAAGGACAGAAGTTACATGG + Intronic
1189531322 X:41886520-41886542 TCTCAATTACAGAAAATAAAAGG + Intronic
1189745792 X:44167714-44167736 CCTCTAAGACAGAACTGAAAAGG - Intronic
1190125332 X:47699747-47699769 GCACAAATTCAGAAATTAAAAGG - Intergenic
1190950301 X:55137074-55137096 CCTCAAATAGAGAAGAGGAACGG + Intronic
1193513916 X:82439773-82439795 CTTAAAATACAGAACTTAAAAGG + Intergenic
1194059774 X:89182325-89182347 CCTCAAATAAGGGAGATAAATGG + Intergenic
1194350116 X:92816629-92816651 ACACAAATAGTGAAGTTAAAGGG - Intergenic
1194479097 X:94397957-94397979 CATCAAATAAAGAACTTTAATGG - Intergenic
1194486374 X:94491980-94492002 CCCCAAAAACGGAAGTGAAAAGG + Intergenic
1194675050 X:96784431-96784453 CCTAAAGTACTGAAGCTAAAGGG - Intronic
1195059975 X:101184681-101184703 ACTCAAATACAAAAGCAAAAGGG - Intergenic
1195404613 X:104499247-104499269 CATCAAAGACAGAAGCAAAACGG - Intergenic
1196574684 X:117304366-117304388 CTTCAAATACAGAAGCACAAAGG + Intergenic
1196640604 X:118055580-118055602 CCTCAACCACAGAAATTTAAGGG + Intronic
1196663822 X:118295546-118295568 ACTCAAATACAAAAGCAAAAGGG - Intergenic
1197471783 X:126872169-126872191 ACTCATATCCAGAATTTAAAAGG - Intergenic
1198439580 X:136649767-136649789 CTACAAATACTAAAGTTAAAAGG + Intronic
1201279183 Y:12326333-12326355 ACTCAAATACAAAAGCAAAAGGG + Intergenic
1201569937 Y:15403107-15403129 ACTCAAATACAAAAGCAAAAGGG + Intergenic
1202334436 Y:23792085-23792107 ACTAAAATACAAAAGTTAACTGG - Intergenic
1202536332 Y:25877974-25877996 ACTAAAATACAAAAGTTAACTGG + Intergenic