ID: 998999169

View in Genome Browser
Species Human (GRCh38)
Location 5:147900969-147900991
Sequence GAGAACATTGGGAAGACTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 1, 2: 1, 3: 21, 4: 235}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998999169 Original CRISPR GAGAACATTGGGAAGACTCT GGG Intronic
901284976 1:8070754-8070776 GAGAATATTGGGAATAAACTTGG + Intergenic
901965706 1:12864067-12864089 GAGAACATTAGGAAGACCAGTGG + Intronic
901981105 1:13034445-13034467 GAGAACATTAGGAAGACCAGTGG + Intronic
902000982 1:13194485-13194507 GAGAACATTAGGAAGACCAGTGG - Intergenic
902020212 1:13340189-13340211 GAGAACATTAGGAAGACCAGTGG - Intergenic
903453888 1:23473751-23473773 GACAACTCTGGGAAGACCCTCGG + Intronic
904205956 1:28855438-28855460 GAGAATTTTGGGAAGTCGCTGGG + Intronic
908782568 1:67704618-67704640 GAGACCCTTGGGAGGACTCCAGG - Exonic
909542549 1:76807062-76807084 GAAAAGATTTGGAAAACTCTTGG + Intergenic
910080502 1:83336220-83336242 GAGCAGCTTGGGAAGCCTCTGGG - Intergenic
911036910 1:93560041-93560063 GAGAACATTGGGGACCATCTTGG + Intergenic
911046035 1:93629199-93629221 GAGAACAGTGGGAGGAGCCTTGG - Intronic
911791156 1:102016512-102016534 GAGAAAATTAGGAGTACTCTTGG + Intergenic
913683434 1:121208541-121208563 GAGCACATTGGGGAACCTCTTGG + Intronic
914035276 1:143996165-143996187 GAGCACATTGGGGAACCTCTTGG + Intergenic
914154176 1:145071805-145071827 GAGCACATTGGGGAACCTCTTGG - Intronic
915432903 1:155880412-155880434 CAGAGCAGTGGGAAGAGTCTGGG - Intronic
915491540 1:156252626-156252648 GAGAACTTTGGGAGCCCTCTAGG - Intronic
916538451 1:165728102-165728124 CAGAACATTCAGAAGATTCTCGG - Exonic
917230733 1:172834861-172834883 GAAAACATGAGGAAGCCTCTGGG - Intergenic
917674996 1:177310387-177310409 GAGCACATTGCAATGACTCTAGG + Intergenic
918118437 1:181516901-181516923 GAGCACATGGTGTAGACTCTGGG + Intronic
918979101 1:191532153-191532175 GTGAATATTGTTAAGACTCTTGG + Intergenic
920470743 1:206227050-206227072 GAGCACATTGGGGAACCTCTTGG + Intronic
921653903 1:217711775-217711797 AAGAAGATTGGGAAGAGACTGGG + Intronic
923357569 1:233175557-233175579 GAGACTTTTGGGTAGACTCTGGG + Intronic
923382240 1:233432955-233432977 GAAAACCTAGGGAAAACTCTTGG - Intergenic
924353816 1:243148228-243148250 GACAAATTTGGGAAGACTCTAGG + Intronic
1064074480 10:12257914-12257936 GAGAACACTGGGAAGGGTCCCGG - Intergenic
1064554432 10:16534424-16534446 AGGATCATTGGGAAGACACTGGG + Intergenic
1065024981 10:21533665-21533687 GTGAACTTTGGGAAGAGTCCAGG + Intergenic
1068868009 10:61915470-61915492 GTGAAGATTGGGAAGTTTCTAGG + Intronic
1069050975 10:63793713-63793735 GAAAACATTGGGGAAACTCCAGG + Intergenic
1070740026 10:78896850-78896872 GAGAACGTTTGGGAAACTCTGGG + Intergenic
1071302345 10:84265426-84265448 GAGAACAGAGGGAAGACTTAAGG - Intergenic
1073334857 10:102698923-102698945 GAGAACACTGGGAACTGTCTAGG - Intronic
1073797195 10:107001309-107001331 GAGTGCAATGGGAGGACTCTTGG + Intronic
1075698952 10:124456066-124456088 GAGAAGGTTGGGAAGAGTGTAGG - Intergenic
1076022707 10:127087472-127087494 GAGAATATTGGGTAGAGTGTTGG + Intronic
1077383067 11:2256032-2256054 GAGGACATTGGGCAGTGTCTGGG - Intergenic
1079603876 11:22342413-22342435 GAGAAACTGGGGAAGACTCTTGG + Intronic
1081078423 11:38706784-38706806 GAGAACAATGGAAACACTTTTGG - Intergenic
1081691808 11:45083431-45083453 GGGAAAATGGAGAAGACTCTTGG - Intergenic
1081818299 11:45966113-45966135 GAGAACATTGGGAAGAAAAGGGG - Intronic
1085368148 11:75972295-75972317 GAGAAAATACAGAAGACTCTGGG - Intronic
1085866193 11:80296666-80296688 GAAAACATTGGGAAAACATTGGG + Intergenic
1085990496 11:81837291-81837313 GAAAACATTGGGGAAACTCTTGG - Intergenic
1086454660 11:86949103-86949125 GAGTACCTTGGCTAGACTCTAGG - Exonic
1087220454 11:95541381-95541403 AAGACCATTGGGAAAATTCTGGG + Intergenic
1087235551 11:95714223-95714245 GAGAATATTGGGCAGAGTCAAGG + Intergenic
1090923680 11:131231045-131231067 AAGCACATTGGGAAGACTACAGG - Intergenic
1091175812 11:133556636-133556658 AAGATCCTTGGGAAGTCTCTGGG + Intergenic
1092035787 12:5333304-5333326 GAGCACATTGGGAAGACATCAGG + Intergenic
1093751043 12:22800414-22800436 GACAGCATGGGGAATACTCTGGG - Intergenic
1094005621 12:25747179-25747201 GAGAAACTTGGAAAGAATCTGGG + Intergenic
1098207413 12:68126658-68126680 GAAAACATTGGGGAAACTCCAGG - Intergenic
1099688924 12:85925748-85925770 GGGAGCATTGGCAAGACTCATGG - Intergenic
1100005546 12:89890991-89891013 GGGAACCTTGGAAAGATTCTTGG + Intergenic
1101162123 12:101988626-101988648 GAAAACATTGGGGAAACTCCAGG - Intronic
1101786720 12:107890521-107890543 GAGCTCACTGGGAAAACTCTTGG - Intergenic
1101795110 12:107965889-107965911 GAGAACAGTGGGCAGCCACTAGG - Intergenic
1103131369 12:118471485-118471507 GAGGAGAATGGGAAGACCCTTGG + Intergenic
1105638459 13:22239083-22239105 CAGAACATTAGAAGGACTCTAGG - Intergenic
1105970924 13:25428779-25428801 GGCAACATTGGAAAGACCCTGGG - Intronic
1109602117 13:64644588-64644610 GAAAACATGGGAAAGATTCTTGG + Intergenic
1110069728 13:71159026-71159048 AAGAACTTTTGGAAGACACTGGG - Intergenic
1110394515 13:75013927-75013949 GAGAGCCTTGAGAAGGCTCTGGG - Intergenic
1111054655 13:82933033-82933055 GAGAACAAGGGAAAGAATCTTGG - Intergenic
1114402712 14:22424636-22424658 GAGAGGATTGGGAAGACACTTGG - Intergenic
1114996168 14:28355025-28355047 TAGAACATTTAGAAGACACTTGG + Intergenic
1114997140 14:28368382-28368404 GAGAACATTTAGAAAGCTCTTGG + Intergenic
1115450912 14:33546183-33546205 GAGAACCCTGGAAAGACCCTAGG + Intronic
1116592941 14:46803213-46803235 CTGAACATTGGGAAGAAGCTGGG + Intergenic
1116934768 14:50728176-50728198 GAGAGCAATGAGAAGAATCTTGG + Intronic
1118814371 14:69299572-69299594 AAGGACATTAGGAAGACTCAAGG - Intronic
1119808814 14:77499464-77499486 GAGAACATTCCGAGGACACTGGG - Intergenic
1119996612 14:79260805-79260827 TAGGACATTGGGAATATTCTGGG - Intronic
1124010888 15:25837776-25837798 GAGGGCATGGGGAAGGCTCTGGG + Intronic
1124212585 15:27775766-27775788 GAAAACATTGTGAAGACACAGGG - Intronic
1125022563 15:34999684-34999706 GGAAACATTTGGAAGACTTTAGG + Intergenic
1125169837 15:36753846-36753868 AAGAACATTTGTTAGACTCTTGG + Intronic
1127476855 15:59342426-59342448 GAAAACATTGGGAAGACTCCAGG - Intronic
1127617996 15:60706384-60706406 GAGAACAATGGACAGACTCCAGG - Intronic
1127737696 15:61859673-61859695 GAGGACATAGGGAAAACTCTTGG - Intronic
1128235219 15:66062418-66062440 GAGAACTGTGGGCAGCCTCTAGG + Intronic
1131892021 15:96983428-96983450 GTGAACGTTGAGGAGACTCTTGG + Intergenic
1136515007 16:30762711-30762733 GAGAACAGAGGGAGGGCTCTGGG - Intronic
1137064241 16:35822163-35822185 GAGAAAATCTGGATGACTCTGGG - Intergenic
1140553019 16:75887753-75887775 GAGAACTTTTGAGAGACTCTTGG + Intergenic
1141842387 16:86581510-86581532 CAGGCCAGTGGGAAGACTCTGGG + Exonic
1143151056 17:4807747-4807769 AGGAACATTGGGAAGCCTCAGGG - Intronic
1143921116 17:10331789-10331811 GAGAACATAGAGAGGACTCCAGG - Intronic
1144674450 17:17152974-17152996 GAGAACATTAGGCAGCCGCTGGG + Intronic
1144731131 17:17526964-17526986 GAGACCAATAGGAAGTCTCTAGG - Intronic
1145749219 17:27343242-27343264 GAGCACATTTGGAAACCTCTGGG + Intergenic
1146665037 17:34694624-34694646 GAAAACATAGGGAAAAATCTTGG + Intergenic
1148105729 17:45117943-45117965 GAGGTCATTGGGAAGGCTGTGGG + Intronic
1149113231 17:53060447-53060469 GAGAACATTGGGGACATTCCAGG + Intergenic
1149453906 17:56771838-56771860 GAGAATCTTAGGAAGACTGTAGG + Intergenic
1149637573 17:58183194-58183216 AGGAACATTGGGGAGGCTCTGGG + Intergenic
1149641284 17:58204559-58204581 TAGCACATTGGGAAGCCACTTGG - Intronic
1151594176 17:75066833-75066855 GAGAACAGTGGGAAGACATTGGG + Intergenic
1153927848 18:9850151-9850173 CAGAACTTGGGGATGACTCTTGG - Intronic
1156292028 18:35755707-35755729 GAGAACATAGGACAGGCTCTGGG - Intergenic
1156570672 18:38249160-38249182 GGGGACAGTGGGAAGACTGTGGG - Intergenic
1157081948 18:44535004-44535026 GAGAAGATGGGGAAGACTCCTGG + Intergenic
1162491612 19:10995757-10995779 CAGACCATTGGGAGGACTCTGGG + Intronic
1163403109 19:17106397-17106419 TAGAACTCGGGGAAGACTCTGGG + Intronic
1164261440 19:23571461-23571483 GAACACTCTGGGAAGACTCTGGG - Intronic
1167270582 19:48503530-48503552 GAGAAGACTGAGAAGAGTCTGGG - Intronic
1167341548 19:48919289-48919311 GAGAACATGGGGGATACTCGGGG + Intronic
925212608 2:2062804-2062826 GAGAAAATTATGACGACTCTGGG - Intronic
930171606 2:48257267-48257289 GAGAAAATTAACAAGACTCTAGG - Intergenic
931179680 2:59886839-59886861 CAAGCCATTGGGAAGACTCTGGG + Intergenic
931301046 2:60978511-60978533 GAGAGCACTGGGAAGGTTCTGGG + Intronic
931861356 2:66358001-66358023 GAGATGAATGGGAATACTCTGGG - Intergenic
931913009 2:66922709-66922731 GAGAACAAAGGGAAGAGACTTGG - Intergenic
932490356 2:72116176-72116198 GAGAACATAGAGAAGAGTCAGGG - Intergenic
933356401 2:81215119-81215141 GTGAAAATTGGGAAAACTCTAGG - Intergenic
934934560 2:98455364-98455386 GACAATATTTGGAAGATTCTGGG - Intronic
935169464 2:100599801-100599823 GAGAACACTGGGAAAGTTCTGGG - Intergenic
935201578 2:100861305-100861327 GAGAACACTTGGAAAACTTTAGG + Intronic
935427113 2:102931628-102931650 GAGAACATTGGGAAGTCCTTAGG - Intergenic
937146362 2:119648529-119648551 CGGCACATTAGGAAGACTCTTGG + Intronic
937305966 2:120871034-120871056 AAGGAGATTGGGAAGACTCATGG + Intronic
939073551 2:137572175-137572197 GAGAACAATGGAAAGACTAGAGG - Intronic
939168512 2:138666133-138666155 GAGAAGTATGGGAATACTCTTGG + Intergenic
940225351 2:151395546-151395568 AAGATCATTTTGAAGACTCTTGG - Intergenic
940249450 2:151658651-151658673 AAGAACATTTTGAAGAATCTGGG - Intronic
941047400 2:160691957-160691979 GAAAACATTGAGGAAACTCTAGG - Intergenic
941780262 2:169436820-169436842 GAAAACATCGGGAAAACTCCAGG + Intergenic
942761183 2:179400007-179400029 GAGAAGAGTGAGGAGACTCTTGG - Intergenic
943171916 2:184412515-184412537 GAGAACATTCAGAAGACTTTTGG + Intergenic
943626926 2:190211541-190211563 GAGTATGTTGAGAAGACTCTTGG - Intronic
943666774 2:190617263-190617285 AAAAGCTTTGGGAAGACTCTTGG - Intergenic
945854749 2:215055738-215055760 GAGAATATTGGAAAAACACTAGG - Intronic
947909327 2:233791035-233791057 GAGAACATTGCAGAGGCTCTGGG + Intronic
948850940 2:240705228-240705250 GAAAACATTGGAAAAAATCTGGG - Intergenic
1168829299 20:835851-835873 GAGGAGATTGGGAAGGCTCCAGG - Intronic
1169074253 20:2751772-2751794 GAGTACCTTGGGCAGCCTCTCGG - Exonic
1169957945 20:11126721-11126743 TAGAACATAGGGAATACTCAAGG - Intergenic
1170847172 20:19972128-19972150 GAGAATACTGGTAAAACTCTCGG + Intronic
1172494452 20:35369103-35369125 GAGAAAATTGGAAAGGCTCCTGG - Intronic
1174677945 20:52376347-52376369 GAGTAAATTGAGAAGACTCTAGG + Intergenic
1174900507 20:54494594-54494616 GAGAACATTGGGTAAAATCAAGG - Intronic
1175204705 20:57302698-57302720 GAGATCACTGGGAAGCCCCTGGG - Intergenic
1175357843 20:58382961-58382983 GAGAACATAGGGAAGATGCTGGG - Intergenic
1176983349 21:15408179-15408201 GAAGACATTGTGAAGACTCAGGG + Intergenic
1178890245 21:36514898-36514920 GATAACAGTGGGAAGACCCGGGG - Intronic
1179471650 21:41614349-41614371 AAGAACACTGTGAGGACTCTGGG - Intergenic
1180954375 22:19735094-19735116 GAGAACATGGGGAGGACTGCAGG - Intergenic
1181612746 22:24029615-24029637 GGACACATTGGGAAGACTGTGGG - Intronic
1182806017 22:33071173-33071195 AAAAACCTTTGGAAGACTCTGGG - Intergenic
1184236569 22:43186345-43186367 GAAAAGATTGAGAAGCCTCTAGG - Intronic
1184987251 22:48144346-48144368 GAGAACATTGGCGAGACTCCTGG + Intergenic
949697919 3:6720822-6720844 AAGAGCATTGAGAAAACTCTTGG + Intergenic
952140439 3:30473034-30473056 GAGAAGAATGGGAAAACTCTAGG + Intergenic
958538809 3:95441279-95441301 GATAACATTAAAAAGACTCTAGG - Intergenic
958887596 3:99744625-99744647 GAGATAATTGGAAAGACTTTGGG - Intronic
961938227 3:130608991-130609013 GAGAACATAAAGAAGAATCTGGG + Intronic
962379430 3:134885672-134885694 GAGAACATTTGGAAAACTTCTGG + Intronic
964436781 3:156661434-156661456 GTGATCATTAGAAAGACTCTAGG + Intergenic
965149196 3:164948170-164948192 GATAACATTGGTGAAACTCTAGG + Intergenic
966170659 3:177076346-177076368 GAGAACAGTGTGAAGACACAGGG - Intronic
973227622 4:47803759-47803781 GAAAACATTGGGGAAACTTTAGG + Intronic
974301424 4:60072397-60072419 GAAAACATTGGGGAAACTGTAGG + Intergenic
974385382 4:61197972-61197994 AAGAACATTGGCAAGAGTCATGG + Intergenic
975179558 4:71328905-71328927 GAAAACATTGGGGAAACTCCAGG - Intronic
975612480 4:76215735-76215757 GAGAACATGGGAAAGACTGTGGG + Intronic
977301757 4:95275206-95275228 GAGAACATAGGAGAGAATCTTGG + Intronic
977927503 4:102717775-102717797 GAGAACAATGGGAAGAGGCAGGG + Intronic
979247991 4:118531402-118531424 GACAAATTTGGGAAGACTCCAGG - Intergenic
980906148 4:138950526-138950548 GAGAACAATGTGAAGACACGGGG - Intergenic
981788226 4:148504830-148504852 GAGAACATTTGGGAGACCCCTGG - Intergenic
984073545 4:175147161-175147183 TAGAAAATTGTGAAGACACTTGG - Intergenic
984141990 4:176014588-176014610 CAGTTCATTGGGTAGACTCTGGG - Intergenic
987255518 5:16146499-16146521 GAGAACAGTAGAAAGACCCTGGG + Intronic
988164649 5:27570696-27570718 GGGAACAGTGGGTAGCCTCTTGG + Intergenic
988688743 5:33550495-33550517 GAGAACCTGGGGAAGAACCTGGG - Intronic
988716891 5:33837063-33837085 GAGAACAATGGGAAAACCCTGGG + Intronic
989131848 5:38114652-38114674 GAGAAATGTGGGAAGAGTCTGGG - Intergenic
989669032 5:43892134-43892156 GGGACCAATGGGAAGAATCTTGG + Intergenic
991517883 5:67459559-67459581 GAGAATATTGGGCAGAATCCTGG - Intergenic
995288070 5:110414808-110414830 GTGAACATTGGGAAGATTTAAGG - Intronic
995526192 5:113052508-113052530 GCGAAGTTTGGGAAGACACTAGG - Intronic
996915087 5:128702899-128702921 GAAAAGATTTGGAAAACTCTTGG + Intronic
998455506 5:142269626-142269648 GGGTAGAATGGGAAGACTCTGGG - Intergenic
998999169 5:147900969-147900991 GAGAACATTGGGAAGACTCTGGG + Intronic
1002294669 5:178223763-178223785 GACAACAGAGGGAAGACTGTTGG - Intronic
1003083874 6:3045450-3045472 GAGAACATCTGGAAGACACAGGG + Intergenic
1003768249 6:9265996-9266018 GAAAACCTTGAGAAGACTCAAGG - Intergenic
1005882080 6:30069548-30069570 GAGAACAAAAGGAAGACACTGGG - Exonic
1005953809 6:30649670-30649692 GGGAACCTGGGGAAGACGCTGGG - Exonic
1008100401 6:47384626-47384648 GAAAACATTGGGGAAACTCCAGG - Intergenic
1009276444 6:61687539-61687561 CAGAACATCTGTAAGACTCTGGG - Intronic
1009356062 6:62747118-62747140 GAGAGCAATTGGAAGACTTTTGG - Intergenic
1009997050 6:70907417-70907439 GAGAGCATTGGAAAGACTTCAGG + Intronic
1012330894 6:97985386-97985408 GAAAACATAGGGAAAAGTCTTGG + Intergenic
1014350225 6:120332882-120332904 GATAACATAGGGAAAAATCTAGG + Intergenic
1015483193 6:133738873-133738895 CAGCACCTTTGGAAGACTCTTGG + Intergenic
1015705482 6:136083193-136083215 GAGAACAGTCGGAAGACTGAGGG + Intronic
1016252763 6:142065861-142065883 GAAAACATTGGGGAAACTCTAGG - Intronic
1016270241 6:142280143-142280165 GAGCACACAGGGAAGACTTTAGG - Intergenic
1019210936 6:170404104-170404126 GGGAACGTTGGGAAGAGACTCGG - Intronic
1019436229 7:1023586-1023608 GAGAACATGACGAAGACTGTGGG + Intronic
1020679702 7:11221168-11221190 GAGCAGGTTGGGAAGACTGTAGG + Intergenic
1023781428 7:43659683-43659705 GAGAATAAAGGGAGGACTCTAGG - Intronic
1024123683 7:46270406-46270428 CAGCACTTTGGGAAGACTGTGGG - Intergenic
1024310695 7:47966379-47966401 GTGAATGTTGGGAAGACACTTGG + Intronic
1027298277 7:76801488-76801510 GAGCAGCTTGGGAAGCCTCTGGG - Intergenic
1027996541 7:85432883-85432905 GAAAACATTGGGGAAACTCCAGG + Intergenic
1028231157 7:88307530-88307552 GAGATCATTGGGAAGACTCTGGG - Intergenic
1028387568 7:90274862-90274884 GAGAAGATTTGGAGAACTCTTGG + Intronic
1029834909 7:103298671-103298693 GAGTAGCTTCGGAAGACTCTGGG + Exonic
1032578060 7:133076612-133076634 GAGATGAGTGGGAAGACTGTAGG - Intronic
1036631212 8:10517145-10517167 AAGAAAAATGGGAAAACTCTAGG + Intergenic
1037260299 8:17001168-17001190 GTGAACATTTGCAAGTCTCTAGG + Intronic
1038191943 8:25330386-25330408 GAGAACTATGGGAAGAGTCAAGG + Intronic
1042302349 8:67298623-67298645 GAAAAACTTTGGAAGACTCTAGG + Intronic
1042449863 8:68931922-68931944 GAGAACATGGGGAATACTCCAGG - Intergenic
1042818978 8:72909532-72909554 GAGAACAATGGGAAGATTAGAGG + Intronic
1044132531 8:88542862-88542884 GAAAACCTTGGGAAGAGTCTTGG + Intergenic
1044170120 8:89040897-89040919 GAGAACATTCCGAAGAATTTTGG - Intergenic
1044394730 8:91697458-91697480 GATAACACTGGGGAAACTCTAGG - Intergenic
1044474777 8:92613386-92613408 GATATCACTGGGAAAACTCTGGG + Intergenic
1044688935 8:94857439-94857461 GAGAACATTGGGAAAAATGAAGG + Intronic
1044863487 8:96546314-96546336 GAGAATATGGTCAAGACTCTAGG - Intronic
1045183007 8:99806390-99806412 GAAAACATTGGGAAGCAGCTGGG - Intronic
1046999353 8:120558128-120558150 CAGATCATTGGGAAGAATCTTGG - Intronic
1047622290 8:126620275-126620297 CATCACATTGGGAAGGCTCTGGG + Intergenic
1051014434 9:12458516-12458538 GAGAAAATTGAGAAGATCCTGGG - Intergenic
1052822155 9:33145977-33145999 GAGGACATGGGGAAACCTCTGGG + Intronic
1053535374 9:38920334-38920356 GAGATGAGTGGGAAGACTCAGGG - Intergenic
1054207595 9:62144738-62144760 GAGATGAGTGGGAAGACTCAGGG - Intergenic
1054630757 9:67443616-67443638 GAGATGAGTGGGAAGACTCAGGG + Intergenic
1055862812 9:80773888-80773910 GAGAACAGTGGGCAGAGTTTTGG - Intergenic
1055931670 9:81565666-81565688 GAGATCACTGGGAACACCCTAGG - Intergenic
1059496685 9:114715691-114715713 GAGGACATGGGGAGGGCTCTGGG + Intergenic
1059796528 9:117703633-117703655 AAGAAGATTGGGAAAAGTCTGGG - Intergenic
1060592175 9:124824391-124824413 GTGAACCTGGGGAAGAGTCTAGG - Intergenic
1061962319 9:133994322-133994344 CAGCACAGTGGGAAGCCTCTGGG - Intergenic
1185653389 X:1665545-1665567 GAGAACCCTGTGAAGACACTGGG - Intergenic
1187149753 X:16670619-16670641 AGGAACATTGGGAAAACTCCAGG - Exonic
1187610253 X:20935316-20935338 GAAAACATTGGGGAAACTCCAGG - Intergenic
1187709343 X:22038273-22038295 AATAACCTTGGTAAGACTCTTGG - Intronic
1188122747 X:26329475-26329497 GAGAAAATAGGGAAGAGACTTGG - Intergenic
1188667990 X:32848219-32848241 ACGAACATTTGGAAGACACTGGG + Intronic
1189171468 X:38913708-38913730 GAGCACGTTGGGAAGGCTCCTGG + Intergenic
1192552452 X:72065096-72065118 GAAAAATTTGAGAAGACTCTTGG + Intergenic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1194020321 X:88682153-88682175 GAGCACAATGGGAAGACATTGGG + Intergenic
1194312428 X:92328531-92328553 AATAACATTGGTAAAACTCTAGG + Intronic
1198781804 X:140245966-140245988 GATAACATTGGAAAAACCCTTGG - Intergenic
1199371019 X:147048078-147048100 GAAAACATTGGGGAAACTCCAGG + Intergenic
1199683571 X:150244308-150244330 GAGACCAATGGGAACTCTCTAGG - Intergenic
1199843841 X:151676461-151676483 GAAAACTTTGAGCAGACTCTTGG - Exonic
1200143350 X:153913063-153913085 GAGAACATTGGTCTGCCTCTCGG + Intronic
1200620695 Y:5442662-5442684 AATAACATTGGTAAAACTCTAGG + Intronic