ID: 999001643

View in Genome Browser
Species Human (GRCh38)
Location 5:147930126-147930148
Sequence TGAAGCAGCATGGAGAAAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999001643_999001649 23 Left 999001643 5:147930126-147930148 CCGGTTTTCTCCATGCTGCTTCA No data
Right 999001649 5:147930172-147930194 GTGGTGTCTTGTCTACAGTAGGG No data
999001643_999001645 4 Left 999001643 5:147930126-147930148 CCGGTTTTCTCCATGCTGCTTCA No data
Right 999001645 5:147930153-147930175 GTGTTGACTCTGTCCCACTGTGG No data
999001643_999001648 22 Left 999001643 5:147930126-147930148 CCGGTTTTCTCCATGCTGCTTCA No data
Right 999001648 5:147930171-147930193 TGTGGTGTCTTGTCTACAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999001643 Original CRISPR TGAAGCAGCATGGAGAAAAC CGG (reversed) Intergenic
No off target data available for this crispr