ID: 999004654

View in Genome Browser
Species Human (GRCh38)
Location 5:147962423-147962445
Sequence ATAGTCTCAGCCCAGAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999004654_999004655 -8 Left 999004654 5:147962423-147962445 CCTGTCTTCTGGGCTGAGACTAT No data
Right 999004655 5:147962438-147962460 GAGACTATGATCCTTCCATTAGG No data
999004654_999004658 17 Left 999004654 5:147962423-147962445 CCTGTCTTCTGGGCTGAGACTAT No data
Right 999004658 5:147962463-147962485 GTGTATTCTGCCCCTAGCCCTGG No data
999004654_999004663 28 Left 999004654 5:147962423-147962445 CCTGTCTTCTGGGCTGAGACTAT No data
Right 999004663 5:147962474-147962496 CCCTAGCCCTGGATGGAGCTGGG No data
999004654_999004659 21 Left 999004654 5:147962423-147962445 CCTGTCTTCTGGGCTGAGACTAT No data
Right 999004659 5:147962467-147962489 ATTCTGCCCCTAGCCCTGGATGG No data
999004654_999004661 27 Left 999004654 5:147962423-147962445 CCTGTCTTCTGGGCTGAGACTAT No data
Right 999004661 5:147962473-147962495 CCCCTAGCCCTGGATGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999004654 Original CRISPR ATAGTCTCAGCCCAGAAGAC AGG (reversed) Intergenic
No off target data available for this crispr