ID: 999004657

View in Genome Browser
Species Human (GRCh38)
Location 5:147962453-147962475
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999004657_999004670 29 Left 999004657 5:147962453-147962475 CCATTAGGATGTGTATTCTGCCC No data
Right 999004670 5:147962505-147962527 TGGAAGCAGCTTCTGGATACAGG No data
999004657_999004663 -2 Left 999004657 5:147962453-147962475 CCATTAGGATGTGTATTCTGCCC No data
Right 999004663 5:147962474-147962496 CCCTAGCCCTGGATGGAGCTGGG No data
999004657_999004661 -3 Left 999004657 5:147962453-147962475 CCATTAGGATGTGTATTCTGCCC No data
Right 999004661 5:147962473-147962495 CCCCTAGCCCTGGATGGAGCTGG No data
999004657_999004667 9 Left 999004657 5:147962453-147962475 CCATTAGGATGTGTATTCTGCCC No data
Right 999004667 5:147962485-147962507 GATGGAGCTGGGCCTGCGCGTGG No data
999004657_999004669 22 Left 999004657 5:147962453-147962475 CCATTAGGATGTGTATTCTGCCC No data
Right 999004669 5:147962498-147962520 CTGCGCGTGGAAGCAGCTTCTGG No data
999004657_999004659 -9 Left 999004657 5:147962453-147962475 CCATTAGGATGTGTATTCTGCCC No data
Right 999004659 5:147962467-147962489 ATTCTGCCCCTAGCCCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999004657 Original CRISPR GGGCAGAATACACATCCTAA TGG (reversed) Intergenic
No off target data available for this crispr