ID: 999004659

View in Genome Browser
Species Human (GRCh38)
Location 5:147962467-147962489
Sequence ATTCTGCCCCTAGCCCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999004657_999004659 -9 Left 999004657 5:147962453-147962475 CCATTAGGATGTGTATTCTGCCC No data
Right 999004659 5:147962467-147962489 ATTCTGCCCCTAGCCCTGGATGG No data
999004654_999004659 21 Left 999004654 5:147962423-147962445 CCTGTCTTCTGGGCTGAGACTAT No data
Right 999004659 5:147962467-147962489 ATTCTGCCCCTAGCCCTGGATGG No data
999004656_999004659 -5 Left 999004656 5:147962449-147962471 CCTTCCATTAGGATGTGTATTCT No data
Right 999004659 5:147962467-147962489 ATTCTGCCCCTAGCCCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999004659 Original CRISPR ATTCTGCCCCTAGCCCTGGA TGG Intergenic
No off target data available for this crispr