ID: 999004663

View in Genome Browser
Species Human (GRCh38)
Location 5:147962474-147962496
Sequence CCCTAGCCCTGGATGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999004657_999004663 -2 Left 999004657 5:147962453-147962475 CCATTAGGATGTGTATTCTGCCC No data
Right 999004663 5:147962474-147962496 CCCTAGCCCTGGATGGAGCTGGG No data
999004656_999004663 2 Left 999004656 5:147962449-147962471 CCTTCCATTAGGATGTGTATTCT No data
Right 999004663 5:147962474-147962496 CCCTAGCCCTGGATGGAGCTGGG No data
999004654_999004663 28 Left 999004654 5:147962423-147962445 CCTGTCTTCTGGGCTGAGACTAT No data
Right 999004663 5:147962474-147962496 CCCTAGCCCTGGATGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999004663 Original CRISPR CCCTAGCCCTGGATGGAGCT GGG Intergenic
No off target data available for this crispr