ID: 999004667

View in Genome Browser
Species Human (GRCh38)
Location 5:147962485-147962507
Sequence GATGGAGCTGGGCCTGCGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999004656_999004667 13 Left 999004656 5:147962449-147962471 CCTTCCATTAGGATGTGTATTCT No data
Right 999004667 5:147962485-147962507 GATGGAGCTGGGCCTGCGCGTGG No data
999004657_999004667 9 Left 999004657 5:147962453-147962475 CCATTAGGATGTGTATTCTGCCC No data
Right 999004667 5:147962485-147962507 GATGGAGCTGGGCCTGCGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999004667 Original CRISPR GATGGAGCTGGGCCTGCGCG TGG Intergenic
No off target data available for this crispr