ID: 999004669

View in Genome Browser
Species Human (GRCh38)
Location 5:147962498-147962520
Sequence CTGCGCGTGGAAGCAGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999004656_999004669 26 Left 999004656 5:147962449-147962471 CCTTCCATTAGGATGTGTATTCT No data
Right 999004669 5:147962498-147962520 CTGCGCGTGGAAGCAGCTTCTGG No data
999004666_999004669 -6 Left 999004666 5:147962481-147962503 CCTGGATGGAGCTGGGCCTGCGC No data
Right 999004669 5:147962498-147962520 CTGCGCGTGGAAGCAGCTTCTGG No data
999004660_999004669 2 Left 999004660 5:147962473-147962495 CCCCTAGCCCTGGATGGAGCTGG No data
Right 999004669 5:147962498-147962520 CTGCGCGTGGAAGCAGCTTCTGG No data
999004664_999004669 0 Left 999004664 5:147962475-147962497 CCTAGCCCTGGATGGAGCTGGGC No data
Right 999004669 5:147962498-147962520 CTGCGCGTGGAAGCAGCTTCTGG No data
999004662_999004669 1 Left 999004662 5:147962474-147962496 CCCTAGCCCTGGATGGAGCTGGG No data
Right 999004669 5:147962498-147962520 CTGCGCGTGGAAGCAGCTTCTGG No data
999004657_999004669 22 Left 999004657 5:147962453-147962475 CCATTAGGATGTGTATTCTGCCC No data
Right 999004669 5:147962498-147962520 CTGCGCGTGGAAGCAGCTTCTGG No data
999004665_999004669 -5 Left 999004665 5:147962480-147962502 CCCTGGATGGAGCTGGGCCTGCG No data
Right 999004669 5:147962498-147962520 CTGCGCGTGGAAGCAGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999004669 Original CRISPR CTGCGCGTGGAAGCAGCTTC TGG Intergenic
No off target data available for this crispr