ID: 999004670

View in Genome Browser
Species Human (GRCh38)
Location 5:147962505-147962527
Sequence TGGAAGCAGCTTCTGGATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999004664_999004670 7 Left 999004664 5:147962475-147962497 CCTAGCCCTGGATGGAGCTGGGC No data
Right 999004670 5:147962505-147962527 TGGAAGCAGCTTCTGGATACAGG No data
999004657_999004670 29 Left 999004657 5:147962453-147962475 CCATTAGGATGTGTATTCTGCCC No data
Right 999004670 5:147962505-147962527 TGGAAGCAGCTTCTGGATACAGG No data
999004660_999004670 9 Left 999004660 5:147962473-147962495 CCCCTAGCCCTGGATGGAGCTGG No data
Right 999004670 5:147962505-147962527 TGGAAGCAGCTTCTGGATACAGG No data
999004666_999004670 1 Left 999004666 5:147962481-147962503 CCTGGATGGAGCTGGGCCTGCGC No data
Right 999004670 5:147962505-147962527 TGGAAGCAGCTTCTGGATACAGG No data
999004662_999004670 8 Left 999004662 5:147962474-147962496 CCCTAGCCCTGGATGGAGCTGGG No data
Right 999004670 5:147962505-147962527 TGGAAGCAGCTTCTGGATACAGG No data
999004665_999004670 2 Left 999004665 5:147962480-147962502 CCCTGGATGGAGCTGGGCCTGCG No data
Right 999004670 5:147962505-147962527 TGGAAGCAGCTTCTGGATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999004670 Original CRISPR TGGAAGCAGCTTCTGGATAC AGG Intergenic
No off target data available for this crispr