ID: 999007306

View in Genome Browser
Species Human (GRCh38)
Location 5:147996880-147996902
Sequence TAAACTCCAAGGTGTTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999007299_999007306 17 Left 999007299 5:147996840-147996862 CCTGAAGTCGGGGCACTCCGGGG No data
Right 999007306 5:147996880-147996902 TAAACTCCAAGGTGTTCTGCTGG No data
999007302_999007306 0 Left 999007302 5:147996857-147996879 CCGGGGCCTCTGACCGCTTTGGC No data
Right 999007306 5:147996880-147996902 TAAACTCCAAGGTGTTCTGCTGG No data
999007303_999007306 -6 Left 999007303 5:147996863-147996885 CCTCTGACCGCTTTGGCTAAACT No data
Right 999007306 5:147996880-147996902 TAAACTCCAAGGTGTTCTGCTGG No data
999007297_999007306 18 Left 999007297 5:147996839-147996861 CCCTGAAGTCGGGGCACTCCGGG No data
Right 999007306 5:147996880-147996902 TAAACTCCAAGGTGTTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999007306 Original CRISPR TAAACTCCAAGGTGTTCTGC TGG Intergenic
No off target data available for this crispr