ID: 999011803

View in Genome Browser
Species Human (GRCh38)
Location 5:148050115-148050137
Sequence CACTAAAAAGAGTAGCTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999011803 Original CRISPR CACTAAAAAGAGTAGCTACA TGG (reversed) Intronic
901513295 1:9729153-9729175 GTCTAAACAGAGCAGCTACAGGG + Exonic
904274555 1:29371853-29371875 GAGAAAAAAGAGTAGCTTCATGG - Intergenic
905597792 1:39223453-39223475 CATTAGAAAGAATAGATACAAGG + Intronic
910235497 1:85031697-85031719 CACTGGAAATGGTAGCTACATGG + Intronic
912722213 1:112029782-112029804 CAGTCAAAAATGTAGCTACAGGG + Intergenic
913172372 1:116244331-116244353 TACTAATAAGAGAAGCAACAAGG - Intergenic
917838262 1:178957809-178957831 AACTGAAATGAGTAGCTAGAAGG + Intergenic
919267805 1:195295002-195295024 CACTAATAAGAAGAGCTACCCGG + Intergenic
920764955 1:208823498-208823520 CACTAGAAAGAGTCACTAAAAGG - Intergenic
921742991 1:218707748-218707770 CACCAAGAAGAGTTGCAACATGG + Intergenic
1062812037 10:474162-474184 CATGAAAAACAGTAGCTACCTGG + Intronic
1066353105 10:34655740-34655762 CAATACAAAGAGTAGACACAAGG + Intronic
1069820470 10:71224512-71224534 CACAAAGCAGATTAGCTACATGG - Intronic
1070474783 10:76819797-76819819 CAGAAAAAAGAGTAGAGACACGG - Intergenic
1071378144 10:85031549-85031571 CACAAAAAAGAGCAATTACAGGG - Intergenic
1073219848 10:101862132-101862154 CACTAGAAATAGTAAATACATGG + Intronic
1075248550 10:120846079-120846101 CAGAAAAAAGAGTAGAGACACGG - Intergenic
1075607946 10:123829077-123829099 CACTAAAAAGGATATCTAGATGG + Intronic
1081356666 11:42121805-42121827 CAGAAAAAAGAGTAGAGACACGG - Intergenic
1087539310 11:99495005-99495027 CACTAAAAAGTGTTGATACAGGG + Intronic
1094608369 12:31969346-31969368 CATTAAAAAAATTAGCCACACGG + Intronic
1098787550 12:74779270-74779292 CACAGAACAGAGTAGCTTCATGG + Intergenic
1098933048 12:76443300-76443322 CAAGAATGAGAGTAGCTACAAGG + Intronic
1100549302 12:95632194-95632216 CACTAAATCGAATAACTACAAGG + Intergenic
1109492453 13:63119591-63119613 CACTAAACAGAAAAGCTACGAGG - Intergenic
1109697874 13:65984572-65984594 AAATAAAAAGAGTTGCAACAAGG - Intergenic
1117909519 14:60623570-60623592 CCCAATAAAGAGTAGCTCCATGG + Intergenic
1118170720 14:63386021-63386043 CTCTAAAAAGGGTAGTTACAGGG + Intronic
1124234813 15:27980455-27980477 TACTGAAAAGGGTAACTACATGG - Intronic
1130131872 15:81150432-81150454 CACAAAAAAGAATAGTTACAAGG - Intergenic
1130793556 15:87183104-87183126 CACTAGAAATGGTAACTACATGG + Intergenic
1131675365 15:94665691-94665713 CACCAAAGAATGTAGCTACAGGG + Intergenic
1131808869 15:96151981-96152003 CATCAAAAAGTGTAGCTATACGG + Intergenic
1136638574 16:31542147-31542169 CACTAGAAAGTGTTGCCACAAGG + Intergenic
1138770088 16:59652703-59652725 CACTATAAAGAATACCCACAGGG - Intergenic
1139158149 16:64469219-64469241 CTCCAAAAAGAGTTACTACAAGG + Intergenic
1141438836 16:84016372-84016394 CAATAAAAAGGGCACCTACATGG + Intronic
1141510805 16:84510890-84510912 CATCAAAAACAGCAGCTACATGG + Intronic
1143351194 17:6289420-6289442 CACTTCATAGAGTTGCTACAAGG + Intergenic
1148390330 17:47267597-47267619 CATTAAAAAGAGTGGATAAAGGG + Intronic
1154093672 18:11389256-11389278 CACTAAAAAGACTTCCTCCATGG - Intergenic
1159319037 18:66822234-66822256 CAATCAAAAGAGTAGCTAAATGG - Intergenic
1161661572 19:5549717-5549739 CAGAAAAAAGAGTAGAGACACGG - Intergenic
1164714681 19:30382886-30382908 CACAAAGAAGAGTAGCTCCCTGG - Intronic
1166342158 19:42144634-42144656 AAGTAACAAGAGCAGCTACATGG + Intronic
927330479 2:21856914-21856936 CACTAAAATGAGAAGCCAGAAGG + Intergenic
928187344 2:29124063-29124085 CACTAGAAATGGTAACTACATGG - Intronic
928899873 2:36305535-36305557 CACTAAAATGAGAAAGTACAAGG - Intergenic
930159941 2:48144652-48144674 GAGTAAAAAGAATCGCTACAGGG - Intergenic
930397398 2:50840654-50840676 CACACAAAAGAGAAGCGACATGG + Intronic
931124244 2:59256139-59256161 CAGTAGAAACAGTTGCTACATGG + Intergenic
933564709 2:83935821-83935843 GACATAAAAGAGTAGGTACAAGG - Intergenic
940321795 2:152385171-152385193 CACCAAAAAGAGTTGCTTCATGG - Intronic
940651258 2:156443216-156443238 GCATAAAAAGAGTAGCTAAAGGG - Intronic
943746683 2:191469473-191469495 AAATAAAAAAAGTAGCAACAAGG - Intergenic
945022408 2:205586853-205586875 CATTAAAAAAAATAACTACAGGG - Intronic
945262452 2:207856491-207856513 CAGTAAAAAGATGAGTTACAGGG - Intronic
1170019020 20:11815061-11815083 TACTAAAACCAGTAGCTATATGG + Intergenic
1172622225 20:36326641-36326663 CACTGAAAATAATAACTACATGG - Intronic
1174988993 20:55488262-55488284 AAATAAAAAGAGGACCTACAAGG + Intergenic
1179263660 21:39782273-39782295 CACTAAAACGGAAAGCTACAAGG - Intronic
1179348612 21:40585297-40585319 CACTCAATAGAGTATCTTCATGG - Intronic
1182507466 22:30794562-30794584 CATTAAAAAAAGAAGGTACAGGG - Intronic
949233851 3:1784739-1784761 TACTGAAATGAGTAGATACATGG - Intergenic
950782458 3:15403783-15403805 CACTCAACAGAGTAGCCCCAAGG + Intronic
952000851 3:28784313-28784335 CACTACAAACAATTGCTACATGG - Intergenic
952510301 3:34046216-34046238 TACTAAGAAGAGTATGTACATGG - Intergenic
956374281 3:68597611-68597633 TACTGAAAAGATTAGCTGCAAGG + Intergenic
956874779 3:73451566-73451588 CACTAAAGAGAGTAAATAAATGG + Intronic
956874857 3:73452295-73452317 CACTAAAGAGAGTAAATAAATGG + Intronic
957241991 3:77671611-77671633 CACTAAAACAAGTAACCACATGG - Intergenic
958093952 3:88916279-88916301 TACAAGAAAGAGTAGCTACAGGG - Intergenic
958540914 3:95470406-95470428 GAGTAAAAATAGTAGCTACCTGG - Intergenic
959179334 3:102958521-102958543 AACTAAAAAGTGTATCTAAATGG - Intergenic
959603577 3:108217457-108217479 CAATATAAAGAATGGCTACATGG - Intronic
960094255 3:113673092-113673114 CACTTAAAACACTAGCTCCAGGG + Intronic
960654910 3:119992164-119992186 CACCAAAAAGAAAAGCTACAAGG + Intronic
960726426 3:120674893-120674915 CACCAATAAGAGAAGGTACAAGG - Exonic
962110700 3:132443691-132443713 CTCTAAAAAGAGGAGCGGCATGG + Intronic
963753107 3:149203206-149203228 CACAATAAAGAGTAGCCACTGGG - Intronic
963995500 3:151703601-151703623 CACTGCAAAGTGTTGCTACAAGG + Intergenic
964029842 3:152124785-152124807 CACTAAAGTGAGTAGTTGCAGGG + Intergenic
964063879 3:152558165-152558187 CAGTAAAAAGAGTGGCTGCATGG + Intergenic
966745490 3:183271508-183271530 CTCTAACACCAGTAGCTACATGG - Exonic
967483335 3:190000372-190000394 CACTAAACAGAATACCTACGTGG + Intronic
970150712 4:13086745-13086767 GGCTAAAAAGGGTATCTACAAGG - Intergenic
971348079 4:25829944-25829966 AAGTACAAAGACTAGCTACAGGG + Intronic
971881945 4:32386856-32386878 CATTTAAAAGAGTAGTTACTGGG + Intergenic
972117307 4:35652465-35652487 CAGTAAAAATAGTAGTTATAGGG + Intergenic
973107796 4:46361585-46361607 CACCAAACAGAGTCGCTACTGGG + Intronic
974165786 4:58199670-58199692 CACAAAAAAGATTAGCAATATGG - Intergenic
974320440 4:60341349-60341371 CACTAAAAAGAGAAAATTCAGGG - Intergenic
977108968 4:92926203-92926225 CACTAAACAAAATAACTACAAGG + Intronic
977198578 4:94089108-94089130 CAGAAAAAAGAGTAGAGACACGG + Intergenic
977913552 4:102564861-102564883 CACTTAAAAGTGTAATTACATGG + Intronic
978436990 4:108696094-108696116 CCTTAAAAAGAGTAGTTTCAGGG + Intergenic
978524367 4:109650209-109650231 CTCTAAAAAGGGTTGTTACAGGG + Intronic
978624908 4:110674414-110674436 CAGTAGAGAGAGTAGCTCCAAGG + Intergenic
978972307 4:114823480-114823502 CAATATAAAGAGAAGGTACAAGG + Intergenic
979895313 4:126149621-126149643 CAGAAAAAAGAGTAGAGACACGG + Intergenic
979974622 4:127181727-127181749 AACTTTAAAGAGAAGCTACATGG + Intergenic
980597120 4:134968635-134968657 CACTGGTAAGAGTAGGTACATGG + Intergenic
981639897 4:146929316-146929338 CACTGAAAAGGGTGGCTGCAGGG + Intronic
982194996 4:152902525-152902547 GACTAAACAGAGTAGATATAAGG + Intronic
982974587 4:162038587-162038609 CAGTTAAAAGACTAGCAACATGG - Intronic
984417634 4:179481285-179481307 TACATAAAAGAGTAGGTACAGGG + Intergenic
986184421 5:5422703-5422725 CACTAAAAAGAAACGCTACCCGG - Exonic
987487354 5:18539535-18539557 CAGAAAAAAGAGTAGAGACATGG - Intergenic
989420339 5:41231156-41231178 CAATTAAAAGAGTAGCTAAGTGG - Intronic
990387141 5:55276769-55276791 AAATAAAAAGAGTGGCTACCTGG - Intronic
990759481 5:59112616-59112638 TTCTAAAAAGAGTAGACACAGGG + Intronic
993857251 5:93091935-93091957 CACTGAAAAAAGTGGCAACAGGG + Intergenic
994960510 5:106595821-106595843 CAATAGAAAGAGAAGCTAAAAGG - Intergenic
997890481 5:137672081-137672103 CAGTAAAAAGAGTAACGCCAAGG + Intronic
999011803 5:148050115-148050137 CACTAAAAAGAGTAGCTACATGG - Intronic
1001670022 5:173466151-173466173 CATTAAAAAGAGTACACACATGG - Intergenic
1002867930 6:1139963-1139985 CACTGGAAATGGTAGCTACATGG + Intergenic
1011648551 6:89483793-89483815 CAAGAACAAGATTAGCTACAAGG + Intronic
1011775064 6:90720894-90720916 CACCAAAAAAACTAGTTACAAGG + Intergenic
1012083493 6:94791908-94791930 GTCTAAAAAGAGTACTTACAGGG + Intergenic
1013189625 6:107791105-107791127 CACTAAAAATAGAGGCAACAGGG + Intronic
1014361012 6:120473780-120473802 GGCTAAAAAGATTAGCCACAGGG - Intergenic
1014481328 6:121941242-121941264 AACTAGAAAGAGTATCTAAATGG - Intergenic
1018339437 6:162835372-162835394 CAATAAAAAGAGTAGGGAGAAGG - Intronic
1020339186 7:7090959-7090981 CACAAAAGAGGGTAGCTATATGG - Intergenic
1020472064 7:8548905-8548927 CAGTAAAAGGAGTAGTTAAATGG + Intronic
1021842884 7:24735454-24735476 AATTAAAAATAGTAACTACAGGG + Intronic
1027532791 7:79355440-79355462 CCATAAAACTAGTAGCTACAAGG - Intronic
1027591003 7:80119179-80119201 CACTAAGAAAAATGGCTACAGGG + Intergenic
1028018639 7:85744474-85744496 CCCTAAAAAGAGGTGCCACAAGG - Intergenic
1028162060 7:87497189-87497211 CACTTAAAATAATTGCTACATGG + Intergenic
1030488446 7:110201634-110201656 CAATAAAAAGAGTAGCTGAATGG - Intergenic
1030612976 7:111708790-111708812 CATTAAAAATATTAGCTAAAAGG - Intergenic
1031402909 7:121346513-121346535 CACTTAAAATGGTAGCTACTTGG + Intergenic
1032941232 7:136794981-136795003 CACTATAGAGAGTAGCTTAAAGG + Intergenic
1039071605 8:33653928-33653950 CACTAAAAAGACTTGGTTCATGG + Intergenic
1039362518 8:36893867-36893889 AACTATAAAAAGTAACTACAAGG - Intronic
1043788003 8:84426403-84426425 AACGCAAAAGAGTAGTTACAAGG - Intronic
1044420316 8:91987758-91987780 CACTAAAAAGAGAGGCTGAAAGG + Intronic
1045531174 8:102986990-102987012 CAGTAAAAAGAATAGTTTCATGG - Intergenic
1047778621 8:128093568-128093590 AAATAAAAAGAGTTGCTATAAGG + Intergenic
1048468291 8:134685452-134685474 AACTAAGAAAAGTAGCTACGTGG + Intronic
1048567256 8:135614717-135614739 CAAAAAAAAGAGTAGAGACAGGG + Intronic
1049937611 9:514312-514334 CTCTAAAAATAATAGCTTCAGGG + Intronic
1051950833 9:22630837-22630859 CACACAAAAAACTAGCTACAGGG + Intergenic
1053518771 9:38755337-38755359 CCATAAAAAGAGAAGCTAAATGG - Intergenic
1056182475 9:84098928-84098950 CAATAAAAAGATGAACTACATGG - Intergenic
1058167139 9:101633043-101633065 CTCTACACAGAGTACCTACATGG + Intronic
1186822911 X:13309758-13309780 AACTAAAAAGAGGGGCTATAGGG + Intergenic
1187105940 X:16241819-16241841 CACAAAAAAGAATAGCCATAGGG + Intergenic
1189736873 X:44080378-44080400 CACTAAAAACATTTGCTGCAAGG + Intergenic
1194443321 X:93959195-93959217 CACAAAGAAGAGCAACTACAGGG - Intergenic
1194705009 X:97164690-97164712 CACCAAAAAAAGTAGCAATAAGG - Intronic
1194742468 X:97590369-97590391 AAACAAAAAGAGTAGATACATGG + Intronic
1195908828 X:109869698-109869720 CAGAAAAAAGAGTAGAGACACGG + Intergenic
1197697396 X:129565301-129565323 CACTAAGAAAAGTAGGTCCAGGG - Intronic
1198658960 X:138945656-138945678 AACTAAAAAGAATAGGTACATGG + Intronic
1198736760 X:139794046-139794068 CACAAAGAAGAGTAGCCCCACGG + Intronic
1200766944 Y:7088117-7088139 CACTAAAAAGAGTAGAAAAAGGG + Intronic
1201313206 Y:12616333-12616355 CAAAAAAGAGAGTGGCTACAAGG - Intergenic