ID: 999013144

View in Genome Browser
Species Human (GRCh38)
Location 5:148065353-148065375
Sequence AACCTGATCTTCATTCTTAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 161}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999013144 Original CRISPR AACCTGATCTTCATTCTTAC TGG (reversed) Exonic
900730435 1:4255461-4255483 GGCCTCATCTTCCTTCTTACTGG - Intergenic
902147169 1:14412079-14412101 AACTTGATGTTCATTCTCAGGGG + Intergenic
902307029 1:15549193-15549215 AACCTGCTCTTCTTTCTTTACGG - Intronic
920393898 1:205630118-205630140 TACTTGATTTTCCTTCTTACAGG + Intronic
920447599 1:206030897-206030919 AAGCTGCTCTTCCTGCTTACAGG - Intergenic
921989156 1:221345575-221345597 AACCTGATTTTAAGTCTTCCTGG - Intergenic
923810224 1:237306952-237306974 AAGCTGATTTTAACTCTTACGGG + Intronic
1063165006 10:3453823-3453845 AACCTGATGTTCTCTATTACTGG + Intergenic
1064599234 10:16976268-16976290 ATCCTCACCTTCATTCTTAAAGG + Intronic
1064985312 10:21204146-21204168 CACCTGAACTTCAGTCCTACTGG + Intergenic
1065976272 10:30845583-30845605 AATCTTATCTTCATTATTATTGG - Intronic
1066122927 10:32308789-32308811 ATACTGATTTTCATTCTTTCGGG - Intronic
1067913105 10:50367098-50367120 AAACTTAACTTCATTCTGACTGG - Intronic
1068830524 10:61489740-61489762 GACCTGATCCCCATTCTTAGTGG + Intergenic
1072249341 10:93569169-93569191 CACCTCATTTTCTTTCTTACAGG + Intronic
1074795874 10:116943201-116943223 CACCTGGTCTTCAGTCTTAGTGG - Intronic
1083195483 11:61083296-61083318 AACCTGATCTTCATAACAACCGG - Intergenic
1084995169 11:72969887-72969909 GACCTGACCCTCATTATTACAGG + Intronic
1085604686 11:77886367-77886389 TACCTGATGATCATTCATACTGG - Intronic
1088702423 11:112425424-112425446 AACCTTATTTTGATTGTTACTGG + Intergenic
1091371285 11:135060992-135061014 ACCCTGACCTTCATTTTCACTGG + Intergenic
1094337501 12:29376647-29376669 AATCTGCTCTTCATTTTCACTGG + Intronic
1095428080 12:42099884-42099906 ATCCTTATCTTCATTTTAACTGG + Intronic
1097072378 12:56364508-56364530 CACCTCATCTTCACTCTTAAAGG + Intergenic
1097603065 12:61719133-61719155 AACCTGATCTTAATTATTTCTGG + Intronic
1098249851 12:68558258-68558280 AACCTTGTCCTCACTCTTACAGG + Intergenic
1099980450 12:89595445-89595467 AGTCAGATCTTCACTCTTACAGG - Intronic
1101648318 12:106652046-106652068 AGGCTGATTTTCATTCATACTGG + Intronic
1104093565 12:125536124-125536146 ACCCTGTCCTTCATTCTTAAAGG - Intronic
1104200328 12:126582989-126583011 CACCTGCTCTTCTTTCTTCCTGG + Intergenic
1108769098 13:53675389-53675411 AAACTGATTTTCAGTTTTACAGG - Intergenic
1114276957 14:21155262-21155284 ATCCTGCTCTTCATTTTTGCTGG - Exonic
1115797561 14:36956020-36956042 AATCTGATGTGCATTCTTTCAGG + Intronic
1116226459 14:42159748-42159770 AACCTGCTCTTCTTTGTGACCGG - Intergenic
1116656569 14:47660822-47660844 AACCATTTCTTCATTTTTACAGG + Intronic
1118370864 14:65136175-65136197 AACCTGCTGTTTATTCTTAGGGG - Intergenic
1120180051 14:81334065-81334087 AACCTGACATGCATTCTCACTGG - Intronic
1124448413 15:29761350-29761372 TAGCTTATCTTCATTATTACTGG - Intronic
1124508087 15:30296232-30296254 AACCTGATCCTCACTCTAATGGG + Intergenic
1124735467 15:32242424-32242446 AACCTGATCCTCACTCTAATGGG - Intergenic
1124928468 15:34096014-34096036 AACATGATTTTCATTTTTCCAGG - Exonic
1125362726 15:38881141-38881163 TAAATGATCATCATTCTTACTGG - Intergenic
1125712344 15:41797184-41797206 CAGCTGATCTTCTTTCTAACAGG - Intronic
1125758561 15:42082228-42082250 AGCCTTATCTTCATTCTTACTGG + Intronic
1126603652 15:50454161-50454183 GCCCTCATCTTCATTCTTAAGGG + Intronic
1127542596 15:59956211-59956233 AACATGATGTTCATTCTAAGTGG - Intergenic
1127614418 15:60669585-60669607 AACCTGCTCTCTGTTCTTACTGG + Intronic
1130743857 15:86629578-86629600 AACCTCATCTCCATTTTTATTGG - Intronic
1132685362 16:1159830-1159852 CACCCGAACTTCATTCTTGCCGG + Intronic
1133527208 16:6617284-6617306 AACCTGATCTTCCTGCTTGGAGG + Intronic
1133966931 16:10538320-10538342 CACCTGCTCTGCATTCTTCCTGG + Intronic
1139695160 16:68669114-68669136 AACCTGATCTTGCTGCTTCCTGG + Intronic
1140533777 16:75690474-75690496 AACCTGATCGCCAGCCTTACTGG - Intronic
1141679769 16:85537283-85537305 ATCCTGATTTTGATTCTCACAGG + Intergenic
1144152021 17:12457395-12457417 AACATGATCTTTGCTCTTACTGG + Intergenic
1147694725 17:42342903-42342925 AACATGATCTTCTTTCTGCCTGG + Intronic
1148022531 17:44562865-44562887 AACCTAATCTTAATTCTTTGGGG - Intergenic
1148100980 17:45091248-45091270 ACCCTGTACTTCATTCTTACTGG + Intronic
1148216985 17:45838718-45838740 AACCAGACCTTCAATCTTAGGGG - Intergenic
1149575862 17:57712410-57712432 AAGCTGGTGTTCATTGTTACTGG + Intergenic
1150182386 17:63137963-63137985 AACCTGTTCTCCATTTTTCCTGG + Intronic
1153607789 18:6852687-6852709 GACCTAATCCTTATTCTTACAGG + Intronic
1155700866 18:28741805-28741827 AAAATGATCTTCCTACTTACTGG + Intergenic
1155815329 18:30300721-30300743 ATCCAGGTCTCCATTCTTACTGG + Intergenic
1158161770 18:54492979-54493001 AACCTGTTTTTAAATCTTACTGG - Intergenic
1158548373 18:58414879-58414901 AACCTCTTCTTCATTCATTCTGG + Intergenic
1158842116 18:61398800-61398822 AGCGTAATCTTCTTTCTTACTGG - Intronic
1165660012 19:37569828-37569850 TACCTGTTTTTCATTCTTTCAGG + Intronic
1166130527 19:40743144-40743166 AACCTGGCCTTCTTTCTTTCAGG + Intronic
1166220487 19:41361203-41361225 AACCTGATTTTTATTATTTCAGG - Intronic
1166951357 19:46430217-46430239 ATCCTTACCTTCATTCTGACTGG - Intergenic
927595909 2:24397133-24397155 AACCGGATGTTCCTACTTACAGG + Intergenic
929059093 2:37905057-37905079 GACCTGATTTTCATTCGTAAAGG - Intergenic
930877628 2:56236929-56236951 AACAGAATCATCATTCTTACAGG - Intronic
931008420 2:57879722-57879744 AACTTTCTCTTCATTTTTACAGG + Intergenic
933777847 2:85781992-85782014 ATGCTGCTCTTGATTCTTACTGG - Intronic
937051268 2:118893098-118893120 AACCAGATGATCACTCTTACTGG - Intergenic
937735369 2:125281607-125281629 TAACTGATCTCCATTCTAACTGG - Intergenic
939188998 2:138893879-138893901 AACCTGATCTTCAGTCTCTCAGG + Intergenic
939194981 2:138960774-138960796 CACCTGATCATCATTTTTAAAGG - Intergenic
941450128 2:165651120-165651142 AACCTGGTCTTCAATTTTACAGG + Intronic
942806821 2:179940604-179940626 AACCTTGTCTTCATTTTAACAGG + Intergenic
943579338 2:189666434-189666456 AATCTCAGATTCATTCTTACAGG - Exonic
948358396 2:237398994-237399016 ATGCTGATCCTCATGCTTACAGG + Intronic
1170333458 20:15241581-15241603 AACATGATCTTCAGTAATACAGG - Intronic
1170530026 20:17281829-17281851 CACCTGATTCTCATGCTTACTGG + Intronic
1170964098 20:21051056-21051078 AGCTTGAACTTCATTATTACAGG + Intergenic
1182854158 22:33502346-33502368 CACCTGCTCTTCCTTCGTACTGG - Intronic
951428762 3:22581903-22581925 ATCCTGACCCTCATTCTTAGTGG + Intergenic
951454254 3:22872860-22872882 ATCTTGATCTTCATACTTATTGG - Intergenic
952113095 3:30147178-30147200 ATACTGAGCTTCACTCTTACAGG + Intergenic
956288623 3:67637643-67637665 AACCTGATCTTCATGCTCCAGGG + Intronic
957317822 3:78590998-78591020 AACTTGATTTTCATTCTTGAAGG + Intergenic
957381568 3:79436720-79436742 AACATGATCTTCATTTTTGTTGG - Intronic
957399546 3:79691067-79691089 ATCCTGCACTTGATTCTTACTGG - Intronic
957762001 3:84571434-84571456 AGCATGACATTCATTCTTACTGG - Intergenic
959228290 3:103614949-103614971 GACCTGACATTTATTCTTACAGG + Intergenic
959986591 3:112580156-112580178 AAGCTCATCTACATTCTTTCTGG + Intronic
961624873 3:128254906-128254928 ATCCTGATTTTCATTCTTAATGG - Intronic
963892627 3:150652735-150652757 AACTTGATGTTCTTTCTTTCTGG + Intergenic
963910066 3:150809147-150809169 GACATGATCTTCCTTCTTTCAGG - Intergenic
969172312 4:5373974-5373996 GACCTCATCCTTATTCTTACCGG - Intronic
969616952 4:8258869-8258891 AATCTGAACTTCATCCTTATGGG + Intergenic
970083090 4:12311910-12311932 AACCCAATCTTCCTTCTTAAGGG - Intergenic
970349967 4:15192498-15192520 TACCTGATCTTCTTGCTTAATGG - Intergenic
970974544 4:22028417-22028439 AGCCTTATCTTCATTCTCACTGG + Intergenic
971426860 4:26524637-26524659 AACATGATCTTCATTGTTTTGGG + Intergenic
972763656 4:42131752-42131774 AGCCTTGTCTTCAGTCTTACTGG - Intronic
975835675 4:78420088-78420110 AACCTGATCTTCTTTCTGTGAGG - Intronic
977379449 4:96253044-96253066 CACCTGAACTTCTTTCTCACTGG + Intergenic
978375195 4:108067859-108067881 ACACTGATCTTCCTACTTACAGG + Intronic
980415159 4:132478157-132478179 ATCTTGATCTTCATTCTACCCGG + Intergenic
980663094 4:135893066-135893088 GACCTGATTTGCATTCATACTGG - Intergenic
983258860 4:165433245-165433267 AACTTAATTTTCATACTTACTGG + Intronic
988371350 5:30371878-30371900 AACCTGTTGTTCAATCATACTGG - Intergenic
988811724 5:34791907-34791929 AACCCCATCGTCATTCTCACTGG + Intronic
989952538 5:50316733-50316755 AACCTTAGCTTCATTAGTACAGG - Intergenic
993047871 5:82888919-82888941 TAGCTGATCTTCATGCTTAGAGG - Intergenic
993268767 5:85765293-85765315 AACCTGATTTTCTTTCTTTTGGG + Intergenic
998893584 5:146773085-146773107 AACTTTATCTTCACTATTACAGG - Intronic
999013144 5:148065353-148065375 AACCTGATCTTCATTCTTACTGG - Exonic
999951233 5:156653269-156653291 AACTTGATATTCATTCTTTTCGG + Intronic
1000426463 5:161096702-161096724 AATCTGCTCTTCTTTCTTTCAGG + Intergenic
1003939966 6:11014770-11014792 ACTCTGATTTTCTTTCTTACAGG + Intronic
1003940402 6:11019447-11019469 ACTCTGATTTTCTTTCTTACAGG - Intronic
1004485952 6:16066742-16066764 AACTTGCCCTTCATTCTTACCGG + Intergenic
1004619093 6:17317645-17317667 AAGCTGATTTTCTTTCTTCCAGG - Intergenic
1004755969 6:18610549-18610571 AACCTGGTTCTCATACTTACTGG + Intergenic
1004777232 6:18861404-18861426 AACCTGTTCTTCATTTCTATGGG + Intergenic
1008300010 6:49825221-49825243 AACGTGTTCTTCATTCATACTGG - Intergenic
1011949702 6:92950504-92950526 AAGCTTATATTAATTCTTACAGG - Intergenic
1012487964 6:99743202-99743224 ATCCTGATCCTCATGGTTACAGG - Intergenic
1013028904 6:106311356-106311378 AACCTGATCTTGAGTTTCACGGG + Intronic
1014004741 6:116405325-116405347 AACCTGATCTTTTTACTCACAGG - Intronic
1014107229 6:117580542-117580564 AAACTGATATTCAATCTAACAGG + Intronic
1014339108 6:120180676-120180698 AGGCTTATCTCCATTCTTACAGG + Intergenic
1016409652 6:143768702-143768724 CATCTGTTCTTCATTCCTACTGG + Intronic
1017201073 6:151755586-151755608 AACCTGATTTCCATTTTTAAAGG - Intronic
1022419806 7:30209818-30209840 AACCTGATCCTGATTATTATTGG - Intergenic
1026675230 7:72423171-72423193 CACCTAATCTTAATTTTTACTGG + Intronic
1027648283 7:80832779-80832801 AACCGGAACTCCATTATTACTGG + Intronic
1028618465 7:92797673-92797695 GTCCTGATCTTTATTCTTATAGG - Intronic
1029056081 7:97744218-97744240 AACCTAAGCTTCAGTCTTTCAGG - Intergenic
1030001028 7:105062519-105062541 AACCTTATCTGCATTCTTTTAGG - Intronic
1032976047 7:137223933-137223955 AACCTGATATTCATGGTGACAGG + Intergenic
1033936322 7:146590050-146590072 AACCTGTTCTTCTTTCCTCCTGG - Intronic
1036382195 8:8243810-8243832 AAACTGCCCTTCATTCTTCCTGG + Intergenic
1036989619 8:13577977-13577999 AACCTGATCCTCAGTGTTACAGG - Intergenic
1038051867 8:23821470-23821492 AGCCTGATCTTGACTCTTACTGG + Intergenic
1040480115 8:47817902-47817924 AATCTGATCTTCATTGGTATAGG + Intronic
1041742632 8:61173013-61173035 AACCTGTTCACTATTCTTACTGG - Intronic
1046335959 8:112787443-112787465 AACCTGATTTTCTTTCTTTTGGG - Intronic
1047932915 8:129748740-129748762 AACCTGATCATCTTTCTTCTAGG - Exonic
1048410724 8:134169370-134169392 AATCTCAACGTCATTCTTACTGG - Intergenic
1049327498 8:142030860-142030882 GACCTGTTTTTCATTCTTTCAGG - Intergenic
1050746977 9:8887507-8887529 AATCTGAACTTCTTACTTACTGG + Intronic
1051265437 9:15305085-15305107 ACCCTGCTCTTCAATTTTACTGG - Intronic
1052362621 9:27576538-27576560 AGCCTGAACTGTATTCTTACTGG + Intergenic
1052754009 9:32522768-32522790 AATCTGATCCTCAATCTTTCTGG - Intronic
1058054841 9:100439044-100439066 ACCCTGCTCTACATTCATACTGG - Intronic
1185914118 X:4016378-4016400 GAGCTGACCTTCATTCTTTCAGG + Intergenic
1187049475 X:15681435-15681457 AACCTGTTCTTTATTATTTCTGG + Intergenic
1187632373 X:21188258-21188280 AACCTAATCTTCATTTCTCCTGG - Intergenic
1189724161 X:43951927-43951949 TACCTGCTCTTCATTTTGACAGG + Intronic
1191933166 X:66396038-66396060 AACCAAATCTTCATTCTTGAAGG - Intergenic
1192588246 X:72337907-72337929 AACTTGCTCTTCCTTCTTCCTGG + Intronic
1193514837 X:82450859-82450881 TAACTGATCTCCATTCTAACTGG - Intergenic
1194529779 X:95031773-95031795 AATCTGATCTTCAAGGTTACAGG + Intergenic
1196911126 X:120485586-120485608 ATCTTGATCTTCATTTTTAAAGG + Intergenic
1198240061 X:134776433-134776455 AATCTGCTCTTCATTCTTTTGGG - Intronic
1198607218 X:138355138-138355160 AACCTTATCTCCATTCCTCCAGG + Intergenic
1198992563 X:142532070-142532092 CACCTGCTCTTCTTTCTTCCAGG + Intergenic
1202202626 Y:22369311-22369333 CACCTGCCCTACATTCTTACAGG + Intronic