ID: 999015036

View in Genome Browser
Species Human (GRCh38)
Location 5:148093412-148093434
Sequence CTGTCTAAGGTGAGGGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999015032_999015036 20 Left 999015032 5:148093369-148093391 CCTTTTTAGCTTTTCTAAATGAG 0: 1
1: 0
2: 4
3: 49
4: 453
Right 999015036 5:148093412-148093434 CTGTCTAAGGTGAGGGTGAAAGG 0: 1
1: 0
2: 0
3: 14
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999015036 Original CRISPR CTGTCTAAGGTGAGGGTGAA AGG Intronic
901755116 1:11436821-11436843 CTGTCTATGCTGATGTTGAAGGG - Intergenic
904604727 1:31692170-31692192 CTGTCTCCCCTGAGGGTGAATGG + Intronic
904674703 1:32191805-32191827 CTGTGTCAGGTGAGAGAGAAGGG - Intronic
904917781 1:33982807-33982829 CTGGCAAAGATGTGGGTGAAGGG + Intronic
905353309 1:37362700-37362722 CTGTCCAAGGTGGGGCTAAAGGG + Intergenic
905532050 1:38687584-38687606 CTGTGTAAGGAGAGGGTAAGGGG - Intergenic
910201775 1:84707480-84707502 CACTCTAAGGTGAGGCTCAATGG + Intergenic
913106155 1:115615912-115615934 CTGTGTATGGTGGGGGTGGATGG + Intergenic
913535691 1:119769855-119769877 CTGTCTAATATGAGTGTGTAGGG + Intergenic
914421592 1:147533095-147533117 CAGTCTAGGGGGAGGGAGAAAGG + Intergenic
915648134 1:157288455-157288477 CTGGCTAAAGTGAGGCTTAAGGG + Intergenic
915733180 1:158068378-158068400 CTGTCAAAGGAGGGGGTTAAGGG + Intronic
916273032 1:162964243-162964265 CTGTCTAAGGGGTGGGGGATAGG + Intergenic
917839279 1:178964349-178964371 CTTCCTAAGGGGAGTGTGAAGGG + Intergenic
918734699 1:188044366-188044388 GTGTCTAAGATGAATGTGAAAGG - Intergenic
918813827 1:189156792-189156814 ATGACTAAGGTGAGGATCAAAGG + Intergenic
919324558 1:196090290-196090312 CTGTCTGAGGTGAAGCAGAAAGG + Intergenic
919777163 1:201201824-201201846 CTGTATAAGGTGAGGCTGGAGGG + Exonic
921069844 1:211649722-211649744 CTCTCCAAGGAGAGGATGAAAGG - Intergenic
921974518 1:221187462-221187484 CTGGCTAAGGTGAGAATAAAAGG + Intergenic
922194655 1:223349628-223349650 TTGTATATGGTGAGGGTGATAGG - Intronic
923430041 1:233911108-233911130 TTGTATGAGGTGAGGGGGAAGGG + Intronic
924351935 1:243123221-243123243 CACTCTAAGGTGAGGTAGAATGG - Intergenic
1065735035 10:28743776-28743798 CTGTCTAAGGCATGGGAGAAAGG - Intergenic
1067793000 10:49301821-49301843 CTGTCTTAGATGAAGGGGAAAGG + Intronic
1068131160 10:52896929-52896951 CTGCTTAAGCTGAGGGTGACAGG + Intergenic
1069417151 10:68210613-68210635 CAGTCTCAGCTGAGGGAGAAAGG + Exonic
1071296203 10:84221974-84221996 CTGTCTGTGATGACGGTGAAGGG - Exonic
1073206548 10:101772451-101772473 CTGTCTAAGGGGAGGGGAATGGG - Intronic
1074045576 10:109835577-109835599 CTGGCCAGGGTGAGGTTGAAAGG + Intergenic
1074276845 10:112011585-112011607 CAGTGTCAGGGGAGGGTGAATGG - Intergenic
1074883650 10:117678005-117678027 CAGTCAAGGGTGAGGGTGGAAGG + Intergenic
1078731587 11:13979874-13979896 CTCTCTAGGGTGAGGGTGGGTGG - Intronic
1079453772 11:20619695-20619717 ATTTCTAAGGTGAGGGTAATTGG + Intronic
1083134977 11:60664095-60664117 CTGCCTAAGGTTGGGGAGAATGG - Intergenic
1083824367 11:65190066-65190088 CTTTCAGAGGTGAGGGAGAATGG - Intronic
1085065866 11:73495096-73495118 CTGTCTAATTTGAGGCTTAATGG + Intronic
1085370394 11:75998462-75998484 CTGCCTAAGATGTAGGTGAAAGG + Intronic
1087805743 11:102553253-102553275 CTGTCTCAGGAGAGGCTTAATGG + Intergenic
1089312690 11:117570336-117570358 CTGTCTAAGGAGAAGCAGAACGG - Intronic
1089335998 11:117724402-117724424 CTGTGGAAGGTGAGGGTGGGAGG + Intronic
1090208477 11:124898806-124898828 CTGTCTAGGTTGTGGGGGAAAGG - Intergenic
1091187721 11:133661547-133661569 CTGTCTAAGGTGAGACTTAGAGG + Intergenic
1091690247 12:2591337-2591359 CTGTATAAGATGAAGGTGAAGGG - Intronic
1092202245 12:6593077-6593099 CAGTCTAAGGTGAGGGCTGAGGG - Exonic
1097089155 12:56491885-56491907 CTAACTAAGCTGGGGGTGAAGGG + Intergenic
1097688869 12:62715432-62715454 CTATCTGAGGAGAGGGGGAAGGG + Intronic
1099631761 12:85157608-85157630 CTGTGTAAGGTGAGAGTTACTGG + Intronic
1101910118 12:108855318-108855340 TTGCCTAAGGTTAGGGAGAATGG + Intronic
1109976833 13:69848031-69848053 CTATTTAAGGTGCTGGTGAAAGG + Intronic
1110080915 13:71309987-71310009 CTGCTTTAGCTGAGGGTGAAGGG - Intergenic
1111812299 13:93106116-93106138 CTGTTTAAGCAGAGGTTGAAGGG + Intergenic
1114494898 14:23125938-23125960 CTGTCTTGGGGCAGGGTGAAAGG - Exonic
1114548089 14:23516997-23517019 CTGTCCAAGAAGAGGGGGAAAGG - Intergenic
1117196121 14:53341636-53341658 TTGTCTGAGATGTGGGTGAAAGG + Intergenic
1118010555 14:61606485-61606507 TTGTCTGAGGTGGGGCTGAATGG - Intronic
1118909385 14:70048753-70048775 CTGTCCCAGGTGAGAGTGAGAGG - Exonic
1119430008 14:74560598-74560620 CAGGCTAGGGTGAGGGTGAATGG - Intronic
1121812204 14:96901075-96901097 CTGTTTAAAGTGAGGGTGGGTGG + Intronic
1122883910 14:104702163-104702185 CTGTCTGGGCTGAGGCTGAAGGG - Intronic
1124651255 15:31476025-31476047 TTCTCAAAGGTGATGGTGAATGG + Exonic
1125729902 15:41887199-41887221 CTCACTAAGGTGGGGGAGAAAGG - Exonic
1126369987 15:47935246-47935268 CTGCCTAACGTAAGGCTGAAAGG - Intergenic
1128220848 15:65967551-65967573 TTGTCTATGGTGAGGGTGAGTGG + Intronic
1130628862 15:85545022-85545044 CTGTCTAGCGTGATGGGGAAAGG - Intronic
1132228501 15:100163802-100163824 GAGTCTAAAGTAAGGGTGAAAGG - Intronic
1132487868 16:205509-205531 CTGTCTGAGGAGAGGGTACATGG + Intronic
1133028088 16:2997329-2997351 CTAGCTAAGGAGAGGGCGAAGGG - Intergenic
1133749873 16:8716454-8716476 CTGGCCAAGGTGAGGGTGCTGGG - Intronic
1137418655 16:48311087-48311109 CTGTCTAAGGTCAATGTGAAGGG - Intronic
1142782213 17:2190125-2190147 CTGCCTATGGGGAGGGTGAAGGG - Intronic
1143370791 17:6437798-6437820 CTGTTTAGGGTGAGGGTGGTGGG - Intergenic
1143411502 17:6712292-6712314 CTGTCTGGGCTGAGAGTGAAAGG + Intronic
1144702202 17:17347170-17347192 CTGCCTGAGGTCAGGCTGAACGG - Exonic
1146430155 17:32785536-32785558 TTGTCTAAGGAGATAGTGAAAGG - Intronic
1147629369 17:41919776-41919798 CTGTCTCAGGTAATGGAGAAGGG - Intronic
1148775402 17:50092462-50092484 CAGCCTAAGGTGAGGGTCATGGG + Intergenic
1148890233 17:50801777-50801799 CGGTCTGAGGTCAGGGTCAAGGG + Intergenic
1149128592 17:53266984-53267006 CTGCCTGAGGTGAGAGGGAAAGG - Intergenic
1149141815 17:53440274-53440296 CTGTGTATGGTGAGGGGGGATGG - Intergenic
1155295419 18:24380468-24380490 ATTTCTGAGGTGTGGGTGAAAGG - Intronic
1159665296 18:71151535-71151557 CTTTCTAAGAGGAGGGTGATAGG + Intergenic
1159685728 18:71417598-71417620 CTGCCTAAGTGGAGAGTGAAGGG + Intergenic
1161153457 19:2721100-2721122 CTGTCCAAGGTGAGCGCGGAGGG + Intronic
1161258920 19:3324848-3324870 TTGTCTAAGGGGAGGTGGAAGGG - Intergenic
1163721595 19:18900507-18900529 CTGCCTGAGGTGGGGGTGACGGG - Intronic
1164472801 19:28550205-28550227 CAGTCTAACCTGAGGGGGAAAGG + Intergenic
1167906133 19:52662261-52662283 ATGTCTCAGATGAGGGTGACAGG - Intronic
927153118 2:20206905-20206927 CTGTCTAGAAAGAGGGTGAAAGG + Intronic
927485407 2:23485367-23485389 CTGTCTAAATTGTGTGTGAAAGG + Intronic
927759927 2:25743714-25743736 CTGTCTTTGATGAGGCTGAAGGG + Intronic
931062479 2:58546766-58546788 CTGCCTACTGTGAGGATGAAAGG - Intergenic
931075764 2:58709853-58709875 CTGTCTAAGGTGGTGCTGCAGGG + Intergenic
932708544 2:74046259-74046281 CTGTCTAAAGAGAGAGAGAAGGG - Exonic
932953223 2:76318072-76318094 TCATCTAAGGTGAGGGTGGAAGG + Intergenic
935236344 2:101141536-101141558 ATCTCTAAGATGATGGTGAAGGG - Intronic
936472188 2:112809009-112809031 GTGTGTAATGTGAGGGAGAAGGG + Intergenic
936678522 2:114743715-114743737 CTGTAAAAGGTGAGGTTGTAAGG + Intronic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
940100866 2:150036812-150036834 CTATCCAAGGTGAAAGTGAAAGG + Intergenic
942918117 2:181337189-181337211 TTGTCTAAGATGTGAGTGAATGG - Intergenic
943792159 2:191945360-191945382 CTGTCCACGGTGAGGCTGGAAGG + Intergenic
944088239 2:195874312-195874334 CAGTTTAAGGAGATGGTGAAAGG + Intronic
944277552 2:197856061-197856083 CTTTCTAAGGTGATTTTGAATGG + Intronic
944654734 2:201866044-201866066 GTGTTTGGGGTGAGGGTGAAGGG + Intronic
946513014 2:220380317-220380339 TTGTCTATGGTGAGAGTTAAGGG + Intergenic
946602964 2:221371874-221371896 CTTTCTCAGGTGAGGGTTGAGGG + Intergenic
946873771 2:224108166-224108188 CTTTGAAGGGTGAGGGTGAATGG + Intergenic
946933754 2:224698012-224698034 TTCTCTGAGTTGAGGGTGAATGG + Intergenic
947543117 2:230991912-230991934 CTGTGTGACGTGAAGGTGAAGGG + Intergenic
948076092 2:235166332-235166354 CTGTCCAGGGAGAGGGTGCAGGG - Intergenic
949043231 2:241858905-241858927 CTGTCCCAGGTCAGGTTGAAGGG + Exonic
1170559058 20:17540352-17540374 GTGTCAAAGCTGAGGGTGACAGG - Intronic
1173619800 20:44428368-44428390 CTGCATCAGGTGAGGGTGCAGGG - Exonic
1176235665 20:64052413-64052435 CTGTCCAAGCTGAGGGAGAGGGG - Intronic
1177340873 21:19798349-19798371 CTATTTAAGATGAGAGTGAAGGG - Intergenic
1177358660 21:20040655-20040677 CTCTCTAAGGTGTAGGTGAAAGG - Intergenic
1184252248 22:43267553-43267575 CTGTGTTAAGTGAGGGGGAAGGG - Intronic
950008468 3:9705712-9705734 CTGCAGAAGGTGAGGCTGAATGG + Exonic
952728564 3:36615554-36615576 TTGTATAAGGTGAGGATTAAGGG + Intergenic
954501346 3:51019620-51019642 CTGTTGGAGGTGAGGGTGGAAGG - Intronic
955288400 3:57667555-57667577 CTATATAAGCTGAGGGTCAAGGG - Intronic
957859828 3:85932512-85932534 ATGTTTAAGATCAGGGTGAATGG - Intronic
960160529 3:114345695-114345717 ATGTCTGGGGTGGGGGTGAAGGG + Intronic
960399463 3:117178600-117178622 CTGCCTAAGGTGAAGGGGACAGG + Intergenic
960695137 3:120388574-120388596 TTGTCCAATGTGAGAGTGAATGG - Intergenic
960992423 3:123320619-123320641 CAGTCTTAGCTGAGAGTGAATGG - Intronic
961864825 3:129945997-129946019 CTGTGAAATGGGAGGGTGAATGG - Intergenic
963397501 3:144752299-144752321 CTGTCTAATGTGACAGAGAATGG - Intergenic
966629145 3:182052653-182052675 TTGTCTAGGGGTAGGGTGAAAGG - Intergenic
967352135 3:188525524-188525546 CTATGTAAGGTTAAGGTGAAGGG + Intronic
968917699 4:3504033-3504055 CAGCCTCAGGTGAGAGTGAAGGG + Intergenic
971892026 4:32537145-32537167 ATCACTAATGTGAGGGTGAAGGG - Intergenic
973199955 4:47489155-47489177 TTGTCTAAGGTTAGGGTAGAGGG + Intronic
975480577 4:74875428-74875450 CTGTCTAAGGTCAATGTGGAGGG - Intergenic
976682079 4:87768472-87768494 CTGTCTGATGTGAGGGGAAAGGG - Intergenic
977000823 4:91499636-91499658 CTGTCAAAGATTAGGGGGAAAGG - Intronic
977595217 4:98871992-98872014 CTGCCTAAGTGGAAGGTGAAAGG + Intronic
978746569 4:112201670-112201692 ATTTCTTAGGTGAGGGAGAAAGG + Intergenic
979250004 4:118557316-118557338 CACTCTAAGGTGAGGTAGAATGG + Intergenic
985757942 5:1730335-1730357 CAGGCTAAGGTCAGGGGGAAGGG + Intergenic
985771140 5:1812143-1812165 CTGTGTCTGGTGAGGGTGGAAGG + Intronic
986038386 5:3962568-3962590 GTGGCTAATGTGAGGGTGATGGG + Intergenic
986806301 5:11311764-11311786 GTGTGTGAGGTGAGGGTGCATGG - Intronic
989423570 5:41269503-41269525 TTGACTAAGGTGATGGGGAATGG + Intergenic
994155807 5:96503324-96503346 CTATGTAAGGTGAAGGTGAAAGG + Intergenic
994177550 5:96728235-96728257 CAGGCACAGGTGAGGGTGAAAGG + Intronic
997347260 5:133201060-133201082 CTTCCTTGGGTGAGGGTGAATGG + Intronic
997399296 5:133590258-133590280 ATCTCTAGGGTGAGGATGAAAGG - Intronic
999015036 5:148093412-148093434 CTGTCTAAGGTGAGGGTGAAAGG + Intronic
999127034 5:149253416-149253438 CTCTGTAAAGTGAGGGTGATTGG + Intronic
999666272 5:153916782-153916804 GTGTCTAGGGTGAGGGGGCAAGG - Intergenic
1001247896 5:170118786-170118808 CTGTCACAGGTGAGGGGGCAAGG + Intergenic
1001705001 5:173735235-173735257 CTGACTCTGGAGAGGGTGAAGGG - Intergenic
1002972807 6:2041629-2041651 CAGGCTGAGGTGAGGGTCAAGGG + Intronic
1003651447 6:7964517-7964539 CTCTGTAGGGTGAAGGTGAATGG + Intronic
1004121552 6:12827864-12827886 CTGTCTTATGTGAGGGTGAGGGG + Intronic
1004878395 6:19979470-19979492 CTGTCAAAGGTGAAGTAGAAAGG - Intergenic
1006531379 6:34657873-34657895 CTGGCTAAGGTGATGGGAAAGGG + Intronic
1006884819 6:37372596-37372618 CTGTCTCAGGAGAGGGTGCAGGG - Intronic
1007229201 6:40336708-40336730 GTGTCTAGGGTGGGGGTGTAAGG - Intergenic
1007802612 6:44409787-44409809 CTCTCTAGGGTGACAGTGAAGGG - Intronic
1009493638 6:64324032-64324054 CTGTCAAAAGTTAGGGTGATGGG - Intronic
1010965397 6:82200502-82200524 ATGTCCAAGATGAGAGTGAAGGG + Intronic
1013246173 6:108289548-108289570 GGGTGTAAGGTGAGAGTGAATGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013779044 6:113710293-113710315 ATGTTTAAGGTGGGGCTGAAAGG + Intergenic
1020874765 7:13678547-13678569 CTGTCTCACCTCAGGGTGAAGGG + Intergenic
1021827316 7:24568369-24568391 CTGTTTGAGGTGAGGCAGAAAGG + Intergenic
1021880454 7:25090425-25090447 CTGTCAAAGCTGGGGGTGAATGG - Intergenic
1022748830 7:33202576-33202598 CAGTCATAGTTGAGGGTGAAGGG + Intronic
1022788165 7:33659905-33659927 CTGTATAAGATGAAGGTGCAAGG - Intergenic
1023339992 7:39209927-39209949 CTCTCAAAGGTGAGAGTTAAGGG + Intronic
1023840230 7:44092950-44092972 CTGACTCAGGTGAGTGTGGACGG + Intergenic
1026639057 7:72108619-72108641 CTGCCTAAGGGCAGGGTGTATGG - Intronic
1030231322 7:107210720-107210742 CTGTCCAAGGGAAGTGTGAAGGG + Intronic
1030652176 7:112128022-112128044 CTGTCGGGGGTGAGGGTGGAGGG + Intronic
1031140878 7:117941869-117941891 CTGTATTAGCTGAGGGGGAAAGG - Intergenic
1031791720 7:126114876-126114898 CTGTCAATGCTGAGGGAGAAAGG - Intergenic
1032437603 7:131913057-131913079 CAGTGTGAGGTGAGGGTGAGGGG + Intergenic
1032511935 7:132479522-132479544 CTCACTAAGGTGCGGGTGGAAGG - Intronic
1033354300 7:140586935-140586957 CTGCTTACGGTGCGGGTGAAAGG - Intronic
1034680406 7:152924080-152924102 CTGGCTAAGCTTTGGGTGAAGGG - Intergenic
1035083899 7:156239791-156239813 ATGTCTACAGTGAGGGTGAAGGG + Intergenic
1035438350 7:158876144-158876166 CAGTCTTAGGAGAAGGTGAAGGG + Intronic
1035635244 8:1139301-1139323 CTGTCTCAGCTGAGGCTGCAGGG + Intergenic
1035902240 8:3469727-3469749 CTGCCTAAGGTGAGGATGTAGGG - Intronic
1041417494 8:57627683-57627705 CTGTTAAAGGTGACAGTGAATGG - Intergenic
1042852304 8:73227915-73227937 CTGAGTAAGGTGAGGGAGATGGG - Intergenic
1043331399 8:79122221-79122243 CTGACTGAGGAAAGGGTGAAGGG - Intergenic
1043858190 8:85286013-85286035 CTGTGCAATGTGTGGGTGAAAGG - Intergenic
1044434930 8:92150821-92150843 CTGTCTGGGGTGGGGGTGGAGGG + Intergenic
1044796890 8:95910371-95910393 CTGACAAAGGTGAGGATCAAGGG + Intergenic
1046761516 8:118026248-118026270 CTGGCTAAGGTGAGGGCTAATGG + Intronic
1047062033 8:121238032-121238054 TTGTATAAGATAAGGGTGAAAGG - Intergenic
1050286323 9:4106107-4106129 TTGTCTAAGGTGTTGGTGGAAGG - Intronic
1050615625 9:7398995-7399017 AGAACTAAGGTGAGGGTGAAGGG - Intergenic
1050867516 9:10521652-10521674 TTGTCGAAGGTTAGGGTGGATGG - Intronic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051864102 9:21659580-21659602 CCATCTAAGGTGAGGTGGAATGG + Intergenic
1052067416 9:24039293-24039315 CTTTCAAAGTTGAGGGTGACAGG - Intergenic
1053524359 9:38813596-38813618 CTTTGTAAGGTGAGGCAGAAAGG - Intergenic
1054196593 9:62038005-62038027 CTTTGTAAGGTGAGGCAGAAAGG - Intergenic
1054641812 9:67550680-67550702 CTTTGTAAGGTGAGGCAGAAAGG + Intergenic
1056355493 9:85797606-85797628 CTGCCCTAGGTGAAGGTGAAGGG - Intergenic
1056943428 9:90974577-90974599 CTCTCTTAGGTGAAGGTGAGAGG + Intergenic
1059535820 9:115079727-115079749 TTTTCCAAGGTGATGGTGAATGG + Intronic
1059631848 9:116133427-116133449 CTGTCCAAGATGAAGATGAAAGG + Intergenic
1059766434 9:117388038-117388060 CTGGCTGAGGGAAGGGTGAAGGG - Intronic
1060336933 9:122733517-122733539 CTTTCTAGGGTGATTGTGAATGG - Intergenic
1060680987 9:125564177-125564199 CAGGCAAAGGTGAGGATGAAAGG + Intronic
1186343123 X:8664040-8664062 CTGTCAAAGGGGTGGGGGAAGGG + Intronic
1186798709 X:13071571-13071593 CTGTTAAAGGTAAGGTTGAAAGG + Intergenic
1187279916 X:17850353-17850375 ATGGCTGAGGAGAGGGTGAAGGG + Intronic
1188024834 X:25197348-25197370 CTGCCTATGCTGAGGGAGAAGGG + Intergenic
1188182498 X:27073124-27073146 CTGTCTGAGGTAAGGGATAATGG - Intergenic
1190116269 X:47627820-47627842 CTGTGCACGGTGAGGGTGAGAGG - Intronic
1197277952 X:124501836-124501858 GTGTCCAAGGTCAGGCTGAAAGG + Intronic
1199764549 X:150931400-150931422 CTGCCTCAGGAGAGGATGAAGGG + Intergenic
1199828306 X:151522755-151522777 GTGTGTAGGGTGAGGGGGAAGGG - Intergenic