ID: 999015388

View in Genome Browser
Species Human (GRCh38)
Location 5:148098196-148098218
Sequence GGACATTCCAGTGCTAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 152}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999015388 Original CRISPR GGACATTCCAGTGCTAAAAG AGG (reversed) Intronic
908445329 1:64194402-64194424 GAACTTTTCAGTGCTAAAACTGG - Intergenic
909386891 1:75068100-75068122 GGCCTTTCCAGTGCTATTAGGGG - Intergenic
911710333 1:101064389-101064411 GGGAATTTCAGTGCTAAAACTGG + Intergenic
916665840 1:166966734-166966756 GGACAAAGCAGTGCTAAAAGAGG + Intronic
917095462 1:171394894-171394916 GGCCCTTCCAGTGCTAGGAGAGG + Intergenic
919159740 1:193813387-193813409 GCAAATTCCAGTGTGAAAAGAGG + Intergenic
921232095 1:213083416-213083438 AGACATTCCTGTACAAAAAGGGG - Intronic
923395942 1:233563243-233563265 GAACTATCCAGTGCTAAACGTGG - Intergenic
923706356 1:236347929-236347951 GGAAGTTACAGTGCTAAGAGGGG - Intergenic
1064802115 10:19088306-19088328 GGACTTTCAAATGCTGAAAGTGG + Intronic
1066795468 10:39115236-39115258 GGACATTTAAGTGCTCAAAAAGG + Intergenic
1066795526 10:39115925-39115947 GGACATATTAGTGCTCAAAGGGG + Intergenic
1067412662 10:46078597-46078619 GAACAGTCCAGTTCTAACAGAGG + Intergenic
1067656647 10:48197400-48197422 GGACACTCCAGCTCTGAAAGGGG + Intronic
1077823302 11:5774610-5774632 AGATATTCCAGAGGTAAAAGTGG + Intronic
1078503277 11:11905877-11905899 GTACTTTCCAGTGCAAAAAGTGG - Intronic
1079552278 11:21714881-21714903 GGAGATTTCAGTGCTAAGATAGG - Intergenic
1082591247 11:55013442-55013464 GGACATTTCAGAGCTAATTGAGG + Intergenic
1083183957 11:61007000-61007022 GTACAATCCTGGGCTAAAAGGGG + Intronic
1084944181 11:72630072-72630094 GGACTCTTCAGTGCTCAAAGGGG - Intronic
1089059853 11:115617619-115617641 TGACTTTACAATGCTAAAAGGGG + Intergenic
1089258253 11:117205535-117205557 GGACATGCCTGTCCTGAAAGCGG - Exonic
1089764033 11:120750009-120750031 GCTCCTTCCAGTGCTAAAATTGG - Intronic
1096993506 12:55824150-55824172 GGACTTTTTAGTGCTAAAACTGG - Intronic
1099386428 12:82018752-82018774 GCTCCATCCAGTGCTAAAAGGGG + Intergenic
1099889921 12:88579044-88579066 GGACATTGCCTGGCTAAAAGAGG - Intronic
1101162309 12:101991409-101991431 GATCTGTCCAGTGCTAAAAGTGG + Intronic
1101952813 12:109189584-109189606 GGACTTCTCAGTGCTAAAATGGG + Intronic
1103936370 12:124479724-124479746 GCAGATTCCAGTGCTAATGGGGG + Intronic
1107211123 13:37855450-37855472 GGTCTGTCCAGTGCCAAAAGTGG - Intronic
1109990920 13:70056406-70056428 GGTCTTTCCAATGCTGAAAGTGG - Intronic
1112864093 13:103872279-103872301 GGGCATGCCAGTGCAAACAGTGG + Intergenic
1112944368 13:104908836-104908858 GAACAATCCAGTGCTGAAAGTGG + Intergenic
1119511728 14:75216808-75216830 GGACTTGGCAGTGCTAAAACTGG + Intergenic
1119792831 14:77368439-77368461 GGACAATCCAGTAATAAAATTGG - Intronic
1120246745 14:82015502-82015524 AGACATTTTAGTTCTAAAAGAGG + Intergenic
1120585131 14:86303182-86303204 GGTGATTCAATTGCTAAAAGAGG + Intergenic
1121324647 14:93012898-93012920 GGCAATTCCAGGGCTAGAAGGGG + Intronic
1125041150 15:35188729-35188751 ATACATTCCACTGCTAACAGTGG + Intergenic
1125163805 15:36679123-36679145 GCACAATCCACTACTAAAAGTGG - Intronic
1126512570 15:49496563-49496585 TTACATTCCAGTCCTAAAAAGGG + Intronic
1126539946 15:49810793-49810815 GGAGATTCCAGTTCTAACACAGG + Intergenic
1126872898 15:53008723-53008745 TGAAATTCCTGTGATAAAAGGGG + Intergenic
1127177775 15:56379613-56379635 GATCTGTCCAGTGCTAAAAGTGG + Intronic
1129562012 15:76580090-76580112 GATCTGTCCAGTGCTAAAAGTGG - Intronic
1136504412 16:30693764-30693786 GGACCTTCCATTGCTATTAGTGG - Intergenic
1136739268 16:32499752-32499774 GGACATTTCAGAGCTCAATGAGG + Intergenic
1137807922 16:51325095-51325117 GGACACTGCAGTGCTCAAAAGGG + Intergenic
1140253804 16:73317850-73317872 GAGAATTCCAGTCCTAAAAGTGG + Intergenic
1140257134 16:73346977-73346999 GGTCATTCCTGTGTTACAAGGGG + Intergenic
1203013945 16_KI270728v1_random:332040-332062 GGACATTTCAGAGCTCAATGAGG - Intergenic
1203032280 16_KI270728v1_random:605199-605221 GGACATTTCAGAGCTCAATGAGG - Intergenic
1143425521 17:6833227-6833249 GGACATGCCAGTACTCAAAACGG + Intergenic
1145729988 17:27171859-27171881 GGACATTTCAGAGCTAATTGAGG + Intergenic
1147891368 17:43719708-43719730 GGAAGATCCAGTACTAAAAGAGG - Intergenic
1148000746 17:44385686-44385708 GGACGTTCCAGTGCTGCCAGGGG + Exonic
1150595832 17:66603627-66603649 GTACATTCCACAGTTAAAAGTGG - Intronic
1152028208 17:77825330-77825352 GGACATCCCAGAGGCAAAAGAGG + Intergenic
1158754208 18:60302597-60302619 GAATATTCCAGTGAGAAAAGAGG - Intergenic
1161753351 19:6113645-6113667 GGGAATTTCAGTGCTAAAACCGG + Intronic
1164369446 19:27630623-27630645 GGACATTTCAGTGCCCACAGAGG + Intergenic
1164790891 19:30979481-30979503 GGCCATTCCACTGCTACAGGGGG - Intergenic
1168022131 19:53616825-53616847 GGACATTCAAGCGCTAAGAACGG - Intergenic
1168698120 19:58417538-58417560 GGACTTTCCAGTGCTGATAGAGG - Exonic
926854615 2:17240982-17241004 GGACTTTGAAGTGCTAAAACCGG - Intergenic
927228821 2:20799271-20799293 GAATATACCAGTGTTAAAAGTGG + Intronic
928348962 2:30529284-30529306 GCACATTTCTGTGCTAAAAGAGG + Intronic
928459691 2:31458888-31458910 GGGCTTTCCAATGCTGAAAGTGG - Intergenic
928862182 2:35872418-35872440 GGAACTTCCAGTACTAAAATTGG - Intergenic
928883104 2:36119635-36119657 GTCCATTCCAGTGCTAGAATAGG - Intergenic
929820362 2:45268711-45268733 GGTCCTTCCAGTGGAAAAAGTGG + Intergenic
932943350 2:76196056-76196078 GTACATTGCATTGCTAATAGTGG - Intergenic
933798080 2:85937115-85937137 GGACATACTTGTGCTAAATGGGG + Intergenic
934719323 2:96562305-96562327 GGACATTCCTATTCAAAAAGGGG - Intergenic
935235525 2:101135242-101135264 GAACCTTCCAGTTCTACAAGAGG + Intronic
939651961 2:144774389-144774411 GTGCATTCCATTGTTAAAAGTGG - Intergenic
939685232 2:145190650-145190672 AGACAGTCCAGTTCAAAAAGGGG - Intergenic
941037600 2:160585113-160585135 GGAAATTCCAGTGGGAAAAAAGG - Intergenic
942414448 2:175744137-175744159 GGACATTCTGATGCTAAACGAGG - Intergenic
944897839 2:204183698-204183720 GGAGCTTCCAAGGCTAAAAGAGG - Intergenic
946582220 2:221142034-221142056 AGGCATTCCATTGCTAAAAAGGG - Intergenic
947856905 2:233330322-233330344 GGAACTTCCAGTCCTAAAATGGG + Intronic
948874028 2:240818027-240818049 GGACATTCCAGTGGGGAAGGGGG + Intronic
1173203949 20:40977045-40977067 GATCTGTCCAGTGCTAAAAGTGG + Intergenic
1173967572 20:47124679-47124701 GGGACTTCCAGTGCTACAAGTGG - Intronic
1177350682 21:19937280-19937302 AGACATTCCAGTTCAAAAAATGG + Intergenic
1179129478 21:38621803-38621825 GGAAATTCCAGTGGTAAACTCGG - Intronic
1184664924 22:45983259-45983281 GGAACTTCCAGGGCTAAAACTGG - Intergenic
1184964612 22:47961906-47961928 AAAAATTCCAGTGCTAAAAATGG - Intergenic
949235421 3:1803250-1803272 GATCAGTCCAGTGCTGAAAGTGG + Intergenic
950552849 3:13677105-13677127 GGACATGCCAGTGATAGAGGAGG + Intergenic
951475541 3:23101994-23102016 CGGACTTCCAGTGCTAAAAGTGG + Intergenic
954471831 3:50704345-50704367 GGTCTGTCCAGTGCTAAAAGTGG + Intronic
955719124 3:61863198-61863220 AGACAATCCACTGCTCAAAGAGG - Intronic
958686013 3:97395720-97395742 ACACATTCCTGTCCTAAAAGAGG + Intronic
959202872 3:103271216-103271238 GGTCATGCCAGTGCAAGAAGTGG + Intergenic
959510969 3:107211716-107211738 GGACATTTCACTGCTGAAACTGG + Intergenic
960021161 3:112955305-112955327 GGTCTGTCCATTGCTAAAAGTGG + Intronic
964871971 3:161322667-161322689 GATCAGTCCAGTGCTGAAAGTGG - Intergenic
973188651 4:47361686-47361708 AGAAATTCCAGTGTTAAAATAGG + Intronic
979313255 4:119229292-119229314 GGACATGCGAGTGAGAAAAGTGG - Intronic
980753031 4:137116959-137116981 GGTCTGTCCAGTGCTGAAAGTGG - Intergenic
982440018 4:155424300-155424322 GAGAATTTCAGTGCTAAAAGTGG - Intergenic
986039791 5:3981873-3981895 GCACATTCCAGTGTGAAGAGGGG + Intergenic
986787480 5:11127643-11127665 AGACACTCCAGTTCTAAAAGGGG - Intronic
992147446 5:73865566-73865588 TGACATTTCAGTGCTACAGGTGG + Intronic
996956664 5:129191072-129191094 GATCTTTCCAATGCTAAAAGTGG - Intergenic
997518857 5:134509281-134509303 GGACATGACAGTGCTCAGAGAGG + Intergenic
999001844 5:147932183-147932205 GGACATCCCAGTCCTTAAACTGG - Intergenic
999015388 5:148098196-148098218 GGACATTCCAGTGCTAAAAGAGG - Intronic
999428740 5:151508320-151508342 GGACATTTCACAGCTGAAAGTGG - Intronic
1004237862 6:13890502-13890524 TGACATTACATTGCTAAAAATGG + Intergenic
1006841136 6:37028405-37028427 GGGACTTCCAGTGCTAAAACTGG + Exonic
1007847880 6:44775661-44775683 TGACACTCCAGTCCTAAAAGGGG - Intergenic
1008071031 6:47099161-47099183 GAACATTTCAGTGCTAGAACTGG - Intergenic
1008118805 6:47586193-47586215 GAACATTACAGTGCAAAAACTGG + Intronic
1008309296 6:49946216-49946238 GCACATTTCACTGTTAAAAGGGG + Intergenic
1010324108 6:74545024-74545046 GGACTTGCCATGGCTAAAAGGGG - Intergenic
1011212112 6:84966438-84966460 GGTCAGTCCAGTGTTAAAGGTGG - Intergenic
1012613614 6:101247939-101247961 GGACATTCAATTGGGAAAAGAGG - Intergenic
1012940760 6:105412612-105412634 GATCATTCCAATGTTAAAAGTGG - Intergenic
1020852077 7:13366990-13367012 GATCTGTCCAGTGCTAAAAGTGG + Intergenic
1021123994 7:16829241-16829263 GATCTTTCCAGTGCTAAAAGTGG - Intronic
1021471380 7:21005995-21006017 TGATTTTCCAGTGCTAAAAGTGG - Intergenic
1023475959 7:40578223-40578245 GGAAATTTCAGTGCAAAAACTGG - Intronic
1023575274 7:41620411-41620433 GGGTCTTTCAGTGCTAAAAGTGG - Intergenic
1025550848 7:62246706-62246728 GGACATTTCAGAGCTCAATGAGG + Intergenic
1025590385 7:62852232-62852254 GGACATTCCAGAACTCAATGAGG + Intergenic
1025857138 7:65291045-65291067 AAACATACCACTGCTAAAAGAGG + Intergenic
1028329982 7:89578279-89578301 GGACATTCAAATAGTAAAAGAGG + Intergenic
1030870930 7:114755498-114755520 GGACAGTCCAGAGATAAAGGGGG + Intergenic
1037884736 8:22589989-22590011 TGTCATTCGAGTGATAAAAGCGG + Intronic
1038137890 8:24809451-24809473 GGACAGTCCATTGTTGAAAGAGG - Intergenic
1038282720 8:26180518-26180540 GGACATTCCTATTCCAAAAGGGG - Intergenic
1040128817 8:43770336-43770358 GGACATTTAAGTGCTCAAGGAGG + Intergenic
1040130463 8:43789905-43789927 GGACATTTAAGTGCTCAAAGAGG + Intergenic
1040283338 8:46083116-46083138 GGACATTTCAGTGCTCACTGAGG + Intergenic
1041106104 8:54445608-54445630 GGACATCCCAGAGCCAGAAGGGG - Intergenic
1043998309 8:86846323-86846345 GATCTTTCCAGTGCTGAAAGTGG - Intergenic
1047164441 8:122421367-122421389 AGACATCCCAGTCCTATAAGGGG - Intergenic
1048217040 8:132505809-132505831 GGGACTTCCAGTGCTAAAATGGG + Intergenic
1048792037 8:138113023-138113045 GGGCATTGCAGACCTAAAAGGGG + Intergenic
1050058385 9:1679328-1679350 GGACATTCCAGACCTAATAAGGG - Intergenic
1050545647 9:6706650-6706672 GGACATTCCAGAGAGAGAAGTGG + Intergenic
1051100884 9:13520037-13520059 GGACATTCAAGTGCCAAGATGGG + Intergenic
1051929665 9:22369397-22369419 GGACATTATAATGATAAAAGAGG + Intergenic
1055629216 9:78205947-78205969 GGACAATCCTATGCAAAAAGAGG + Intergenic
1058703467 9:107619953-107619975 GGACAGGCCAGTCCTAAAAGGGG + Intergenic
1059015176 9:110507553-110507575 AGCCATTCCAGGGATAAAAGAGG - Intronic
1059984369 9:119807738-119807760 AGACATTCAAGTGCTGGAAGGGG + Intergenic
1188548785 X:31338755-31338777 GGGAATTCCAGTGCTAAATCCGG + Intronic
1191583717 X:62795291-62795313 GGACATTTCAGCGCCAAATGAGG - Intergenic
1191957077 X:66654600-66654622 GAACTGTCCAGTGCTGAAAGTGG - Intergenic
1192674693 X:73183421-73183443 GGAAAAACCAGTGCAAAAAGTGG + Intergenic
1192958606 X:76102507-76102529 GGACTCTCCAATGCTAAAAGTGG + Intergenic
1193497557 X:82233065-82233087 GGAAATTCCTGTGCACAAAGAGG - Intergenic
1193843234 X:86435583-86435605 GGACATTCCAAAGCAAAAACAGG - Intronic
1194274568 X:91863175-91863197 GATCTGTCCAGTGCTAAAAGTGG + Intronic
1194287967 X:92034314-92034336 GATCTGTCCAGTGCTAAAAGTGG + Intronic
1194834690 X:98668053-98668075 GTTCAGTCCAGTGCTGAAAGTGG + Intergenic
1194839514 X:98723367-98723389 GTTCAGTCCAGTGCTCAAAGTGG - Intergenic
1197670330 X:129270186-129270208 GGTCTGTCCAATGCTAAAAGTGG + Intergenic
1200591808 Y:5084581-5084603 GATCTGTCCAGTGCTAAAAGTGG + Intronic
1200605492 Y:5258867-5258889 GATCTGTCCAGTGCTAAAAGTGG + Intronic
1200879963 Y:8202434-8202456 GGACAAATTAGTGCTAAAAGAGG - Intergenic
1201530178 Y:14983289-14983311 GAACTTTCCTGTGTTAAAAGAGG + Intergenic
1201536863 Y:15058757-15058779 GGACAATCCACTGCTAAAAATGG + Intergenic