ID: 999019506

View in Genome Browser
Species Human (GRCh38)
Location 5:148148049-148148071
Sequence TCTTATATGAAGATGTTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999019506_999019511 4 Left 999019506 5:148148049-148148071 CCCTTCAACATCTTCATATAAGA No data
Right 999019511 5:148148076-148148098 AATTTAATAATGGGAATACAGGG No data
999019506_999019509 -5 Left 999019506 5:148148049-148148071 CCCTTCAACATCTTCATATAAGA No data
Right 999019509 5:148148067-148148089 TAAGAATAGAATTTAATAATGGG No data
999019506_999019510 3 Left 999019506 5:148148049-148148071 CCCTTCAACATCTTCATATAAGA No data
Right 999019510 5:148148075-148148097 GAATTTAATAATGGGAATACAGG No data
999019506_999019508 -6 Left 999019506 5:148148049-148148071 CCCTTCAACATCTTCATATAAGA No data
Right 999019508 5:148148066-148148088 ATAAGAATAGAATTTAATAATGG No data
999019506_999019512 29 Left 999019506 5:148148049-148148071 CCCTTCAACATCTTCATATAAGA No data
Right 999019512 5:148148101-148148123 TTATTTTTTGTTCCAACTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999019506 Original CRISPR TCTTATATGAAGATGTTGAA GGG (reversed) Intergenic
No off target data available for this crispr