ID: 999020016

View in Genome Browser
Species Human (GRCh38)
Location 5:148154676-148154698
Sequence TTGGCTATCACCACCCATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999020014_999020016 -9 Left 999020014 5:148154662-148154684 CCTTACAAATTGCTTTGGCTATC No data
Right 999020016 5:148154676-148154698 TTGGCTATCACCACCCATCAGGG No data
999020010_999020016 4 Left 999020010 5:148154649-148154671 CCTGCCACCTTTACCTTACAAAT No data
Right 999020016 5:148154676-148154698 TTGGCTATCACCACCCATCAGGG No data
999020012_999020016 -3 Left 999020012 5:148154656-148154678 CCTTTACCTTACAAATTGCTTTG No data
Right 999020016 5:148154676-148154698 TTGGCTATCACCACCCATCAGGG No data
999020011_999020016 0 Left 999020011 5:148154653-148154675 CCACCTTTACCTTACAAATTGCT No data
Right 999020016 5:148154676-148154698 TTGGCTATCACCACCCATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999020016 Original CRISPR TTGGCTATCACCACCCATCA GGG Intergenic
No off target data available for this crispr