ID: 999020778

View in Genome Browser
Species Human (GRCh38)
Location 5:148163481-148163503
Sequence GGCCACACCAATGCAAGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999020772_999020778 14 Left 999020772 5:148163444-148163466 CCAAAATAATCTTGTTTGACTCC No data
Right 999020778 5:148163481-148163503 GGCCACACCAATGCAAGGGATGG No data
999020774_999020778 -7 Left 999020774 5:148163465-148163487 CCATGTCTCATATCCAGGCCACA 0: 13
1: 140
2: 734
3: 1303
4: 1885
Right 999020778 5:148163481-148163503 GGCCACACCAATGCAAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999020778 Original CRISPR GGCCACACCAATGCAAGGGA TGG Intergenic
No off target data available for this crispr