ID: 999028901

View in Genome Browser
Species Human (GRCh38)
Location 5:148268016-148268038
Sequence CCTGCTCCAGACCTTGGTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 202}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999028901_999028905 19 Left 999028901 5:148268016-148268038 CCACAACCAAGGTCTGGAGCAGG 0: 1
1: 0
2: 0
3: 15
4: 202
Right 999028905 5:148268058-148268080 ATCCCAACTTGGAAGAAAGAAGG 0: 1
1: 0
2: 2
3: 30
4: 341
999028901_999028904 8 Left 999028901 5:148268016-148268038 CCACAACCAAGGTCTGGAGCAGG 0: 1
1: 0
2: 0
3: 15
4: 202
Right 999028904 5:148268047-148268069 AAGCTGAATTTATCCCAACTTGG 0: 1
1: 0
2: 2
3: 6
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999028901 Original CRISPR CCTGCTCCAGACCTTGGTTG TGG (reversed) Intergenic
900184744 1:1327793-1327815 CCTGCTGCAGATCTGGGCTGCGG + Exonic
900789392 1:4669585-4669607 CCTGGTCCCGCCCTTGATTGTGG + Intronic
901136450 1:6999970-6999992 CTTTCTCCACCCCTTGGTTGGGG - Intronic
902684619 1:18067813-18067835 CCTGCTCCAGCTCTTGGTTCAGG + Intergenic
903672898 1:25046944-25046966 CCTGCTCCAGCCCTGGGGTTGGG - Intergenic
904899687 1:33847094-33847116 CCTGCTCCAGAGCTGGGCTGAGG - Intronic
909585091 1:77281089-77281111 CCTGCTGCAGACCATTGTTAAGG - Intergenic
911267296 1:95757045-95757067 CCTGCCACAGAGCTGGGTTGGGG + Intergenic
913561914 1:120029772-120029794 CCTGGTACAGATTTTGGTTGGGG - Intronic
913636212 1:120763821-120763843 CCTGGTACAGATTTTGGTTGGGG + Intergenic
914282499 1:146189166-146189188 CCTGGTACAGATTTTGGTTGGGG - Intronic
914543528 1:148639882-148639904 CCTGGTACAGATTTTGGTTGGGG - Intronic
914623093 1:149431127-149431149 CCTGGTACAGATTTTGGTTGGGG + Intergenic
914994985 1:152535604-152535626 CCTGCCCCAGACCTGGGAGGAGG - Intronic
915100347 1:153494935-153494957 CCTGCTTCATACCTTGGCTTTGG - Intergenic
915304764 1:154970875-154970897 CCTGCTCCAGTTCGAGGTTGGGG - Intronic
915924169 1:160003718-160003740 CCTGCCCCATACCTTGGGTCAGG - Intergenic
917528023 1:175806781-175806803 CCTGCTGGAGACCTTAGCTGAGG - Intergenic
920796951 1:209147909-209147931 CATTCTCCAGAACTTGCTTGTGG - Intergenic
921521896 1:216166537-216166559 CCTAGTCCAGACCTATGTTGTGG - Intronic
1063667134 10:8069519-8069541 CCTCCTCCAGAGTGTGGTTGTGG - Exonic
1064839604 10:19576092-19576114 CCTGCTCATGTCCTTGGTTTGGG - Intronic
1067221091 10:44344949-44344971 CCTGCTCCAGAGCCTGGGAGAGG + Intergenic
1069570149 10:69489843-69489865 CCTCCTCCAGCCCCTGGCTGGGG - Intronic
1070186729 10:74070793-74070815 CCTGCTCCTTACCTTCGATGAGG + Exonic
1070801529 10:79247003-79247025 CCTGCTCCAGCCCTGAGGTGAGG + Intronic
1071882907 10:89918775-89918797 CCTACTCCAGAACCTGGTGGGGG - Intergenic
1072534794 10:96353886-96353908 CCTGCTCCAGCCTCTGGTGGGGG - Intronic
1074409836 10:113218491-113218513 CCTGCTACATTCCTGGGTTGGGG - Intergenic
1074490347 10:113934311-113934333 CCTCCCCCAGCCCTGGGTTGGGG + Intergenic
1075193733 10:120335887-120335909 CCCGCACCAGACATTGGCTGAGG + Intergenic
1076592271 10:131591736-131591758 CCTCTGCCAGACCTTGATTGGGG + Intergenic
1076835994 10:133021211-133021233 CCGGCCCCAGCCCTGGGTTGAGG + Intergenic
1078091252 11:8266050-8266072 CCTGCTCCAGTCCCTGGGTTTGG - Intronic
1079028565 11:16968071-16968093 CCTGCTCTAGATCTCAGTTGGGG - Intronic
1081396093 11:42588026-42588048 GCTGCCCCAGACCTTGCTGGGGG + Intergenic
1082645184 11:55715035-55715057 ACTGCTGGAGAACTTGGTTGTGG + Intergenic
1082646006 11:55726453-55726475 ACTGCTGGAGAACTTGGTTGTGG + Intergenic
1082650605 11:55787210-55787232 ACTGCTGGAGAACTTGGTTGTGG + Intergenic
1082760373 11:57121506-57121528 CCTGCTCCTATCCTTGGGTGAGG + Intergenic
1083795512 11:65014434-65014456 CCTGCCCCAGTCCTGGGGTGCGG - Intronic
1084646578 11:70462583-70462605 CAAGCTCCAGAACTTGGATGAGG + Intergenic
1088325507 11:108596741-108596763 CATGCTTCAGCCCTGGGTTGTGG + Intergenic
1089519530 11:119054704-119054726 CCGGCTCCATACCTTAGATGAGG + Intronic
1089668939 11:120039035-120039057 CCTGCTACACACCATGGATGGGG + Intergenic
1089741861 11:120590047-120590069 CCAGCTCCAGACCTTGGCCTTGG - Intronic
1096007731 12:48185761-48185783 CATGCTCCATGCCCTGGTTGGGG - Exonic
1096499203 12:52055080-52055102 CCCGCTCCGGGCCTTGGTTGAGG - Exonic
1096514591 12:52148879-52148901 CCTGCCCCAGACTTGGGTGGGGG + Intergenic
1098084802 12:66830801-66830823 CCAACTCCAGACCCTGGTTTTGG + Intergenic
1103358864 12:120342146-120342168 CCTGCTCCCTACCTAGGTTGGGG - Exonic
1105027325 12:132857613-132857635 GCTGCTGCGGACCTTGGTCGAGG - Intronic
1105776818 13:23669996-23670018 CCTGCCCCAGATCAGGGTTGTGG + Intronic
1106580168 13:31010864-31010886 CCTTCTCCAGACTCTGCTTGAGG - Intergenic
1108198674 13:48020657-48020679 CCTGCTCCAGTCCTTGGGCTAGG + Intergenic
1109053782 13:57519302-57519324 CATGCTCCAGATCTTGGTGGTGG - Intergenic
1109934186 13:69259632-69259654 CCTGATCCAGACCTTGAGAGAGG - Intergenic
1112889730 13:104214081-104214103 CCTGCTTCAGACACTGATTGAGG + Intergenic
1112914412 13:104528903-104528925 CCTTCTCCACACCTTAGTGGGGG - Intergenic
1113946958 13:114049871-114049893 CCTGCCCCACTCGTTGGTTGTGG - Intronic
1114135291 14:19841739-19841761 CCTGTTCTATATCTTGGTTGCGG - Intergenic
1114524738 14:23360474-23360496 CCTGCTGCAGGCCCTGGGTGGGG + Intronic
1115338228 14:32263491-32263513 TGTGCTCCAGACCCTGGATGTGG + Intergenic
1117504421 14:56388301-56388323 CCAACTCCAGGCCTTGGTTCTGG - Intergenic
1118036661 14:61875753-61875775 CCTGCACCAGACCTGCATTGTGG + Intergenic
1119040185 14:71267700-71267722 CCAGCGCCAGAAATTGGTTGAGG - Intergenic
1119588501 14:75861640-75861662 CTTGCTCCAAACCCTGGTTAAGG - Intronic
1121961522 14:98264538-98264560 CCTGCTGAACACCTTGATTGTGG + Intergenic
1122636385 14:103131732-103131754 CCTGCTCCAGAACCTGCATGAGG + Exonic
1122801408 14:104231559-104231581 CCTGCACCAGCACTTGGTGGTGG + Intergenic
1125507726 15:40276637-40276659 CCTGCTCCAGGCCATGGCTGGGG + Exonic
1125728966 15:41882310-41882332 GCTGCTCCAGACCCGGGTGGTGG - Exonic
1127167633 15:56263643-56263665 ACTGCTCTATACCTTGATTGCGG - Intronic
1127734825 15:61830830-61830852 CCTGTTCCAGGCCCTGGCTGGGG - Intergenic
1127816082 15:62610051-62610073 CCTGCTCCAGACTTAGGAGGGGG + Intronic
1128090555 15:64916087-64916109 CCTGGTCCTGACCTTGGGTGGGG - Intronic
1128709365 15:69860297-69860319 TCTGGTCCCTACCTTGGTTGGGG + Intergenic
1128802205 15:70504071-70504093 CCTGCTGGAGACCTTGCTTGGGG + Intergenic
1131829854 15:96347317-96347339 CCTGTCCAAGACCCTGGTTGGGG + Intergenic
1132582841 16:693448-693470 CCTGCGCCACCCCTGGGTTGAGG + Exonic
1132851780 16:2028069-2028091 CTCCCTCCAGACCCTGGTTGGGG + Intronic
1132975662 16:2709997-2710019 CCTGCTCCGGGCTTTGGCTGGGG - Intergenic
1133548660 16:6832861-6832883 CCTGTGCTAGACCTTGGTTCTGG + Intronic
1133592104 16:7255605-7255627 GCTGGTCCAGACCTTGCTTAGGG - Intronic
1134047897 16:11114698-11114720 GCTGCTCCACACCCTGGCTGTGG - Intronic
1136463894 16:30429082-30429104 TCTCCTCCTGGCCTTGGTTGGGG - Exonic
1137013807 16:35352430-35352452 CCTGCTGCAGACCCTGCTTCAGG + Intergenic
1137762670 16:50953170-50953192 CCTGCTCCAAGCCATGGCTGTGG + Intergenic
1140199285 16:72881526-72881548 CTTGTTCCCGACCTTGGTAGGGG - Intronic
1140475258 16:75236745-75236767 CTGGCTCCAGACCCTGGTTCTGG - Intronic
1141426129 16:83945906-83945928 CCTGCTGATGACCCTGGTTGGGG - Intronic
1141742664 16:85904328-85904350 CCCCCTCCACACCTTGTTTGTGG - Intronic
1141881078 16:86859823-86859845 TGTGCTCCAGACGTTGGTGGTGG - Intergenic
1142235835 16:88922129-88922151 CCTGCGCCACACTTTGGGTGGGG + Intronic
1142279897 16:89142322-89142344 CCTGCTGTAGGCCTTGTTTGGGG - Intronic
1145268237 17:21390668-21390690 CCTGGTCCAGAGTTTGGTTGTGG + Intronic
1147945674 17:44078861-44078883 CCAGCTGCAGCCCTTGGATGAGG - Exonic
1148127584 17:45244878-45244900 CCGGCTCCAGAGCCTGGATGCGG + Exonic
1148704893 17:49621162-49621184 CCTGCTCCAGGGATTGGTTCAGG + Intronic
1149156743 17:53639890-53639912 TCTGCTCTAGACCTTGGAGGAGG - Intergenic
1149548544 17:57522507-57522529 GCTGCTCCAGAGCTTTGCTGTGG - Intronic
1151606873 17:75143095-75143117 CCTGCTCCATACCCTGGAGGAGG + Intronic
1152191717 17:78892167-78892189 CCAGCTCCAGCGCTTGGCTGAGG - Exonic
1152623408 17:81377575-81377597 CCAGCTTCAGGGCTTGGTTGGGG - Intergenic
1153814798 18:8783094-8783116 CCTGCACCAGGCCTTGGTGAGGG + Intronic
1154459421 18:14565736-14565758 CCTGTTCTATATCTTGGTTGTGG - Intergenic
1158433791 18:57418207-57418229 GCTGCCCCAGACCTTGCTGGGGG - Intergenic
1160016894 18:75150500-75150522 CCTACTCCAGACTTTTGTTTTGG + Intergenic
1160608104 18:80067260-80067282 CCTGCCCCAGAACTCAGTTGGGG + Intronic
1162056198 19:8065651-8065673 CCTCTTCCTGACCTTGGCTGTGG + Exonic
1162371683 19:10283770-10283792 CCAGCTCCAGACCTTTGGTGAGG + Exonic
1163187246 19:15647348-15647370 CCAGCTGCAGCCTTTGGTTGGGG + Intronic
1163302915 19:16458972-16458994 CCTGCTCCACGCCTGGGCTGTGG + Intronic
1165230126 19:34381617-34381639 CCTGCTGCATACCTAGCTTGGGG + Intronic
1165837348 19:38767301-38767323 CCTGCTCTAAAACTTGGTGGAGG - Intronic
1166464985 19:43024234-43024256 CCTGTTCCAGGGCTGGGTTGTGG - Intronic
1168163787 19:54532899-54532921 CCACCACCAGACCTGGGTTGTGG - Intronic
927177930 2:20423239-20423261 CCTGCTCCAGGCCTTAGCTCAGG + Intergenic
928096326 2:28407240-28407262 CCTGCTGCAGGCCTGGGTTTAGG - Intronic
928454027 2:31403260-31403282 CCTGCTGCCTTCCTTGGTTGAGG - Intronic
933285938 2:80384804-80384826 AGTGCTCCAGACCTTGCCTGAGG + Intronic
934657563 2:96124016-96124038 CCTGCTCCAGGCCTTGATCTTGG + Exonic
935940943 2:108238717-108238739 CCTGCTACAGACCTTCTTTAAGG - Intergenic
936875338 2:117182587-117182609 GTTGCTGCAGACATTGGTTGTGG - Intergenic
936937685 2:117853922-117853944 CCTAATCCAGGCCTTGGGTGAGG + Intergenic
937924304 2:127156047-127156069 CTTGCTCCAGTCCATGCTTGTGG + Intergenic
941928387 2:170917599-170917621 CCTGCTCCAGCCCATGGCTCTGG + Intergenic
945408155 2:209476166-209476188 CCTTCTCGAGACCATGATTGTGG + Intronic
946665222 2:222042485-222042507 GATGCTCCAGAACTTGGTTCTGG - Intergenic
947599653 2:231438344-231438366 CCTGGCCCAGACCCTGATTGTGG + Intergenic
948504038 2:238415836-238415858 CCTGCTCCAGCCCATGGCTCTGG + Intergenic
949035543 2:241814297-241814319 GCTGCTCCAGATCTGGGGTGAGG + Intronic
1170454335 20:16518298-16518320 CCCGCTTCCCACCTTGGTTGTGG - Intronic
1172080714 20:32338588-32338610 CCTTCCCCAGCCCTTCGTTGTGG + Intergenic
1174524903 20:51163104-51163126 CCTCCTCCCGACATTGGGTGAGG - Intergenic
1174541670 20:51294590-51294612 CCTGCTCCAGCCCTGGGCTTGGG + Intergenic
1175283509 20:57821074-57821096 TCTCCCCCAGACCCTGGTTGAGG + Intergenic
1175908497 20:62393405-62393427 CCTGTTCCAGGCCGTGGTTAAGG + Intronic
1178258909 21:31080639-31080661 CCTGGTCAACACCTTGATTGCGG + Intergenic
1179401820 21:41091256-41091278 CCAGCTCCAGAGCTTGGTGTAGG - Intergenic
1183703190 22:39461356-39461378 CCTGCACCAGCCCTGGGGTGAGG + Intronic
1184752418 22:46495205-46495227 CCTGCTACACACCTAGGCTGTGG + Intronic
1184791731 22:46704129-46704151 CCTCCTCTAGGCCTTGGCTGTGG - Intronic
1184808706 22:46813818-46813840 CCTGCCCCAGTCCTGGGCTGAGG - Intronic
1185241330 22:49749219-49749241 CCTGCTCCAGACCCAGCTTCTGG + Intergenic
952102245 3:30027707-30027729 CCTGCCCCATAGCTGGGTTGGGG + Intergenic
952264698 3:31774370-31774392 CCTGCTCCAGGGCGTTGTTGTGG - Intronic
952279696 3:31911087-31911109 CCTGCTTCAGACCCTGTTTGAGG + Intronic
952906317 3:38141231-38141253 CCTGCACCAAATCTTGGTTCTGG + Exonic
953749192 3:45596232-45596254 CTCGCTCCAGACGTTGGGTGAGG - Exonic
954155539 3:48683000-48683022 CCTGCTCCAGGCCCTGGGGGGGG + Exonic
954491286 3:50908736-50908758 CTTGATCCAGACCTTAGTTCAGG + Intronic
954816665 3:53287570-53287592 TCTGCTCCAGTCATAGGTTGTGG + Exonic
958636837 3:96755737-96755759 CCTGCTCCAGTCCTTGGCAAGGG - Intergenic
961179439 3:124865049-124865071 CCTGCTGCAGAACTTGGCAGTGG - Intronic
961329277 3:126129211-126129233 CCTCCTCCAGCCCGTGCTTGAGG + Intronic
961778458 3:129306964-129306986 CCTGCGCCAGAGATTGGTAGAGG - Intergenic
962755707 3:138464219-138464241 CCTGGTCCAGACCGTGGAGGGGG + Intronic
967156373 3:186696234-186696256 CCTGCTCCATACCTGGGTGCAGG - Intergenic
967488610 3:190062828-190062850 CCTGTTCAAGTCCTTGGTGGTGG - Intronic
968884135 4:3318247-3318269 CCTGTTCGAGTCCTTGGTTCTGG + Intronic
968939297 4:3629824-3629846 TCTGCTCCAGAGCCTGGCTGTGG + Intergenic
969655717 4:8497138-8497160 CCTTCTCCAGAGCAAGGTTGAGG + Intergenic
969925688 4:10583794-10583816 CTTGCTCCCCACCTTGGTTAAGG - Intronic
970207148 4:13666351-13666373 CCTGCACCACACCTTGTTGGAGG + Intergenic
971229966 4:24793745-24793767 CCTGCTCCAGAGGTAGCTTGTGG - Intronic
980076383 4:128298227-128298249 CCGGGTCCACACCTTGGTTCAGG - Intergenic
981748216 4:148070825-148070847 CCTGCACCTGACCATGGTTGGGG + Intronic
983944129 4:173567364-173567386 CCTGCTCTAGACCATGCTTTGGG + Intergenic
986518605 5:8590252-8590274 CCTGGTCAACACCTTGGCTGTGG - Intergenic
987517419 5:18930786-18930808 TCTGTTCCAGAACTTGTTTGTGG + Intergenic
991119422 5:62994125-62994147 CCTGCAGCAAACCTTTGTTGAGG + Intergenic
992034828 5:72762724-72762746 CCTTCTCCAGCCTTTGGATGAGG - Intergenic
992791660 5:80219564-80219586 CCTGCTCCAGAAGTGGGTGGAGG - Intronic
993129000 5:83872458-83872480 CCTATTCCATACCTTAGTTGAGG - Intergenic
993770423 5:91918080-91918102 TCTGGTCCAGTTCTTGGTTGTGG + Intergenic
995379065 5:111512268-111512290 CCTGCTCCAGACCATGGATCTGG - Intronic
997780961 5:136658030-136658052 CTTGCTCCAGTCTTTGCTTGAGG + Intergenic
999028901 5:148268016-148268038 CCTGCTCCAGACCTTGGTTGTGG - Intergenic
1002279413 5:178121914-178121936 CCTGCTCCAGTGCCTGGTTGCGG - Exonic
1007268977 6:40621182-40621204 CCTGCTCCAGACCTTTGACCTGG + Intergenic
1007359585 6:41345525-41345547 CTTGCTCCTGCCCTTGGTGGCGG - Intronic
1007574436 6:42916023-42916045 CCAGCTGCAGACCTGAGTTGCGG - Exonic
1008885681 6:56430017-56430039 CCTGCTCCAGACCCTGGCTAGGG + Intergenic
1009744865 6:67799166-67799188 CCAATTCCACACCTTGGTTGTGG + Intergenic
1011254720 6:85408505-85408527 CTTGCTCCAGATCTTGGGAGAGG + Intergenic
1013435664 6:110103408-110103430 CCTGCTCCATGCATTGGTGGAGG + Exonic
1015257793 6:131199621-131199643 CGTGCTCCAGACCATGCTTATGG - Intronic
1017032744 6:150238497-150238519 CCTTCTCCAGTCTTTGGCTGTGG + Intronic
1017478718 6:154827806-154827828 CCTGCCCCACACCTTTTTTGGGG + Intronic
1020117650 7:5485097-5485119 CCTGCTTCATTCCTTGCTTGTGG - Intronic
1020979455 7:15049877-15049899 ACTGTTCCATATCTTGGTTGTGG + Intergenic
1024158071 7:46646863-46646885 TCTGCTCCAGACCTTCATGGTGG - Intergenic
1024160001 7:46664216-46664238 CCTCCTCCAGGCCTTTGCTGTGG - Intergenic
1026257995 7:68729455-68729477 CCTCCTCCAGACCTGTGTCGTGG + Intergenic
1029371439 7:100153525-100153547 CCTGCCCCTGCCCTTGGTGGTGG + Intronic
1030821784 7:114101596-114101618 CCTGCTCTAGAATTTTGTTGGGG + Intronic
1034729599 7:153374843-153374865 CCTGCTCCAGACCCTGGGATAGG - Intergenic
1035234143 7:157485361-157485383 CCTGCTCCAGACCTCTGCCGGGG - Intergenic
1037717285 8:21411159-21411181 GCTGCCCTAGACCTTGGATGAGG + Intergenic
1039525334 8:38209658-38209680 CCTTTTCAAGACCTTGCTTGAGG + Intronic
1044406891 8:91837779-91837801 CCTTCTCCAGTGCTTGTTTGAGG - Intergenic
1048940234 8:139394179-139394201 CCTGCTCCAGAGGGTGTTTGAGG + Intergenic
1049806721 8:144544323-144544345 CCTCCTCCACACCTGGGCTGGGG + Intronic
1049875072 8:145012139-145012161 CCTGCTCCAGTCCCTGGCTAGGG - Intergenic
1053598916 9:39590734-39590756 CCTGCTGCAAACCTTGGTGTGGG - Intergenic
1053856670 9:42345251-42345273 CCTGCTGCAAACCTTGGTGTGGG - Intergenic
1054451460 9:65405500-65405522 TCTGCTCCAGAGCCTGGCTGTGG - Intergenic
1056560145 9:87722915-87722937 ACTTCTTCAGGCCTTGGTTGTGG + Intergenic
1056672423 9:88641918-88641940 CCTGCTCCAGACCTGGGACCAGG + Intergenic
1057173178 9:92976086-92976108 CCTGCTCCAGGCTTTCGGTGGGG + Intronic
1057378470 9:94545605-94545627 CTTGCTTCAGATCTTTGTTGAGG - Intergenic
1057711650 9:97451017-97451039 CCTTCCCCAGAGGTTGGTTGGGG - Intronic
1058812810 9:108657661-108657683 CATGTTCCAGCCCTTGGTTAAGG - Intergenic
1060206709 9:121686612-121686634 CCTGCTTCATCCCTGGGTTGGGG - Intronic
1192064695 X:67869763-67869785 CCTGCTCAACCCCTTAGTTGTGG + Intergenic
1194506178 X:94736681-94736703 CCTGATCCAGACCTGAGTTCAGG + Intergenic
1198302619 X:135346104-135346126 CCAGCTCCTAACCTTGGGTGAGG + Intronic