ID: 999030160

View in Genome Browser
Species Human (GRCh38)
Location 5:148281580-148281602
Sequence GAGGGTAAACAGAAGCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1597
Summary {0: 1, 1: 1, 2: 45, 3: 351, 4: 1199}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999030160_999030169 24 Left 999030160 5:148281580-148281602 CCACTCTGCTTCTGTTTACCCTC 0: 1
1: 1
2: 45
3: 351
4: 1199
Right 999030169 5:148281627-148281649 CAGTTCCAGTGAGATAAGTCAGG 0: 1
1: 1
2: 18
3: 155
4: 828

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999030160 Original CRISPR GAGGGTAAACAGAAGCAGAG TGG (reversed) Intronic
900371953 1:2336162-2336184 GTGGGCATGCAGAAGCAGAGAGG - Intronic
900704730 1:4073251-4073273 AAGGGGAAAAAGAAGGAGAGTGG + Intergenic
900743940 1:4347595-4347617 GAGGGGAAACTGAGGCACAGAGG + Intergenic
901316343 1:8312365-8312387 AACTGTAAATAGAAGCAGAGGGG + Intergenic
901384598 1:8899372-8899394 GAGGGAAAAAAGAAGAAAAGAGG - Intergenic
901460396 1:9387706-9387728 GAGCTAAAACAGAAGCAGAAGGG + Intergenic
901595227 1:10379790-10379812 GAGGGCACACAGACACAGAGAGG - Intronic
901853568 1:12030475-12030497 GTGGGGAGACCGAAGCAGAGGGG + Intronic
901954303 1:12772790-12772812 GAGGCCAGACAGAAGCACAGTGG - Intergenic
902051639 1:13567927-13567949 GAGGGGAAAGAGAGGCAGAGGGG + Intergenic
902051649 1:13567971-13567993 GAGGGGAAAGAGAGGCAGAGGGG + Intergenic
902051659 1:13568015-13568037 GAGGGGAAAGAGAGGCAGAGGGG + Intergenic
902051669 1:13568059-13568081 GAGGGGAAAGAGAGGCAGAGGGG + Intergenic
902051679 1:13568103-13568125 GAGGGGAAAGAGAGGCAGAGGGG + Intergenic
902170142 1:14603721-14603743 GAGGGTAAAGGGATGGAGAGAGG - Intronic
902171509 1:14615321-14615343 GAGGCTAAAGAAGAGCAGAGTGG + Intronic
902192831 1:14775568-14775590 GTGGGCAGACAGAAGCTGAGAGG + Intronic
902529329 1:17080452-17080474 GAAGGCATAAAGAAGCAGAGTGG + Intronic
902965170 1:19995849-19995871 GAGGGTGAGCAAAAGCAGGGTGG - Intergenic
903305074 1:22407660-22407682 GAGGGTTGCCAGCAGCAGAGGGG + Intergenic
903390279 1:22959096-22959118 GAACGTAACCAGAAGCCGAGGGG + Intronic
903517071 1:23918459-23918481 GAAAGTAAACAGAAGCAGGCCGG + Intergenic
903967245 1:27098565-27098587 GAGGTGAAAAAGAGGCAGAGGGG - Intergenic
904010055 1:27384081-27384103 GAGGGTTAGGAGAAGCAGATGGG - Intergenic
904206766 1:28860656-28860678 GTAGGGAAACAGAATCAGAGAGG + Intronic
904447308 1:30585579-30585601 GAGGGAAAGCTGAAGCAGGGCGG - Intergenic
904751465 1:32743242-32743264 GAGGGTAAACACAGGCAGAATGG - Intronic
905102786 1:35540196-35540218 AAAGGGAAACAGAAGCAGGGAGG - Intronic
905312690 1:37061204-37061226 GAGGGAAATGAGAGGCAGAGTGG - Intergenic
906579634 1:46925692-46925714 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
906604089 1:47153196-47153218 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
906636519 1:47414039-47414061 GAGGGGCTACAGAAGCAGAGAGG - Intergenic
906667187 1:47630315-47630337 GGGGGAAAACAGGAGCATAGTGG + Intergenic
906709607 1:47919444-47919466 GGGGGTAACAGGAAGCAGAGAGG + Intronic
906740033 1:48173516-48173538 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
906980398 1:50622703-50622725 GATGGTAAAGAGGAACAGAGAGG + Intronic
907015099 1:51005082-51005104 GAGGGTAAGCCAAAGCAGGGTGG + Intergenic
907786827 1:57620714-57620736 GAGAGAACACAGATGCAGAGAGG + Intronic
908592788 1:65651826-65651848 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
908598361 1:65711825-65711847 GAGGGCAAGCAGAAGCAAGGTGG - Intergenic
908601477 1:65744520-65744542 GAGGGCAAGCAGAAGCCGGGTGG - Intergenic
908611489 1:65865676-65865698 GAGGAAGAGCAGAAGCAGAGTGG - Intronic
908813579 1:68009057-68009079 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
909261311 1:73492131-73492153 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
909356776 1:74718638-74718660 AAGGGTAACTAGAAGGAGAGAGG - Intronic
909384159 1:75036509-75036531 GAGGGTGAGCACAAGCAGGGTGG + Intergenic
909493209 1:76248105-76248127 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
909557398 1:76969190-76969212 GAGGGCAAGCCGAAGCAGGGTGG + Intronic
909558330 1:76981162-76981184 GAGGGCGAGCTGAAGCAGAGCGG + Intronic
909707777 1:78607839-78607861 GAGGGTGAGCTGAAGAAGAGGGG + Intergenic
910033639 1:82763428-82763450 GAAGGTAACCAGAGGAAGAGGGG - Intergenic
910281696 1:85508491-85508513 GAGGGCAAGCTGAAGCAGGGCGG + Intronic
910330918 1:86071855-86071877 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
910383558 1:86657589-86657611 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
910606339 1:89088831-89088853 GAGGGCGAACAGAAGCAGGGTGG - Intergenic
910626852 1:89316477-89316499 GAGGGTGAGCAGAAGCAAGGTGG + Intergenic
910827916 1:91428731-91428753 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
911054888 1:93701076-93701098 GTGGGGAAACAGGAGCAGAGAGG - Intronic
911339308 1:96617828-96617850 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
911417308 1:97590828-97590850 GAGTGGCATCAGAAGCAGAGAGG - Intronic
911474302 1:98357442-98357464 GAGGGTAAGCAGCAGCAGCATGG - Intergenic
911530626 1:99039398-99039420 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
912235253 1:107844165-107844187 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
912244247 1:107944216-107944238 GAGGGTAAGTAGAAGATGAGAGG - Intronic
912301482 1:108521034-108521056 GTGGGTGAGCTGAAGCAGAGTGG - Intergenic
912375753 1:109208559-109208581 GAGGTGAAAAGGAAGCAGAGGGG - Intergenic
912675714 1:111679235-111679257 GAGGGCTAGCAGAAGCAGGGTGG + Intronic
912894948 1:113576453-113576475 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
912963108 1:114213544-114213566 GAGGGTGAACAGAAGATGACTGG + Intergenic
913102815 1:115584819-115584841 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
913512446 1:119574019-119574041 GAGGGCGAGCTGAAGCAGAGTGG + Intergenic
914248763 1:145905167-145905189 GTGGGGGAACAAAAGCAGAGTGG + Intronic
914457972 1:147854715-147854737 GAGGGCAAGCAGAAGCAGGGAGG + Intergenic
915061443 1:153188947-153188969 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
915077398 1:153320399-153320421 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
915271442 1:154756485-154756507 GAGAGTAAACAGATGAAGGGGGG - Intronic
915651520 1:157315405-157315427 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
915654570 1:157348567-157348589 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
915716565 1:157950148-157950170 GAGGGGAAACAGAGGGAGGGAGG + Intergenic
915744199 1:158143508-158143530 AAGGGAAAACAGAAGAAGAATGG + Intergenic
916038426 1:160941874-160941896 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
916204108 1:162298482-162298504 GAGGATCAGCAGAGGCAGAGTGG + Intronic
916259878 1:162831066-162831088 GAATAAAAACAGAAGCAGAGTGG + Intronic
916276303 1:162997538-162997560 GAGGTTAAAGACAAGCAAAGTGG + Intergenic
916362788 1:163990127-163990149 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
916612881 1:166410202-166410224 GAGGGCGAGCAGAAGCAGAGTGG - Intergenic
916731678 1:167572196-167572218 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
916856908 1:168759538-168759560 GAGGGTAAACAAAGTCAGAAAGG + Intergenic
917019293 1:170569019-170569041 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
917023455 1:170614823-170614845 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
917069727 1:171137143-171137165 GGAGGGAAACAGAAGCAGAAAGG + Intergenic
917163231 1:172080921-172080943 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
917257584 1:173132216-173132238 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
917357680 1:174143717-174143739 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
917405894 1:174708489-174708511 AAGGATTAACAGAAGCAGGGTGG + Intronic
917533260 1:175855734-175855756 GGGGGAACCCAGAAGCAGAGAGG - Intergenic
917573717 1:176297065-176297087 GAGGGCAAGCCGAAGCAGGGAGG - Intergenic
918159948 1:181889229-181889251 GAGGGTGAGCAACAGCAGAGTGG + Intergenic
918163278 1:181920580-181920602 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
918353760 1:183684884-183684906 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
918501578 1:185201546-185201568 GAGGGCAAGCTGAAGCAGAGTGG - Intronic
918537143 1:185586549-185586571 GAGGGTGAGCCAAAGCAGAGTGG + Intergenic
918624967 1:186646993-186647015 AATGGTACACAGCAGCAGAGGGG - Intergenic
918632154 1:186730806-186730828 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
919063967 1:192668932-192668954 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
919836138 1:201574781-201574803 GAGGATAAACAGAGGCAGGGAGG - Intergenic
920094514 1:203477492-203477514 GAGGGGAAACAGAAGCTCTGTGG - Intronic
920299634 1:204980651-204980673 GAGAGGAGACAGGAGCAGAGGGG + Intronic
920406030 1:205711905-205711927 GTGGATAAACAGATGAAGAGAGG - Intergenic
920428789 1:205900464-205900486 GAGGGGAAACCGGAACAGAGAGG + Intergenic
920631783 1:207659675-207659697 GAGGGCAAGCTGAAGCAGAGCGG + Intronic
920780904 1:208990181-208990203 GAGGGGAAACAGAGGGAGAGGGG + Intergenic
920985508 1:210885255-210885277 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
921004088 1:211075752-211075774 GAGGGCAAGCCGAAGCAGGGCGG + Intronic
921222530 1:212983392-212983414 GAGGGCAAAGAGAGGGAGAGAGG + Intronic
921626101 1:217379514-217379536 GAGGGCAAACAGAAGCAGGGTGG + Intergenic
921631261 1:217437077-217437099 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
921671350 1:217927265-217927287 GAGAGCAAAGAGAAGGAGAGTGG + Intergenic
921962153 1:221047279-221047301 GAGGGTGAACAGAAGTAGGGTGG + Intergenic
922066129 1:222145642-222145664 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
922406298 1:225316647-225316669 GAGGGAGAACTGAAGCAGGGTGG - Intronic
922715928 1:227872034-227872056 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
923067062 1:230527567-230527589 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
923690997 1:236192635-236192657 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
923853345 1:237820368-237820390 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
924226610 1:241927303-241927325 GAGGGGAAGGAAAAGCAGAGTGG - Intergenic
924253486 1:242158610-242158632 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
924293975 1:242566898-242566920 GAGGGTTAAAAGAGGGAGAGGGG - Intergenic
924295930 1:242586785-242586807 GAGGGCAAGCCGAAGCAGGGAGG + Intergenic
924621984 1:245669937-245669959 GAGGGTCCACAAAGGCAGAGTGG + Intronic
924829092 1:247573484-247573506 GAGGGTGAACAGAAGCAGGGTGG - Intronic
924878144 1:248128451-248128473 GAGAGTTAGCAGAAGCAGGGTGG + Intergenic
924894120 1:248317260-248317282 GAGAGTGAGCAGAAGCAGAGTGG - Intergenic
1062961984 10:1579071-1579093 CAGGGTAAACTGAGGCAGTGTGG - Intronic
1063186317 10:3654986-3655008 GAGAGGAAAAAGAAGCAAAGAGG - Intergenic
1063662116 10:8042140-8042162 GAGGGTAAATGGAGCCAGAGAGG + Intergenic
1064264641 10:13815641-13815663 CAGGGTCAACAGAGGTAGAGTGG - Intronic
1064829538 10:19446251-19446273 GAGTGTAAGCTGAAGCAGGGTGG - Intronic
1065121067 10:22530754-22530776 GAGGGCAAACAGAAGCCGGGTGG - Intergenic
1065261895 10:23932116-23932138 GAAGGTAACCAGAAGCTGAGGGG + Intronic
1065651656 10:27899155-27899177 GAGGGCAAGCAGAAGCAGACTGG + Intronic
1065811906 10:29450400-29450422 GAGGGTGCACAGAAGGAAAGTGG - Intergenic
1065907566 10:30271962-30271984 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1066140866 10:32502354-32502376 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1066159578 10:32714246-32714268 GAGGGCGAGCAGAAGCAGGGTGG + Intronic
1066174807 10:32892147-32892169 GGAGGTAAACTGAAGCTGAGAGG + Intergenic
1066257728 10:33696580-33696602 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1066288855 10:33995706-33995728 GGGGGAAAAATGAAGCAGAGGGG - Intergenic
1066751218 10:38659332-38659354 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1066965826 10:42263759-42263781 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1067209776 10:44250199-44250221 GAGGGCAAGCCGAAGCAGGGTGG - Intergenic
1067251933 10:44593984-44594006 GACAGTGAGCAGAAGCAGAGTGG + Intergenic
1067332353 10:45333919-45333941 GAGGGTGAACTGAGGCAGGGTGG - Intergenic
1067944949 10:50683497-50683519 GAAGGTACACTGAGGCAGAGAGG - Intergenic
1068086175 10:52375521-52375543 GAAGGCAAGCAGAAGCAGGGTGG - Intergenic
1068357188 10:55923806-55923828 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1068495306 10:57778992-57779014 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1068575076 10:58675980-58676002 GAGAGTGAGCAGAAGCAGGGTGG + Intronic
1068609571 10:59043824-59043846 GAGGGCATGCCGAAGCAGAGTGG - Intergenic
1069026179 10:63544648-63544670 GAAGGTACACAGAAGCAGATGGG + Intronic
1069120899 10:64567792-64567814 GAGGGTGAGCAGAAGTAGGGAGG - Intergenic
1069264372 10:66438988-66439010 GAGGGTGACCCGAAGCAGGGTGG - Intronic
1069370850 10:67746542-67746564 GAGAGCAAAGAAAAGCAGAGTGG + Intergenic
1069746742 10:70719916-70719938 GTGTGTAAACAGAGGCAGTGTGG - Intronic
1070213086 10:74347277-74347299 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1070322732 10:75366531-75366553 GTGGGGACACAGAGGCAGAGCGG - Intergenic
1070504792 10:77103772-77103794 GAGGGGAAAAAGATGGAGAGGGG - Intronic
1070714813 10:78711739-78711761 GAGGGAAAAGAGAAGCAAACCGG - Intergenic
1070866450 10:79710368-79710390 GAAGGTACACTGAGGCAGAGAGG - Exonic
1070880243 10:79848499-79848521 GAAGGTACACTGAGGCAGAGAGG - Exonic
1070999653 10:80817722-80817744 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1071002103 10:80842047-80842069 GAAGGCAAGCAGAAGCAGTGTGG - Intergenic
1071337545 10:84613221-84613243 GTGGGAACACACAAGCAGAGTGG - Intergenic
1071441591 10:85702758-85702780 GAGGATAAACGGAGGCAGAGAGG + Intronic
1071633360 10:87232589-87232611 GAAGGTACACTGAGGCAGAGAGG - Exonic
1071646809 10:87364807-87364829 GAAGGTACACTGAGGCAGAGAGG - Exonic
1071698530 10:87903819-87903841 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1071699600 10:87916039-87916061 GTAGATAAACAAAAGCAGAGAGG - Intronic
1071844275 10:89505596-89505618 GAGGGTGAGCCGAAGCAGAGTGG + Intronic
1072009146 10:91288268-91288290 GAGGGAAAACAGAAGAAGAGAGG - Intergenic
1072044795 10:91643987-91644009 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1072375767 10:94814079-94814101 GAGGCTAAACTGAAGCAGGGAGG - Intronic
1072389643 10:94969730-94969752 GAGGCTAAACTGAAGCAGGGAGG - Intronic
1072394356 10:95023472-95023494 GAGAGTGAGCTGAAGCAGAGTGG - Intergenic
1072404324 10:95136032-95136054 GAGGGAGAGCAGAAGCAGGGTGG + Intergenic
1072480600 10:95807481-95807503 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1072493788 10:95934683-95934705 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1072541976 10:96405525-96405547 GGGAGTAAACAGAAGGAGATGGG + Intronic
1072616656 10:97054088-97054110 GAGGCTCACCAGAAGCCGAGCGG - Intronic
1072775107 10:98183011-98183033 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1072822953 10:98576525-98576547 GAGGACAAGGAGAAGCAGAGAGG + Intronic
1072953664 10:99870273-99870295 GAGGGTGAGCAGAAGCAGAGTGG - Intergenic
1073978863 10:109131555-109131577 GAGGGTGAGCCGAAGCAGAATGG + Intergenic
1074015463 10:109529867-109529889 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1074016848 10:109542869-109542891 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
1074117852 10:110471009-110471031 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1074532358 10:114306031-114306053 GAGGGGACACAGATGCAGAAGGG + Intronic
1075175387 10:120155855-120155877 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1075789171 10:125071183-125071205 GAGGGGAAACAGAGGCAGCGAGG + Intronic
1075805396 10:125184955-125184977 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1075984003 10:126767338-126767360 GAGGGCAAGCAGAACCAGGGTGG - Intergenic
1076389706 10:130090259-130090281 GAGGGACAACTGAAGCAGGGTGG + Intergenic
1077378077 11:2214961-2214983 GAGGATGAGCAGAGGCAGAGTGG - Intergenic
1077428395 11:2499017-2499039 GAGGGCACACAGAAGCAGGTGGG - Intronic
1077799584 11:5524748-5524770 GAGGGTAGACAGAAACAGGGAGG - Intronic
1077803784 11:5569427-5569449 GAGGGCAAACCAAAGCAGGGTGG + Intronic
1078024823 11:7685046-7685068 GAGGGTAACACAAAGCAGAGAGG + Intergenic
1078283793 11:9930770-9930792 GAGGGTGAGCCGAAGCAGCGTGG + Intronic
1078354764 11:10625413-10625435 GATGGCCAACAGAAGCTGAGGGG + Intronic
1078392987 11:10952555-10952577 GAGGGTCAGCCGAAGCAGGGTGG - Intergenic
1078410906 11:11116863-11116885 GATGGGAAAAAGAGGCAGAGAGG + Intergenic
1079407545 11:20159306-20159328 GAGGGGGGACAGAAGGAGAGAGG + Intronic
1079538656 11:21545701-21545723 GAGTGAAAACAGAATGAGAGGGG + Intronic
1079577783 11:22025130-22025152 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1079867821 11:25758137-25758159 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1080235886 11:30067595-30067617 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
1080334464 11:31180546-31180568 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1080346899 11:31335374-31335396 GAGGGGAAGCTGAAGCAGGGCGG - Intronic
1080489512 11:32747918-32747940 GAGGGCGAGCTGAAGCAGAGCGG - Intronic
1080638439 11:34143576-34143598 AAAGTTAAAGAGAAGCAGAGAGG - Intronic
1080709982 11:34737670-34737692 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1080849933 11:36059478-36059500 GAGGGTACAATGAATCAGAGAGG - Intronic
1080965703 11:37211410-37211432 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
1081095042 11:38921610-38921632 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
1081118198 11:39231917-39231939 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1081252436 11:40851431-40851453 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1081487138 11:43539711-43539733 GGGGGTTACCAGGAGCAGAGGGG + Intergenic
1081682456 11:45017783-45017805 GAGGGCAAGCTGAAGCAGGGCGG - Intergenic
1081691826 11:45083520-45083542 GAGGATAGACAGAGGCAGTGGGG + Intergenic
1082011510 11:47452864-47452886 CAGGCTCAACAGAGGCAGAGTGG + Intergenic
1082670624 11:56032970-56032992 GTGGGTGAGCAGAAGCAGGGTGG + Intergenic
1082680406 11:56161634-56161656 GAGTGGAAACTGAAGGAGAGGGG - Intergenic
1082872225 11:57953829-57953851 GAGGTTGAGCAGAAGCAGGGTGG - Intergenic
1082876400 11:57992971-57992993 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1083499097 11:63087281-63087303 GAGGGCAGGCAGAAGCAGGGTGG + Intronic
1083503490 11:63133285-63133307 GAGGGTAAGCTGAAGCAGGGTGG - Intronic
1083506960 11:63167027-63167049 GAGGGTAAGCTGAAGCAGGGTGG + Intronic
1083510140 11:63201990-63202012 GAGGGTGAGCAGAAGCAGGTTGG + Intronic
1083516310 11:63262107-63262129 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
1083997964 11:66281521-66281543 AAGAGTACACAGCAGCAGAGTGG - Intronic
1084504715 11:69558171-69558193 GACGGGAAACTGAGGCAGAGAGG - Intergenic
1085337896 11:75711331-75711353 GGAGGCAAACAGAAGCTGAGAGG - Intergenic
1085471560 11:76761684-76761706 GAAGGAAAATAGAAGCACAGAGG + Intergenic
1085863560 11:80261842-80261864 GGGAGGAAGCAGAAGCAGAGGGG - Intergenic
1085937236 11:81162332-81162354 GATGGCAAAGAGAAGGAGAGTGG + Intergenic
1085949016 11:81306900-81306922 CAGGGTAAAATAAAGCAGAGAGG - Intergenic
1086086116 11:82956681-82956703 GAGGGTGAGCTGAAGCAGCGTGG - Intronic
1086117279 11:83266277-83266299 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1086129117 11:83382836-83382858 GAGGGCAAGAAGAAGCAGGGTGG + Intergenic
1086298187 11:85395426-85395448 GAGGGTGAGCTGAAGCAGGGCGG + Intronic
1086414622 11:86576436-86576458 AAGGGTGAATAGAAGCAGAATGG - Intronic
1086421830 11:86644906-86644928 GAGGGTGAACAGAAGCAGGGTGG + Intronic
1086494325 11:87386668-87386690 GAGGGTGAGCCGAAGCAGGGCGG + Intergenic
1086608371 11:88724752-88724774 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1086732980 11:90271526-90271548 GAGGGCAAGCCGAAGCAGGGTGG - Intergenic
1087003503 11:93445058-93445080 GAGGGCAAGCTGAAGCAGGGCGG - Intergenic
1087311111 11:96545152-96545174 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1087831057 11:102820212-102820234 GAGGGTAAGCAGGAGCAGGGTGG - Intergenic
1088078379 11:105879186-105879208 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1088644979 11:111910882-111910904 GTGAGTAAACAGGAGCTGAGTGG - Intronic
1088702462 11:112425917-112425939 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1088707361 11:112475885-112475907 GAGGGTAGACAGAAGAAGGTGGG - Intergenic
1089430153 11:118416882-118416904 GAGGGTAAAGGGAAGCAGTTTGG + Intronic
1089529249 11:119116011-119116033 GAGGGGAAGCTGAGGCAGAGAGG - Intronic
1089597943 11:119593771-119593793 GAGGCTAAACCTCAGCAGAGGGG + Intergenic
1089766113 11:120766748-120766770 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1089942572 11:122434920-122434942 GAAGAAAAACAGAAGCAGTGTGG - Intergenic
1090160022 11:124482744-124482766 GTGGAGAAGCAGAAGCAGAGGGG - Intergenic
1090216347 11:124968628-124968650 GAGGGTGAACCGAAGCAGGGTGG - Intronic
1090307407 11:125703289-125703311 GAGCGCAAGCAGAAGCAGGGTGG + Intergenic
1090312614 11:125755768-125755790 GAAGGCAAGCAGAAGCAGGGTGG + Intergenic
1090722943 11:129493625-129493647 GAGGGCAAGCTGAAGCAGGGAGG + Intergenic
1090725172 11:129518394-129518416 GAGGGCAAGCAGAAGCAAGGTGG - Intergenic
1090811620 11:130249640-130249662 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1090879911 11:130824413-130824435 GAGAGGACACAGAAGAAGAGAGG - Intergenic
1091070616 11:132559167-132559189 GAGGGGAAAGAGAGGGAGAGAGG + Intronic
1091213613 11:133885545-133885567 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1091773619 12:3169857-3169879 GAGGGTACAGAGAAGCTTAGAGG + Intronic
1092304277 12:7283398-7283420 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1092306046 12:7302187-7302209 GGGAGAAAAGAGAAGCAGAGTGG - Intergenic
1092398876 12:8154208-8154230 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1092440320 12:8495749-8495771 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1092567777 12:9686143-9686165 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1092629031 12:10358826-10358848 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
1092637479 12:10467195-10467217 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1092661963 12:10748206-10748228 GAGGGTGAGCCGAAGCAGGGCGG - Intergenic
1093356520 12:18173905-18173927 GCAGGTAAAGATAAGCAGAGAGG + Intronic
1093545137 12:20336924-20336946 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1093608165 12:21119737-21119759 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
1093903802 12:24665564-24665586 CTGGGGAAACAGAAGCAGAAAGG + Intergenic
1094410862 12:30167694-30167716 GGAGAAAAACAGAAGCAGAGTGG - Intergenic
1094482372 12:30895021-30895043 GAGGGCAAGCCAAAGCAGAGTGG - Intergenic
1094669071 12:32551200-32551222 GAGGGCAAATAGGAGCAGACAGG + Intronic
1094695091 12:32809861-32809883 GAGAATAAAGAAAAGCAGAGTGG - Intronic
1094843813 12:34352809-34352831 GCAGGTAAACAGAAACAGTGCGG - Intergenic
1094846675 12:34364401-34364423 GAAGGAAAACAGAAACAGGGAGG - Intergenic
1094847497 12:34367742-34367764 GAAGGAAAACAGAAATAGAGAGG - Intergenic
1094851340 12:34383641-34383663 GAAGGAAAACAGAAACAGCGCGG - Intergenic
1095140504 12:38657048-38657070 GAGGGTGAGCTGAAGCAGTGCGG + Intronic
1095230579 12:39734203-39734225 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1095282246 12:40367056-40367078 GAAGGTACACAAAAGCAGAAAGG + Exonic
1095356334 12:41280059-41280081 GAGGGCGAGCAGAAGCAGGGTGG + Intronic
1095389681 12:41690522-41690544 ATGGGTAAACATAAGCAGAAAGG + Intergenic
1095511867 12:42959817-42959839 GAAGATAAGCAGAAGAAGAGAGG - Intergenic
1095547449 12:43388326-43388348 GAGGGTGAACAGAAGCAGGCAGG - Intronic
1095595218 12:43950995-43951017 GAGAGTGAGCAGAAGCAGGGTGG + Intronic
1095674156 12:44897464-44897486 GAGGGCAAGCAGAAGCAAAGTGG + Intronic
1095831545 12:46591964-46591986 GAGGGCTAGCAGAAGCAGGGTGG - Intergenic
1095920699 12:47526870-47526892 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1095930852 12:47624000-47624022 GAGGGCAAGCAGAAGCAAGGTGG + Intergenic
1096841380 12:54381515-54381537 GAGGAAACACAGACGCAGAGAGG - Intronic
1096950069 12:55459456-55459478 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1097023699 12:56038224-56038246 GAGGGGAATCAGAAGAAGAGAGG - Exonic
1097654516 12:62343692-62343714 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
1097898884 12:64853786-64853808 GAGGGTAAGCTGAAGCAGGGTGG - Intronic
1097956544 12:65492526-65492548 GAGGGGCAACAGAAGAAAAGGGG - Intergenic
1098082209 12:66799545-66799567 GAGGGGAAAAGGAAGGAGAGAGG - Intronic
1098477459 12:70921248-70921270 GAGTGGAAAGAGAAGCAAAGAGG - Intergenic
1098635535 12:72780040-72780062 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1098706810 12:73702165-73702187 GAGTGTGAGCAGAAGCAGGGTGG + Intergenic
1098759651 12:74407079-74407101 GAGGGAAAAGAGAGACAGAGAGG - Intergenic
1098780078 12:74676229-74676251 GAGGGCAAGCAGAAACAGGGTGG + Intergenic
1098993935 12:77096428-77096450 GAGGGCAAGCGGAAGCAGGGAGG - Intergenic
1099071449 12:78049504-78049526 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1099107809 12:78518769-78518791 GAGGGCAAACAGAAGCAGGGTGG + Intergenic
1099236185 12:80084562-80084584 GAGGGCGAACTGAAGCAGGGTGG - Intergenic
1099239015 12:80116345-80116367 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1099253801 12:80290186-80290208 GAGGGTGAGCAGAAGCAGGGCGG - Intronic
1099428318 12:82551183-82551205 GAGGGTGAGCTGAAGCAAAGTGG - Intergenic
1099486331 12:83233109-83233131 GAGGGTGAGCGGAAGCAGGGTGG - Intergenic
1099491947 12:83299592-83299614 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1099522432 12:83681382-83681404 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1099699036 12:86061204-86061226 GAGGGCAAGCTGAAGCAGGGTGG + Intronic
1099745056 12:86690608-86690630 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1099820319 12:87700731-87700753 GAGGGTGAGCCGAAGCAGGGCGG - Intergenic
1099897473 12:88667300-88667322 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1100110967 12:91242411-91242433 GAGGGTATGCCGAAGCAGGGTGG + Intergenic
1100417104 12:94389641-94389663 GAGGGTGAGCTGAAGCAGGGCGG + Intronic
1100739962 12:97581235-97581257 GAGGGTGAGCAAAAGCAGGGTGG + Intergenic
1100768822 12:97898597-97898619 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1100853613 12:98739067-98739089 GTGTGCAAACAGATGCAGAGAGG + Intronic
1101280123 12:103244969-103244991 AAGAGTCAACAGAAGCAAAGGGG + Intronic
1101286883 12:103323280-103323302 GATGGGAAACAGAGGCAGAGAGG - Intronic
1101301754 12:103489922-103489944 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1101540991 12:105665330-105665352 AAGAGAAAACTGAAGCAGAGAGG + Intergenic
1101580552 12:106037908-106037930 GAGGAGAAAGAGAAGGAGAGAGG - Intergenic
1101601335 12:106212697-106212719 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1101690770 12:107078458-107078480 GAGGCGAAAGAGAACCAGAGAGG - Intronic
1102003824 12:109575903-109575925 GAGAGCAAACATAAGCACAGAGG - Intronic
1102119529 12:110429564-110429586 GAGGGAACAGTGAAGCAGAGAGG + Intergenic
1102345658 12:112159484-112159506 GAGGGTGATCTGAAGCAGGGTGG - Intergenic
1103166664 12:118775748-118775770 GTGTGCAGACAGAAGCAGAGAGG - Intergenic
1103169238 12:118799447-118799469 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1103255736 12:119539978-119540000 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
1103324665 12:120112373-120112395 GAGGTTGAACTGAAGCAGAGAGG - Intronic
1104165943 12:126229956-126229978 CAGAGTAAACAGAAGTACAGGGG + Intergenic
1104423201 12:128653925-128653947 GAGGGGAAACTGAGGCACAGAGG - Intronic
1105201328 13:18182309-18182331 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1105645865 13:22316743-22316765 GAGAGCAAACTGAAGCAGGGTGG - Intergenic
1105914965 13:24905850-24905872 GAGGGGCATCAGCAGCAGAGAGG - Exonic
1106025724 13:25953698-25953720 GAGGGCAAGCCGAAGCAGGGTGG + Intronic
1106042063 13:26103094-26103116 GAGGGCAAGCAGAAGCAGGATGG + Intergenic
1106128987 13:26923885-26923907 GAAGTTAAACAGATGCAGAAAGG - Intergenic
1106153103 13:27125627-27125649 GAGGGTGAGCGGAAGCAGGGTGG + Intronic
1106336112 13:28784476-28784498 GAGGGCAAGCCGAAGCAGGGTGG - Intergenic
1106336667 13:28789462-28789484 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1106378893 13:29216655-29216677 CAGGGTGAGCAGAAGCAGGGTGG - Intronic
1106429339 13:29665429-29665451 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1106874309 13:34055080-34055102 GAGGGTGAGCAGAAGCAGAATGG - Intergenic
1107289913 13:38840250-38840272 GAGAGCAAGCAGAAGCAGGGTGG - Intronic
1107380742 13:39854241-39854263 GAGTGTGAGCCGAAGCAGAGCGG - Intergenic
1107473538 13:40713148-40713170 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1107516008 13:41130651-41130673 AAGGATAAACACGAGCAGAGAGG + Exonic
1107570787 13:41656096-41656118 GAGAGTAACCCGAAGCAGACTGG + Intronic
1107650727 13:42542063-42542085 GAAGATAAAGAGAAGGAGAGAGG - Intergenic
1107671390 13:42749941-42749963 GATGGTAAACAGCAGCAGGATGG - Intergenic
1107674356 13:42779170-42779192 GGGGATAAACAGCAGTAGAGTGG + Intergenic
1108217645 13:48200901-48200923 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1108262879 13:48675943-48675965 GGGGGTGAGCAGAAGCAGAGTGG - Intronic
1108471792 13:50774239-50774261 GAGGGTGAGACGAAGCAGAGTGG - Intronic
1108566099 13:51699420-51699442 GAGGGTAAAGCAAAGCAAAGCGG - Intronic
1108940488 13:55947500-55947522 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1109195846 13:59376967-59376989 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1109207135 13:59495144-59495166 GAGGGCAGAAAGAAACAGAGTGG + Intergenic
1109293661 13:60504784-60504806 GAGGGCGAGCAGAAGCAGAGTGG + Intronic
1109366523 13:61364060-61364082 GAAGGCAAGCAGAAGCAGGGTGG + Intergenic
1109457570 13:62612017-62612039 GAGGGTGAGCAGAAGCAGGGAGG - Intergenic
1109661682 13:65467716-65467738 GAGGGCGAGCAGAAGCAGAGCGG - Intergenic
1109669383 13:65585316-65585338 GAGGGCAAGCTGAAGCAGGGCGG + Intergenic
1109731468 13:66419500-66419522 GAGGGCAAGCAGAAGCAGAGTGG + Intronic
1109806598 13:67452421-67452443 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1110071511 13:71184434-71184456 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1110332455 13:74288401-74288423 GGGGTAAAACAGCAGCAGAGTGG + Intergenic
1110389631 13:74959287-74959309 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
1110824598 13:79957955-79957977 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1110968689 13:81733369-81733391 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1110996892 13:82121622-82121644 AAGGGTAGACAGAATCACAGAGG + Intergenic
1111634994 13:90892541-90892563 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1112165766 13:96918541-96918563 GAGGGTGAGCAGAAGCAGAGTGG + Intergenic
1112363086 13:98734452-98734474 GAGGGCAAGCTGAAGCAGAGTGG + Intronic
1112620232 13:101047220-101047242 GAGGGGGAACAGAAGCAGGGTGG - Intergenic
1112879841 13:104093467-104093489 GAAGGAAATTAGAAGCAGAGTGG + Intergenic
1113300974 13:109018792-109018814 GAGGGTGAGCTGAAGCAGAGCGG - Intronic
1113885234 13:113655323-113655345 GAAGGGAAACTGAGGCAGAGAGG + Intronic
1114133643 14:19821224-19821246 GAGGGTAAGCCAAAGCAGGGTGG - Intronic
1114335943 14:21690109-21690131 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1114370415 14:22081118-22081140 GAAGGTAAAAAGAATGAGAGGGG - Intergenic
1114433705 14:22685868-22685890 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1114550240 14:23528587-23528609 GATGGTTCACAGAGGCAGAGTGG - Intronic
1114695561 14:24624010-24624032 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1114744901 14:25136567-25136589 AAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1114817578 14:25978996-25979018 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1114844817 14:26308758-26308780 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1115124106 14:29972178-29972200 GAGGGCAAACAGAAGCAAAGTGG + Intronic
1115135820 14:30107103-30107125 GAGCGTGAACTGAAGCAGGGTGG + Intronic
1115281588 14:31668835-31668857 GAGGGTAGGCAGAAGCAGCGTGG - Intronic
1115320640 14:32076743-32076765 GAGGGGAGGGAGAAGCAGAGGGG + Intronic
1115339001 14:32272570-32272592 GAGGGCACACAGAAACAGGGTGG + Intergenic
1115357083 14:32460429-32460451 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1115867315 14:37761293-37761315 GAAGGCAAGCAGAAGCAGGGTGG - Intronic
1115912249 14:38269255-38269277 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
1116164883 14:41322818-41322840 GAGGACAAACAGTAGCTGAGAGG + Intergenic
1116272848 14:42794770-42794792 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1116401813 14:44516134-44516156 GAGGGTCAGCTGAAGCAGGGCGG - Intergenic
1116565323 14:46438329-46438351 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117005724 14:51419151-51419173 GAGGGTGATCTGAAGCAGGGCGG - Intergenic
1117104184 14:52381982-52382004 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1117120976 14:52568149-52568171 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1117169996 14:53084796-53084818 GAGGGCAAGCCGAAGCAGGGTGG + Intronic
1117185015 14:53231391-53231413 GAGGGCAAGTAGAAGCAGGGAGG + Intergenic
1117237893 14:53798052-53798074 GAAGGTGAACTGAAGCAGGGTGG + Intergenic
1117402488 14:55370942-55370964 GAGGGGAAAAAGAAGCAGAAAGG - Intronic
1117621577 14:57592749-57592771 AAGGGTAAACAGAGGAAGAGAGG - Intronic
1117624134 14:57618382-57618404 GAGGGTAAGCAGAAGCAGGGTGG + Intronic
1117710620 14:58525405-58525427 GAGAGCAAGCAGAAGCAGGGTGG + Intronic
1117750956 14:58923725-58923747 GAGAGCAAACAAAAGCAGGGTGG + Intergenic
1117850145 14:59958904-59958926 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1117887608 14:60381772-60381794 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1118333290 14:64831047-64831069 GAGGGGGAAAAGAAGCAGTGGGG - Intronic
1118450015 14:65892217-65892239 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1118516178 14:66530754-66530776 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1118830002 14:69421977-69421999 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1119018564 14:71085138-71085160 GAGGGCAAGCCGAAGCAGGGTGG - Intronic
1119198540 14:72735493-72735515 GAGGGAAAACAGAACCAAATGGG + Intronic
1120044564 14:79791259-79791281 GAGAGCAACCACAAGCAGAGAGG - Intronic
1120065720 14:80038947-80038969 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
1120201229 14:81540362-81540384 GAGGGTAAGCCAAAGCAGACTGG + Intergenic
1120271863 14:82322389-82322411 GTGGGCAAGCAGAAGCAGGGTGG - Intergenic
1120554198 14:85908266-85908288 GAAGGCAAACCAAAGCAGAGTGG - Intergenic
1120624964 14:86813768-86813790 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1121071755 14:91029601-91029623 GAGGGTACAGAGAGGCACAGAGG - Intronic
1121409344 14:93738410-93738432 GAGGGAAAAGAGAAACAAAGAGG + Intronic
1121449600 14:93998841-93998863 GAGGGCCCAGAGAAGCAGAGGGG + Intergenic
1121572258 14:94955430-94955452 GACTGAAAACAGAAGCAGACAGG - Intergenic
1122409105 14:101517039-101517061 AAGGGGAAACAGAAGAAGGGAGG + Intergenic
1123116630 14:105897775-105897797 CAGGGTAAACAGAAAATGAGAGG - Intergenic
1124165709 15:27323959-27323981 GAAGTGAAACACAAGCAGAGTGG - Intronic
1124474759 15:30023180-30023202 GAGGGTGAGCAGAATCAGGGTGG - Intergenic
1125135880 15:36342088-36342110 GAGTGTCAACAGATGCTGAGGGG + Intergenic
1125219478 15:37317223-37317245 AAGGGTGAACTGAAGCAGGGTGG + Intergenic
1126087092 15:45021058-45021080 GAGGGTGAGCCGAAGCAGGGAGG - Intergenic
1126742030 15:51786998-51787020 GAGGGTGAGCTGAAGCAGGGCGG + Intronic
1127029938 15:54850878-54850900 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
1127179395 15:56399130-56399152 GAGGGTGAACTGAAGCAGAGTGG + Intronic
1127431171 15:58910200-58910222 GAAAGTAAACAGAGGCATAGGGG + Intronic
1128240758 15:66099596-66099618 AAGGGGAAACAGGACCAGAGAGG - Intronic
1128339884 15:66813971-66813993 GAGGGCAAGCTGAAGCAGGGCGG - Intergenic
1128466840 15:67919672-67919694 GAGGGTAAACAACTGCAGAGAGG - Intergenic
1128857595 15:71032273-71032295 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1129495680 15:75977609-75977631 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
1130046514 15:80449972-80449994 CACGGTAAACAGAATCACAGAGG + Intronic
1130252329 15:82307627-82307649 CAGGGTAGAAGGAAGCAGAGGGG + Intergenic
1131590768 15:93746548-93746570 GAGAGCAAACAAAAGCAGGGTGG + Intergenic
1131893414 15:96999549-96999571 GAAGGAAAACAGGAGCAGAGAGG - Intergenic
1132096325 15:98987830-98987852 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1132374381 15:101319110-101319132 GAAGGGAAACAGATGTAGAGGGG - Intronic
1132704439 16:1237059-1237081 GTGGGGAAACTGAGGCAGAGAGG - Intergenic
1132707077 16:1249366-1249388 GTGGGGAAACTGAGGCAGAGAGG + Intergenic
1133555745 16:6904937-6904959 CTGGGTAAACAAAAGCAGTGGGG + Intronic
1133887418 16:9843648-9843670 CTGGGTTGACAGAAGCAGAGTGG - Intronic
1134049773 16:11129425-11129447 GACAGAAAACAGAAGCAAAGAGG - Intronic
1134312942 16:13092793-13092815 GAGGGCAAGCTGAAGCAGGGCGG - Intronic
1134396907 16:13873608-13873630 AAGGGATTACAGAAGCAGAGAGG - Intergenic
1135512026 16:23094017-23094039 GAGGGTGAGCTGAAGCAGAGTGG + Intronic
1135544395 16:23356032-23356054 GAGCATAAACTGAACCAGAGTGG + Intronic
1135864978 16:26092761-26092783 GAGGGTGAGCTGAAGCAGGGCGG + Intronic
1135897295 16:26419385-26419407 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1136096665 16:27961985-27962007 GAGGGGAAACTGAGGCAGAAGGG - Intronic
1137046098 16:35663892-35663914 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1137325020 16:47425417-47425439 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
1137552177 16:49445266-49445288 GAGGGAAAAAAGAGGGAGAGAGG - Intergenic
1137977289 16:53042406-53042428 GAGGGGAAACAGAGGAAGAGAGG - Intergenic
1138151468 16:54661507-54661529 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1138277436 16:55746035-55746057 GAGGGCAGGCAGAAGGAGAGAGG + Intergenic
1138578426 16:57923536-57923558 GAGGGAAAACGGCAGAAGAGAGG + Intronic
1138757484 16:59505967-59505989 GAGAGTAGAGAGAAGTAGAGGGG + Intergenic
1138799673 16:60012812-60012834 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
1138886830 16:61090613-61090635 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1139268695 16:65662688-65662710 GTGGGGAAACTGAGGCAGAGGGG - Intergenic
1140022225 16:71249325-71249347 AAGGGAAAACAGATGCAGAGAGG - Intergenic
1140483731 16:75277659-75277681 GAGGGTTCACATAAGCAGAGAGG + Intergenic
1140903571 16:79392109-79392131 GAGAGGAAAGAGAAGAAGAGAGG + Intergenic
1141106939 16:81241674-81241696 GATGGGAAACTGAGGCAGAGGGG + Intronic
1141222173 16:82081302-82081324 GAGTGACAACAGAAGGAGAGAGG - Intronic
1141446226 16:84060408-84060430 GACGGTAAACACACTCAGAGTGG + Intronic
1142220389 16:88851530-88851552 GAGGGTGAGCCGAAGCAGGGTGG + Intronic
1202994886 16_KI270728v1_random:99497-99519 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1203021573 16_KI270728v1_random:411839-411861 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1143135923 17:4712149-4712171 GAGGAAAACCAGAAGCAAAGGGG + Intronic
1143427225 17:6849497-6849519 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1143738197 17:8929442-8929464 GAGAATTACCAGAAGCAGAGAGG + Intronic
1143810766 17:9469810-9469832 GAGTGAATCCAGAAGCAGAGAGG + Intronic
1144293984 17:13855635-13855657 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1144371699 17:14597627-14597649 GAGGGTGACCAGAAGTAGAGTGG + Intergenic
1144434202 17:15224397-15224419 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1146053700 17:29570789-29570811 GAGAATAAACAGGAGCAAAGGGG - Intronic
1146746419 17:35334220-35334242 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1146826056 17:36024056-36024078 GAGGGTGAGCAGGAGCAGGGTGG - Intergenic
1146939115 17:36831784-36831806 GAGGGTGCAGAGAAGCAGAGTGG + Intergenic
1147387082 17:40089091-40089113 GAGGGGAGATAGAGGCAGAGAGG - Intronic
1147570266 17:41566192-41566214 GACTGTAAGCAGGAGCAGAGAGG + Intronic
1148466342 17:47867292-47867314 GAGGGTGAAGAGAAGCAATGAGG + Intergenic
1148980960 17:51574551-51574573 GAGGGCCAGCAGAAGCAGAGTGG + Intergenic
1149093914 17:52817520-52817542 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1149168238 17:53779838-53779860 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1149281358 17:55108703-55108725 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1149365373 17:55938837-55938859 GAGGGTGAGCAGAAGCAGGTTGG + Intergenic
1149639679 17:58194730-58194752 GGTGGTAAAGAGAAGGAGAGGGG - Intronic
1150247157 17:63685143-63685165 GAGTGTAAACAGAAGCATTAAGG + Intronic
1150563213 17:66313070-66313092 CAGAGGAAACAGAAGTAGAGAGG - Intronic
1150884543 17:69070438-69070460 GAGGGGGAGCAGAAGCAGGGTGG + Intergenic
1151064277 17:71132289-71132311 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1151234167 17:72706640-72706662 GAAGAAAAACAGAAGCAGGGTGG - Intronic
1151362952 17:73599573-73599595 GAGGGAAAAGAGGAGGAGAGAGG + Intronic
1152065308 17:78109284-78109306 GAGGGAAAACAGAGACAGTGGGG + Intergenic
1152110605 17:78355731-78355753 GAGTGTATAGAGAGGCAGAGAGG + Intergenic
1153119114 18:1700113-1700135 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1153702527 18:7711177-7711199 GAGGGCAAGCAGAAACAGGGTGG + Intronic
1153717933 18:7869491-7869513 GAGGGAGAGCAGAAGCAGGGTGG - Intronic
1153752664 18:8249203-8249225 TAGAGAAAAGAGAAGCAGAGGGG - Intronic
1153789000 18:8560820-8560842 GAGGGAAAAGAGAAAGAGAGCGG - Intergenic
1153798378 18:8646574-8646596 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1153941605 18:9983109-9983131 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1154019457 18:10650159-10650181 GAGCATGAACCGAAGCAGAGTGG + Intergenic
1154101629 18:11479728-11479750 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1154288623 18:13084596-13084618 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1154288817 18:13086479-13086501 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
1154490102 18:14915200-14915222 GAGAGCAAACAGCAGCAGACAGG + Intergenic
1155114141 18:22748455-22748477 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
1155857432 18:30850569-30850591 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1155923630 18:31630468-31630490 GAAGATAAACAGCAGAAGAGAGG + Intronic
1156208793 18:34915225-34915247 GAGGTTAAAAATCAGCAGAGGGG - Intergenic
1156582282 18:38392416-38392438 GAGGGTGAGCAGAAGCTGGGTGG + Intergenic
1157067380 18:44367246-44367268 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1157144510 18:45148044-45148066 GAGAGTAAACGGGAGCAGAAGGG - Intergenic
1157850520 18:51044770-51044792 GAGGGTATACAGAAGCTCAAAGG - Intronic
1158399116 18:57104800-57104822 GAGGGCAAGCAAAAGCAGGGTGG - Intergenic
1158661150 18:59388837-59388859 GAGGTTAAACAGAAAGAGTGTGG + Intergenic
1158853288 18:61517432-61517454 GAGGGCAAGCTGAAGCAGGGTGG + Intronic
1159099306 18:63940528-63940550 GAGTGTAAGCTGAAGCAGGGTGG + Intergenic
1159386052 18:67726322-67726344 GAGAGCAAATAGAAGCAGGGTGG - Intergenic
1159570830 18:70110409-70110431 GAGGGCAAGCTGAAGCAGGGTGG + Intronic
1159581237 18:70236565-70236587 GAGGGTGAGCAGAAGCAAGGTGG + Intergenic
1159901685 18:74053098-74053120 GAGGGTGAGCAGAAGCAGCGTGG + Intergenic
1160076324 18:75680907-75680929 AAGGGGAACGAGAAGCAGAGCGG + Intergenic
1160360302 18:78269522-78269544 GTGGCTCAACAGAAGCAGAATGG - Intergenic
1160466736 18:79083704-79083726 GAGGGCAAGCTGAAGCAAAGTGG - Intronic
1161115924 19:2496283-2496305 GAGGGTAAACTGAGGCACAGAGG + Intergenic
1161342673 19:3751614-3751636 GAGGGTAAACTGAGGCCCAGAGG - Intronic
1161458325 19:4381211-4381233 GATGGGAGACAGAGGCAGAGGGG - Intronic
1161645923 19:5453417-5453439 GTGGAAAAACAGAAGCAGAGAGG - Intergenic
1162375051 19:10299926-10299948 GGGGGTAAACTGAAGCACTGTGG - Intergenic
1162581750 19:11535684-11535706 GATGGTAAACTGAGGCACAGAGG + Intergenic
1163093040 19:15034660-15034682 GAGGATATACAGAAAAAGAGGGG - Intergenic
1163676714 19:18659024-18659046 GAGGGTACAGAGACCCAGAGGGG - Intronic
1163715150 19:18868996-18869018 GAGGGTCACCAGCAGCAGCGAGG + Exonic
1163832281 19:19552783-19552805 GTGGGGAAACAGAAGCTCAGGGG + Intergenic
1163989799 19:20988043-20988065 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
1164047622 19:21555931-21555953 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1164580581 19:29432699-29432721 GGTGGGAAACAGAGGCAGAGAGG - Intergenic
1164586534 19:29479406-29479428 GAGGGAACTCAGATGCAGAGAGG + Intergenic
1164645607 19:29856800-29856822 GAGGTTACACAGAGTCAGAGAGG + Intergenic
1164743578 19:30594731-30594753 CAGGGGAAACAGGAGAAGAGTGG - Intronic
1165003800 19:32787909-32787931 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1165254669 19:34568511-34568533 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1165269814 19:34696520-34696542 GAAGGTGAGCAGAAGCAGGGTGG + Intergenic
1165816408 19:38645098-38645120 GAGGGTAGACAGAACCTGGGTGG + Intergenic
1166038109 19:40184166-40184188 CAGGGCAAAAGGAAGCAGAGGGG + Intergenic
1166163725 19:40971440-40971462 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1167269867 19:48500678-48500700 GAGGGGACACAGCAGCAGATGGG + Intronic
1167623490 19:50571335-50571357 GAGGAAGAAGAGAAGCAGAGTGG + Intergenic
1168457607 19:56526211-56526233 GAGGGTGAGCTGAAGCAGGGTGG + Exonic
1168530937 19:57128061-57128083 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
925600060 2:5599107-5599129 GAAGGTTAACAGACTCAGAGAGG - Intergenic
925627946 2:5860864-5860886 GAGGGCAAGCAGGAGCAGGGTGG - Intergenic
926074777 2:9933131-9933153 GAGGGTGAGCCGAAGCAGGGCGG - Intronic
926474254 2:13302789-13302811 TAGGGCATAGAGAAGCAGAGAGG - Intergenic
926593506 2:14764361-14764383 GAGGGTAAACAAAAGTCGAAAGG - Intergenic
926944062 2:18168501-18168523 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
926970680 2:18464164-18464186 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
926975052 2:18506429-18506451 GAGGGAAAAAAGAAAAAGAGGGG - Intergenic
927003157 2:18820774-18820796 GAGGGGATAAAGAAGCAGAAAGG - Intergenic
928070931 2:28215760-28215782 GAGAGCAGAAAGAAGCAGAGGGG - Intronic
928154058 2:28859598-28859620 GAGGGAATAGAGAAGGAGAGGGG - Intronic
928209614 2:29313821-29313843 GAGGAAAAACAAAAGCAGAAGGG - Intronic
928462609 2:31489234-31489256 GAGGGCAAGCTGAAGCAGGGGGG + Intergenic
928488203 2:31754194-31754216 GAGGGTGAGCAGAAACAGGGTGG + Intergenic
928750564 2:34466362-34466384 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
928883558 2:36123306-36123328 GAGAGTGAAGAAAAGCAGAGTGG - Intergenic
929025782 2:37600164-37600186 GAGGGTGAGCTGAAGCAGAGTGG - Intergenic
929256220 2:39813973-39813995 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
929257833 2:39831267-39831289 GAGGGCAAGCAGAGGCTGAGTGG - Intergenic
929333625 2:40713249-40713271 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
929837934 2:45425661-45425683 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
930223386 2:48767867-48767889 GAGGGCAGGCAGAAGCAGGGTGG - Intronic
930247353 2:48998004-48998026 GAGGCTAAACAGAGTCAGACAGG - Intronic
930274778 2:49298614-49298636 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
930323253 2:49882036-49882058 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
930860422 2:56065844-56065866 GAGGGAAAACAGAAGCAGAGTGG - Intergenic
930951248 2:57146391-57146413 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
931021298 2:58047243-58047265 GAAGGTAACGAGAAGCAGCGCGG - Intronic
931212171 2:60207609-60207631 GAGGGAGAGCAGAAGCAGGGTGG - Intergenic
932168282 2:69528650-69528672 GAGGGTAAAAAGAAGGAAGGAGG + Intronic
932469605 2:71945244-71945266 GAGGGGAAATGGAGGCAGAGTGG - Intergenic
932511894 2:72300824-72300846 GAGGGTAATTTGAAGCAGGGTGG - Intronic
932646868 2:73511463-73511485 GAGGGTGAGCAGCAGCAGGGTGG - Intronic
933042660 2:77488088-77488110 GAGGGAAGAGAGAAGGAGAGAGG + Intronic
933413290 2:81951500-81951522 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
933488368 2:82950819-82950841 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
934314210 2:91901501-91901523 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
934617034 2:95778617-95778639 GAGGGTGAGCCGAAGCAGGGCGG + Intergenic
934643859 2:96045942-96045964 GAGGGTGAGCCGAAGCAGGGCGG - Intergenic
934702656 2:96454572-96454594 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
934837276 2:97602036-97602058 GAGGGTGAGCCGAAGCAGGGCGG - Intergenic
935123560 2:100202624-100202646 GAGGGGAAACTGAGGCAGAAAGG + Intergenic
935273976 2:101460215-101460237 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
936156704 2:110051633-110051655 GTGGATAAATAGAGGCAGAGAGG + Intergenic
936181897 2:110274356-110274378 GAGGGTGATTAGAAGCAGGGTGG - Intergenic
936187988 2:110319811-110319833 GTGGATAAATAGAGGCAGAGAGG - Intergenic
936230671 2:110697323-110697345 GAGGGTGATTAGAAGCAGGGTGG + Intergenic
936469064 2:112781834-112781856 GAAGGAAAACAGAAGCTGAGAGG + Intronic
936649910 2:114413974-114413996 GAGGGTAAGCCAAAGCAGGGAGG - Intergenic
936750516 2:115635482-115635504 GAGAGTAAGGAAAAGCAGAGTGG - Intronic
936900037 2:117472340-117472362 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
936909842 2:117579381-117579403 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
937000054 2:118457577-118457599 GAGGGCAAGCTGAAGCAGGGGGG - Intergenic
937035040 2:118774014-118774036 AAGGGAAAACAGAAGCGGTGAGG + Intergenic
937143047 2:119618432-119618454 GAGGGTGAGCCGAAGCAGGGTGG + Intronic
937259472 2:120576392-120576414 AAGAAGAAACAGAAGCAGAGCGG + Intergenic
937526055 2:122771923-122771945 GAAGGCAAGCAGAAGCAGGGTGG + Intergenic
937562644 2:123244619-123244641 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
937606225 2:123804544-123804566 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
938144658 2:128823534-128823556 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
938224357 2:129602877-129602899 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
938263820 2:129912505-129912527 GAAGTTAAACTGAAGCAGAGTGG + Intergenic
938552307 2:132393555-132393577 GAAGGTGATCAGGAGCAGAGGGG - Intergenic
938952399 2:136267035-136267057 GAGGGTGAGCAGGAGCAGGGTGG - Intergenic
939055510 2:137360385-137360407 GAGGGTGAGCTGAAGCAGAGTGG + Intronic
939180306 2:138795794-138795816 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
939413857 2:141866817-141866839 GAGAGAAAATAGAAGGAGAGAGG + Intronic
939628054 2:144502624-144502646 GAGTGGAAAGAGAGGCAGAGGGG + Intronic
939640930 2:144638977-144638999 TAGGGCAAGCAGAAGCAGGGTGG - Intergenic
939937848 2:148313935-148313957 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
940030639 2:149257941-149257963 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
940054624 2:149500507-149500529 GAGGGAGAGCAGAAGCAGGGTGG - Intergenic
940396920 2:153200180-153200202 GAGGATAAACTGAAGCAGGAAGG + Intergenic
940400633 2:153244499-153244521 GAGTGTGAGCAGAAGCAGGGTGG + Intergenic
940417899 2:153443343-153443365 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
940565240 2:155351827-155351849 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
940995800 2:160148620-160148642 GAGGGTGAGCAGAAGCAGGGCGG + Intronic
941239471 2:163017909-163017931 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
941477963 2:165971643-165971665 GAGGGAGAGCAGAAGCAGGGTGG + Intergenic
941518799 2:166511843-166511865 GAGGGCGAACAGAAGCAGGGTGG - Intergenic
941682420 2:168413339-168413361 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
942065846 2:172270703-172270725 GAGGGCAAGCAGAAGCAGTGTGG - Intergenic
942199821 2:173559758-173559780 GAGGGCAAGCAGAAGCAGAGTGG + Intergenic
942410952 2:175708960-175708982 GAGGGTGAACTGAAGCCGGGTGG + Intergenic
942431380 2:175914596-175914618 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
942602812 2:177658488-177658510 GAGGGAAAAAAGAAGAGGAGAGG - Intronic
942744071 2:179212168-179212190 GAGGGCAAGCCGAAGCAGGGCGG + Intronic
942758067 2:179365154-179365176 TAGGATAAACACAGGCAGAGAGG + Intergenic
942854831 2:180532560-180532582 GAGTGTAAGCTGAAGCAGGGCGG - Intergenic
942873540 2:180765246-180765268 GAGGGCAAGCTGAAGTAGAGCGG + Intergenic
942898673 2:181089066-181089088 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
943074725 2:183179821-183179843 GAGGGCAAGCAGAAACAGGGTGG - Intergenic
943094803 2:183416464-183416486 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
943147767 2:184066433-184066455 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
943240465 2:185377314-185377336 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
943337626 2:186637666-186637688 GGGGCTAAAAAGAAGCAGAAAGG - Intronic
943352438 2:186811911-186811933 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
943552576 2:189358020-189358042 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
943836729 2:192524316-192524338 GAGGGTGAGCCGAAGCAGAGTGG + Intergenic
944267820 2:197748093-197748115 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
944291952 2:198018077-198018099 GAGGGCGAGCAGAAGCAGGGTGG + Intronic
944374729 2:199028621-199028643 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
944483639 2:200181344-200181366 GAGGGAAAATAGAAGCAGGCAGG - Intergenic
944635321 2:201670904-201670926 AAGGGTAAACCAAAGCAGGGTGG + Intronic
944650903 2:201829330-201829352 GAGGCTAATCAGAACCACAGTGG + Intronic
944763710 2:202842751-202842773 GAGTTTAAGCAGAAGAAGAGAGG - Intronic
944764265 2:202848983-202849005 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
945116800 2:206416045-206416067 GAGGGCAAGCCGAAGCAGGGCGG - Intergenic
945210968 2:207381467-207381489 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
945359373 2:208878772-208878794 GGGGGTCAACAGAAGCTGAGTGG - Intergenic
945482287 2:210357986-210358008 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
945945125 2:215988240-215988262 GAGGGCAAGCTGAAGCAGGGTGG + Intronic
946506783 2:220309776-220309798 GAGGGGAAAGTGAAGAAGAGAGG + Intergenic
946649099 2:221871894-221871916 GAGGGTGTGCAGAAGCAGAGTGG + Intergenic
946661985 2:222010983-222011005 GAGAGAGAACAGAAGCTGAGAGG + Intergenic
946692683 2:222320546-222320568 GAGGATAAACAGAAACACACTGG - Intergenic
946912904 2:224484978-224485000 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
947033424 2:225824398-225824420 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
947098433 2:226592486-226592508 GAGGGTGAAGAGAAGCAGGGTGG - Intergenic
947164448 2:227247464-227247486 GAGGATACACAATAGCAGAGAGG + Intronic
947275876 2:228391217-228391239 GAGGGCAAGCTGAAGCAGGGGGG - Intergenic
948042532 2:234914636-234914658 GAGGGGTAACAGAGTCAGAGAGG - Intergenic
948541510 2:238694267-238694289 GAGGGAAAAGAGAAACAGAAGGG + Intergenic
948748194 2:240110734-240110756 GAGGGGAAGGAGAAGGAGAGTGG - Intergenic
1168938711 20:1690759-1690781 GAGGGTAAGCAGAAGCAGGGTGG + Intergenic
1169253844 20:4082830-4082852 GACTGTCAACAGAGGCAGAGTGG - Intergenic
1169984189 20:11423418-11423440 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1170229480 20:14028717-14028739 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1170294155 20:14806299-14806321 GAGGGCGACCAGAAGCAGGGTGG + Intronic
1170727425 20:18942151-18942173 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
1170926161 20:20726280-20726302 GAGGCTCACCAGAAGCAGATTGG + Intergenic
1171081795 20:22194276-22194298 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
1171086868 20:22245627-22245649 GAGGTAAAACAGACTCAGAGAGG + Intergenic
1172466688 20:35160788-35160810 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
1172909777 20:38399389-38399411 GAGGGCAAACAGGAGAAAAGGGG + Intergenic
1172949789 20:38715569-38715591 ATGAGTAAACTGAAGCAGAGAGG + Intergenic
1173356182 20:42292887-42292909 AAGGGGTAACAGAAGCAGTGGGG + Intronic
1173434169 20:43017502-43017524 GGGGACAAACAGATGCAGAGGGG - Intronic
1173771843 20:45666395-45666417 GAGGGTGAGCGGAAGCAGGGTGG - Intronic
1174657167 20:52181243-52181265 GAGGATAAAAATAAACAGAGAGG - Intronic
1175218842 20:57405553-57405575 GAAGGTAAACAGTAGTAGAGAGG + Intronic
1175564863 20:59965591-59965613 GACTGAATACAGAAGCAGAGAGG - Intronic
1175614998 20:60390472-60390494 GAGGGGAAAGGGAAGCAGAAGGG - Intergenic
1175805393 20:61825606-61825628 GAGGGGAAACTGAGGCAAAGAGG + Intronic
1176116530 20:63434062-63434084 GAGGGTAAACTGAGGCTGTGGGG - Intronic
1176546507 21:8204503-8204525 GAAGGGAAAAAGAAACAGAGAGG - Intergenic
1176554401 21:8248694-8248716 GAAGGGAAAAAGAAACAGAGAGG - Intergenic
1176565458 21:8387550-8387572 GAAGGGAAAAAGAAACAGAGAGG - Intergenic
1176573323 21:8431718-8431740 GAAGGGAAAAAGAAACAGAGAGG - Intergenic
1176716617 21:10355679-10355701 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1176891697 21:14327002-14327024 GAGGGCACGCAGAAGCAGGGTGG + Intergenic
1177040110 21:16097707-16097729 GAGAGAAAACAGAGGCAGAGAGG - Intergenic
1177042787 21:16133485-16133507 GTGGGTGAGCAGAAGCAGGGTGG - Intergenic
1177111463 21:17034280-17034302 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1177313154 21:19423999-19424021 GAAGGCAAGCAGAAGCAGGGTGG + Intergenic
1177540911 21:22493315-22493337 GCGGGCAAGCAGAAGCAGGGTGG + Intergenic
1177543947 21:22532711-22532733 GAGGTTATACAGAAGTAGTGTGG + Intergenic
1178393482 21:32219322-32219344 GAGGGTGAGCAAAAGCAGGGTGG + Intergenic
1178864534 21:36316971-36316993 GAGGGTGAACAGAAGCAGGGTGG - Intergenic
1180596152 22:16974857-16974879 GAGGGTGAGCCGAAGCAGGGTGG + Intronic
1180601719 22:17024257-17024279 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1181460484 22:23083257-23083279 GAGGGTAGACCCAGGCAGAGGGG + Intronic
1181825067 22:25508344-25508366 AAGAGAAAACTGAAGCAGAGAGG + Intergenic
1182057727 22:27373196-27373218 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1182204262 22:28607881-28607903 GAGTGAAAGCAGAAGCAGGGAGG - Intronic
1182547865 22:31085999-31086021 GAGGGTAAAGAGGCCCAGAGGGG - Intronic
1183021574 22:35031241-35031263 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1183313636 22:37125151-37125173 CAGGGAAAACTGAAGCTGAGAGG - Intergenic
1183422358 22:37719258-37719280 GAGGGGACAGAGAAGGAGAGAGG + Intronic
1184178950 22:42806330-42806352 GAGGGGAAGTCGAAGCAGAGGGG + Intronic
1184290953 22:43498008-43498030 GCAGGTAAGCAGAAGGAGAGAGG + Intronic
1184301748 22:43564970-43564992 CAGGGTGAACAGAAGCAGGGGGG - Intronic
1184719151 22:46299439-46299461 CAGGGTATGCAGATGCAGAGGGG - Intronic
1185006820 22:48282870-48282892 GAGGGAAAAAAGAAGGAGGGAGG + Intergenic
1185153701 22:49180605-49180627 GTGGGGAAACAGGAGCAGGGAGG - Intergenic
1185198447 22:49487504-49487526 GAACAAAAACAGAAGCAGAGTGG - Intronic
1203251370 22_KI270733v1_random:120765-120787 GAAGGGAAAAAGAAACAGAGAGG - Intergenic
1203259416 22_KI270733v1_random:165839-165861 GAAGGGAAAAAGAAACAGAGAGG - Intergenic
949093682 3:60629-60651 GAAGATAGACAGAAGAAGAGTGG + Intergenic
949226886 3:1705531-1705553 GAGGGTGAACTGAAGCAGGGTGG + Intergenic
949346857 3:3084782-3084804 GTGAGAAAACAGATGCAGAGAGG - Intronic
949428176 3:3941855-3941877 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
949456671 3:4246232-4246254 GAGGGTGAGCAGAAGCAGGGCGG - Intronic
949525574 3:4900172-4900194 GAGTGTATACAGAGGGAGAGAGG - Intergenic
949580682 3:5384534-5384556 GAGGGCAAGCCGAAGCAGGGTGG - Intergenic
949594668 3:5531270-5531292 GAGGGTGAGCAGAAGCAGAGTGG - Intergenic
949632613 3:5944545-5944567 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
949801281 3:7906631-7906653 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
949954967 3:9259995-9260017 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
950611072 3:14126925-14126947 GTGAGTAAACAGAATCAGAGAGG + Intronic
950908512 3:16562186-16562208 GAGGGTACACAGAGACAGACAGG + Intergenic
950953287 3:17023989-17024011 GAGGATGAACTGCAGCAGAGAGG - Intronic
950991945 3:17449082-17449104 GAGGGTGAGCAGAAGCAGCATGG + Intronic
951310820 3:21124694-21124716 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
951347322 3:21561441-21561463 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
951617705 3:24566884-24566906 GAGGGTGAACTGAAGCAGGCGGG + Intergenic
951629196 3:24699764-24699786 GAGGGAGAGCAGAAGCAGGGTGG - Intergenic
951676521 3:25247616-25247638 GAGGATGAGCAGAAGCAGGGTGG - Intronic
951741600 3:25931326-25931348 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
951759583 3:26130451-26130473 GAGGGTGAGACGAAGCAGAGCGG - Intergenic
951826584 3:26875657-26875679 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
951832085 3:26942470-26942492 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
951840413 3:27027804-27027826 GAAGGCAAACAGATGCAGGGTGG + Intergenic
952150631 3:30586249-30586271 GTGGGTAAATAGGAGAAGAGTGG - Intergenic
952517730 3:34122560-34122582 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
953047153 3:39304373-39304395 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
953102438 3:39842755-39842777 GAGGGCAGACAGAAGCAGGGGGG - Intronic
953117349 3:40006260-40006282 GAAGGAAAATAGAAGGAGAGAGG + Intronic
953219097 3:40951243-40951265 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
953233019 3:41081251-41081273 GAGGGTAAACAAAGCTAGAGGGG - Intergenic
953262805 3:41356734-41356756 CAGGGAAGACAGAATCAGAGTGG + Intronic
953286561 3:41616488-41616510 GAGGGATAGCAGAAGCAGGGTGG + Intronic
953384667 3:42499761-42499783 GAGGGATGTCAGAAGCAGAGGGG - Intronic
953555867 3:43946353-43946375 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
953653157 3:44823984-44824006 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
954436723 3:50500238-50500260 GAGGGTGGGCAGAAGCAGTGAGG - Intronic
954507566 3:51091852-51091874 GAGGGCAAGCCGAAGCAGGGTGG + Intronic
954510577 3:51121287-51121309 GAGGGCGAGCAGAAGCAGAGTGG - Intronic
954513900 3:51153478-51153500 GAGGGCAAGCCGAAGCAGTGTGG - Intronic
954524862 3:51261260-51261282 GAGGGCAAGCAGAAGGAGGGTGG + Intronic
954978770 3:54723679-54723701 GAGGGTGAGCCGAAGCAGAGTGG - Intronic
955454051 3:59100804-59100826 GAGAGCAATCAGAAGCAGGGTGG - Intergenic
955595446 3:60585173-60585195 GAGAGTAAGCTGAAGCTGAGTGG + Intronic
955920026 3:63945948-63945970 CAGAGTAACCAGATGCAGAGAGG + Intronic
956301989 3:67781911-67781933 GAGGGTGAACTGAAGCAGGGTGG - Intergenic
956316873 3:67947957-67947979 GAGGGTGAGCTGAAGGAGAGCGG + Intergenic
956355635 3:68389707-68389729 GAGGGTGAGCAGAAGCTGGGTGG + Intronic
956403845 3:68907569-68907591 GAGGGAACACAGATGCAGACTGG - Intronic
957011353 3:75009190-75009212 GAGGGCCAGCAGAAGCAGGGTGG - Intergenic
957249578 3:77756590-77756612 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
957411954 3:79852734-79852756 GATGGTAAAGAGAGTCAGAGGGG + Intergenic
957579318 3:82050374-82050396 GAGAATAATTAGAAGCAGAGGGG + Intergenic
957695650 3:83635644-83635666 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
957747757 3:84366595-84366617 GAGGGCCAGCAGAAGCAGGGTGG - Intergenic
957776415 3:84760854-84760876 CAGGGCAAGCAGAAGCAGGGTGG + Intergenic
957993338 3:87654169-87654191 GAGGGCAAGCAGAAGCATGGTGG - Intergenic
958000102 3:87739723-87739745 GAAGGTAGAGAGAGGCAGAGGGG - Intergenic
958000113 3:87739811-87739833 GAGGGTAGAGAGAGGCAGAGGGG - Intergenic
958036949 3:88182093-88182115 GAAGGTGAGCCGAAGCAGAGCGG + Intergenic
958257512 3:91341516-91341538 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
958414005 3:93852732-93852754 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
958521000 3:95185029-95185051 GAGGGTGATCCGAAGCAGAGTGG - Intergenic
958618442 3:96526811-96526833 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
958694643 3:97511476-97511498 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
959045254 3:101466855-101466877 GAGGGCAAGCTGAAGCAGGGCGG + Intronic
959059814 3:101605780-101605802 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
959278136 3:104304157-104304179 GAGGGTGAGCAGAAGCAGAGTGG + Intergenic
959345664 3:105191471-105191493 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
959453689 3:106533909-106533931 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
959494869 3:107038496-107038518 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
959534526 3:107470203-107470225 GAGGGTGAGCAGAAGAAGGGTGG + Intergenic
959813685 3:110650364-110650386 GATGGGAAGCAAAAGCAGAGCGG + Intergenic
959815753 3:110671581-110671603 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
959847993 3:111056503-111056525 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
960226988 3:115179908-115179930 GAGGGTAAGCCAAAGCAGGGTGG - Intergenic
960311834 3:116126302-116126324 GAGAGTATATAGAAGCAGATAGG + Intronic
960478762 3:118162747-118162769 GAGGGCAAGCCAAAGCAGAGGGG + Intergenic
960623720 3:119660399-119660421 GAGCGCCAACAGCAGCAGAGTGG - Exonic
960653888 3:119981368-119981390 GAGGGCAAGCTGAAGCAGGGTGG + Intronic
960763401 3:121097609-121097631 GAGGGTGATCTGAAGCAGGGTGG - Intronic
960773236 3:121217477-121217499 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
960827803 3:121811131-121811153 GATGGCAAGCAGAAGCAGAGTGG + Intronic
960883236 3:122367157-122367179 GAGGGTGAAGAGAAGGAGAGAGG + Intronic
961086980 3:124076576-124076598 GACATTAAACAGAAGCACAGAGG - Intergenic
961541216 3:127600730-127600752 GAGGGGAAACAGCAGAGGAGGGG - Intronic
961998324 3:131269524-131269546 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
962007012 3:131359874-131359896 GAGGTGAGGCAGAAGCAGAGAGG + Intergenic
962156763 3:132956549-132956571 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
962181131 3:133207278-133207300 GAAGGCAAGCAGAAGCAGGGTGG - Intronic
962512258 3:136114111-136114133 GAGGGTGACCCGAAGCAGGGTGG + Intronic
962634856 3:137319879-137319901 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
962642438 3:137401115-137401137 GAGGGTGAGCAGAAGCAAGGTGG - Intergenic
962765633 3:138560207-138560229 GAGGGCAAACCGAAGGAGGGTGG + Intronic
963083343 3:141414867-141414889 AAGTGTCAACAGAGGCAGAGAGG - Intronic
963401818 3:144807281-144807303 GAGAGCGAACAGAAGCAGGGTGG - Intergenic
963410933 3:144926793-144926815 GAGGGCGAACAGAAGCAGGGTGG - Intergenic
963481515 3:145879976-145879998 GAGGGCAAGCAGAAGCAGAGTGG - Intergenic
963629376 3:147713457-147713479 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
963898584 3:150711981-150712003 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
963980150 3:151528549-151528571 GAGGGCAAACCAAAGCAGGGTGG + Intergenic
963998639 3:151740288-151740310 GAGGGCGAACAGAAGCAGGGTGG - Intronic
964371447 3:156004381-156004403 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
964391325 3:156201110-156201132 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
964472715 3:157071427-157071449 GAGGGTAAAACAAAGCTGAGGGG + Intergenic
964649188 3:158991866-158991888 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
964904752 3:161706934-161706956 GAGGGTGGACAGAAGCAGGGTGG + Intergenic
965091161 3:164163727-164163749 GAGGGCTAGCAGAAGCAGGGTGG - Intergenic
965120681 3:164551481-164551503 GGGGTTAAACAGATGAAGAGTGG + Intergenic
965511024 3:169568065-169568087 GAGGGTGAGCAGAAGCAGGATGG + Intronic
965622031 3:170651444-170651466 GAGAGCAAGCAGAAGCAGGGCGG - Intronic
966250997 3:177865570-177865592 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
966255005 3:177907976-177907998 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
966291108 3:178360956-178360978 GAGGGCAAGCAGAAGCATGGTGG + Intergenic
966309322 3:178576191-178576213 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
967083623 3:186073457-186073479 GAGGTCACACAGCAGCAGAGCGG + Intronic
967326084 3:188241239-188241261 CAGGGCAAACAGCTGCAGAGAGG - Intronic
967411236 3:189168573-189168595 GAGGGTAGACAGATGCATATTGG + Intronic
967419653 3:189259293-189259315 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
967633503 3:191774713-191774735 GAGGGTAGAGAGAAGCAAAAGGG - Intergenic
967715503 3:192757902-192757924 GAGGGAGAGCAGAAGCAGGGTGG + Intronic
967756823 3:193179532-193179554 GAGGGTGAGCTGAAGCAGAGTGG + Intergenic
967893505 3:194379933-194379955 GAGGTTACACAGAAACACAGGGG + Intergenic
968538649 4:1151022-1151044 CAGGGCAACCAGATGCAGAGAGG - Intergenic
968577785 4:1376017-1376039 GAGGGGCTACAGGAGCAGAGTGG - Exonic
968789586 4:2650403-2650425 GAAGGAAAACAGAAGGCGAGGGG + Intronic
968860693 4:3166911-3166933 GAGGGCAAGCCGAAGCAGGGCGG - Intronic
969164902 4:5299092-5299114 AAGGGCAAGCAGAAGCAGGGTGG - Intronic
969353846 4:6613749-6613771 GAGGGAAAAGAAAAGAAGAGAGG + Intronic
970214605 4:13745665-13745687 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
970626093 4:17884730-17884752 GAGACTACACAGAAACAGAGAGG - Exonic
970679290 4:18489024-18489046 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
970714643 4:18907607-18907629 GAGGGCTAGCAGAAGCAGGGTGG + Intergenic
970964505 4:21912951-21912973 GAGAGTAAACTGAAGAAGACAGG + Intronic
970975766 4:22041160-22041182 GAGGGCAAGCTGAAGCAGGGCGG - Intergenic
971437204 4:26640577-26640599 GAGGGTGAGCCGAAGCAGGGAGG + Intronic
971749121 4:30623873-30623895 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
971926399 4:33014669-33014691 GGGGGTAATTACAAGCAGAGAGG + Intergenic
972372531 4:38438493-38438515 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
972743362 4:41909810-41909832 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
972755477 4:42041904-42041926 GAGGGTGACCCGAAGCAGGGTGG + Intronic
972962661 4:44473557-44473579 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
973321707 4:48817134-48817156 GAGAGTAAGCAGAAGCAGTGTGG + Intronic
973336912 4:48965919-48965941 CAGGGCAACTAGAAGCAGAGGGG - Intergenic
973629023 4:52801797-52801819 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
973715303 4:53670108-53670130 GAGGGCAAACTGAAGCAGCGTGG - Intronic
973798307 4:54451044-54451066 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
973835718 4:54807218-54807240 GAGGGTGAATTGAAGCAGGGTGG + Intergenic
973837410 4:54824541-54824563 GAAGGTGAGCAGAAGCAGGGTGG + Intergenic
973883501 4:55297300-55297322 GAGGGTGAGCCGAAGCAGGGCGG + Intergenic
974106324 4:57473187-57473209 GAGGGCAAGCCAAAGCAGAGTGG - Intergenic
974264060 4:59560900-59560922 GAGGGCAAGCAGAAGCAGGTGGG - Intergenic
974265823 4:59584541-59584563 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
974491717 4:62572211-62572233 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
974560014 4:63505805-63505827 GAGAGTGAGCAGAAGCAGAGTGG + Intergenic
974566865 4:63589749-63589771 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
974792924 4:66713738-66713760 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
975053338 4:69894349-69894371 AAGGGTAAACACCAGCAGTGAGG + Intergenic
975149506 4:71005260-71005282 GAGGCCAAGCAGAAGCAGGGTGG - Intronic
975177822 4:71308569-71308591 GAGGGTGAGCAGAAGCAGAGGGG + Intronic
975245778 4:72119624-72119646 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
975425050 4:74215491-74215513 GAGGGCGAACTGAAGCAGGGTGG - Intronic
975466418 4:74714252-74714274 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
975524168 4:75331146-75331168 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
975528698 4:75378372-75378394 GAGTGTGAACCGAAGCAGGGTGG + Intergenic
975574561 4:75849790-75849812 GAGGGGAAACAGAATGTGAGAGG + Intergenic
975638700 4:76477821-76477843 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
975751144 4:77524692-77524714 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
975844066 4:78506723-78506745 GAGGGCAAGCTGAAGCAGGGAGG - Intronic
976392802 4:84523223-84523245 GAGGGTAAGGAGGGGCAGAGAGG + Intergenic
976506509 4:85853448-85853470 GAGGGTGAGCCGAAGCAGGGCGG - Intronic
976534412 4:86194042-86194064 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
977057382 4:92211006-92211028 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
977203899 4:94148499-94148521 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
977219836 4:94325755-94325777 GAGGGCAAGCTGAAGCAGTGTGG - Intronic
977326517 4:95580771-95580793 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
977439048 4:97038387-97038409 GAGGGTGACCAGAAGCAGTGGGG - Intergenic
977561431 4:98537286-98537308 GAGGGCAAGCCGAAGCAGGGTGG - Intronic
977792852 4:101128592-101128614 GAGGGCAAGCAGAAGCAGGGCGG + Intronic
977895726 4:102362800-102362822 GAAGGAAAACAGAAGCAAGGTGG + Intronic
977946429 4:102919579-102919601 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
978078964 4:104568444-104568466 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
978138986 4:105296790-105296812 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
978223422 4:106304925-106304947 GAGGGTAGACAAAGGAAGAGGGG - Intronic
978828609 4:113054843-113054865 GTGAGTAAATAGAAACAGAGAGG - Intronic
978957847 4:114636740-114636762 TAGGGTAAAACAAAGCAGAGTGG - Intronic
979012248 4:115387092-115387114 GAGGGTGAGCAGAAGTAGGGTGG + Intergenic
979023045 4:115526975-115526997 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
979085433 4:116404287-116404309 TAGGGAATACAGAAGGAGAGAGG + Intergenic
979115199 4:116814962-116814984 GAGGGTGATCCGAAGCAGGGTGG + Intergenic
979421310 4:120508953-120508975 GAGGGAAAGCAGAAGCAGGGTGG + Intergenic
979487465 4:121284957-121284979 GAGGGTAAGCTGAGGCAGAGTGG + Intergenic
979668362 4:123336990-123337012 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
979966070 4:127077635-127077657 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
980100405 4:128536176-128536198 GAGGGTGAACCAAAGCAGGGTGG - Intergenic
980148679 4:129021099-129021121 GAGGATGAACAGAAGTAGGGTGG + Intronic
980151736 4:129056080-129056102 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
980157718 4:129126815-129126837 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
980306221 4:131064647-131064669 TAGGATGAACAGATGCAGAGAGG - Intergenic
980494243 4:133570584-133570606 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
980584005 4:134789394-134789416 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
980634009 4:135474256-135474278 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
980733316 4:136849253-136849275 GAGGGCAAGCAGAAGCAGAGTGG - Intergenic
980769254 4:137350722-137350744 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
980888224 4:138786034-138786056 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
981084948 4:140673964-140673986 GAGGGAAATGAGGAGCAGAGAGG - Intronic
981131502 4:141162651-141162673 GAGGACAAGCAGAAGCAGGGTGG + Intronic
981629622 4:146804092-146804114 GAGGGCAAGCTGAAGCAGGGTGG + Intronic
981671455 4:147292316-147292338 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
981749770 4:148082410-148082432 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
981788065 4:148503165-148503187 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
981795031 4:148585892-148585914 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
981796336 4:148599270-148599292 GAGGGTGAGCTGAAGCAGAGTGG - Intergenic
981859932 4:149341829-149341851 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
981939843 4:150271052-150271074 GAGGGCAAGCCGAAGCAGGGTGG + Intronic
982794622 4:159630013-159630035 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
982815468 4:159878220-159878242 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
982825655 4:160001498-160001520 GAGGGTGAGCAGAAGTAGGGTGG + Intergenic
982848079 4:160276409-160276431 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
982853044 4:160342772-160342794 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
982909302 4:161118542-161118564 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
982915498 4:161203793-161203815 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
983044602 4:162970167-162970189 GAGGGCCAGCAGAAGCAGGGTGG - Intergenic
983179366 4:164630281-164630303 GAGGGCTAGCAGAAGCAGAGTGG + Intergenic
983543207 4:168935121-168935143 GAGGGCGAGCAGAAGCAGGGTGG + Intronic
983594264 4:169448827-169448849 GAGGGTGAGCCGAAGCAGGGTGG + Intronic
983596390 4:169472430-169472452 GAGGGAGAGCAGAAGCAGGGTGG - Intronic
983840777 4:172455059-172455081 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
984224390 4:177017357-177017379 GAGGGTGAACCGAAGCAGGGCGG + Intergenic
984354113 4:178636826-178636848 GAGGGCAAGCAGAAGCAGAGTGG + Intergenic
984372383 4:178884070-178884092 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
984434069 4:179685648-179685670 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
984526142 4:180861031-180861053 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
984618551 4:181926857-181926879 GAAGGCAAGCAGAAGCAGGGTGG + Intergenic
985317328 4:188672336-188672358 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
985794734 5:1953580-1953602 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
986241426 5:5963417-5963439 GAGGGTGAACTGAAGCAGGCAGG + Intergenic
986295625 5:6435662-6435684 GATGGTAGATAGAAGCAGATGGG - Intergenic
986358458 5:6951964-6951986 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
986378915 5:7163097-7163119 GATGGCCAACAGAAGCAGGGTGG - Intergenic
986645180 5:9910324-9910346 TAGAGTAGACAGAGGCAGAGAGG + Intergenic
986675110 5:10177546-10177568 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
986838892 5:11672901-11672923 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
987075664 5:14379845-14379867 GACAGTGAACAGAAGCAGAACGG - Intronic
987474657 5:18375762-18375784 GAGGGTCAACGGGAGCAGAAGGG - Intergenic
988204007 5:28110806-28110828 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
988381316 5:30499816-30499838 GAGGGTGAACCAAAACAGAGTGG - Intergenic
988402023 5:30775282-30775304 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
988618130 5:32794853-32794875 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
988771177 5:34434754-34434776 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
988795152 5:34646674-34646696 GAGGGTGAGCTGAAGCAGAGCGG - Intergenic
988867776 5:35354339-35354361 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
988970712 5:36465105-36465127 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
988975143 5:36508164-36508186 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
989320795 5:40131346-40131368 GAGGGCAAGCAGAAGCAGAGTGG - Intergenic
989358114 5:40567359-40567381 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
989605420 5:43239784-43239806 GAGGATAAAAAGAATAAGAGTGG - Intronic
989666523 5:43860239-43860261 GAGGTTGCACAGATGCAGAGTGG - Intergenic
989687710 5:44108848-44108870 GAAGGTGACCAGAAGCAGGGTGG - Intergenic
989825260 5:45847646-45847668 GAGGGAGAACAGAAGCAGGGTGG + Intergenic
990009788 5:50983041-50983063 CAGAGGCAACAGAAGCAGAGAGG - Intergenic
990098779 5:52156486-52156508 GAGGGTGAGCAGAAACAGGGTGG + Intergenic
990160020 5:52927552-52927574 GAAAGCAAACAGAATCAGAGTGG - Intronic
990183851 5:53191630-53191652 GAGGGTGAGCAAAAGCAGAGTGG - Intergenic
990239153 5:53799519-53799541 GAGGGCAAGCTGAAGCAGGGCGG + Intergenic
990332919 5:54745214-54745236 GAGGGCAAACAGAACCAGTAGGG + Intergenic
990713065 5:58606070-58606092 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
990803426 5:59631592-59631614 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
990822527 5:59858426-59858448 GAGGGCAAAGACAAGCAGTGGGG - Intronic
991034496 5:62114593-62114615 GAGGCTAAACAGAAGGAATGTGG - Intergenic
991236617 5:64406809-64406831 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
991280811 5:64910924-64910946 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
991409588 5:66332936-66332958 AAGGGAGAACAGAAGCAGTGAGG - Intergenic
991575806 5:68102374-68102396 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
991651982 5:68865097-68865119 GAGAGTGGGCAGAAGCAGAGTGG + Intergenic
991965134 5:72083266-72083288 GAGGAAAAGGAGAAGCAGAGAGG - Intergenic
992025992 5:72669619-72669641 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
992077767 5:73206913-73206935 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
992287207 5:75247990-75248012 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
992372216 5:76154945-76154967 GAGGGTAGATAAAAGAAGAGAGG + Intronic
992376483 5:76193011-76193033 CAGTGTAAATAGGAGCAGAGGGG - Intronic
992383936 5:76265769-76265791 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
992442412 5:76808500-76808522 GAGAGGAAGCAGAGGCAGAGGGG - Intergenic
992480210 5:77143741-77143763 GAGTTTAAACAGCAGCAGAGGGG + Intergenic
992580975 5:78175192-78175214 GAGGGTGAGCTAAAGCAGAGTGG - Intronic
992673777 5:79084987-79085009 GAAGGTGGAAAGAAGCAGAGGGG - Intronic
992740702 5:79770583-79770605 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
993028061 5:82668959-82668981 GAGGGAAGATAGAAGCAGATTGG - Intergenic
993162258 5:84307405-84307427 GAGGCCCAACAGAAACAGAGAGG + Intronic
993266402 5:85732009-85732031 GAGGGCAAACCAAAGCAGGGTGG + Intergenic
993381946 5:87218163-87218185 GAAGGCAAGCAGAAGCAGGGTGG - Intergenic
993410563 5:87567817-87567839 GAGGGCAAGCAGAAGCAAGGGGG - Intergenic
993563820 5:89447301-89447323 GAGGGAAAGAAGAGGCAGAGTGG + Intergenic
993814046 5:92518664-92518686 GAGAATAAACAGATGTAGAGGGG - Intergenic
993948055 5:94138420-94138442 GAGGGTAAGCCAAAGCAGGGCGG - Intergenic
994014963 5:94955109-94955131 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
994077075 5:95665404-95665426 GTTGGTACATAGAAGCAGAGAGG - Intronic
994622551 5:102179803-102179825 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
994850901 5:105053683-105053705 GAGGGTCAGCAGAAGCAGAGTGG - Intergenic
995093990 5:108213583-108213605 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
995108118 5:108398617-108398639 GAGGGCAAAGTGAGGCAGAGTGG + Intergenic
995134967 5:108671193-108671215 GAGGGTGAGCAGAAGAAGTGTGG - Intergenic
995263860 5:110136247-110136269 GAGGGTGAGCAGAAGCAGGCTGG - Intergenic
995301833 5:110594151-110594173 GAGGGCAAGCAGAAGCATGGTGG + Intronic
995398788 5:111717506-111717528 GAAGGTGAGCAGAAGCAGGGTGG - Intronic
995464339 5:112435843-112435865 GAGGGTGAGCAGAAGCAGGCTGG + Intergenic
995474955 5:112538796-112538818 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
995785816 5:115826197-115826219 GAGGGTGAGCAGAAGCAGAGTGG - Intergenic
995790742 5:115883499-115883521 AAGGGTGAGCAGAAGCAGGGTGG - Intronic
995808477 5:116080046-116080068 GAAGGTGAGCAGAAGCAGGGTGG + Intergenic
995811232 5:116108991-116109013 GATGGTGAGCAGAAGCAGGGTGG - Intronic
996428000 5:123335642-123335664 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
996592189 5:125160540-125160562 GAGAGTGAACAGAAGCAGGGTGG + Intergenic
997154315 5:131536710-131536732 GACGGAAAGCAGAAGCATAGTGG - Intronic
997217924 5:132129718-132129740 GAGAGCAAGCAGAAGCAGGGTGG - Intergenic
997343934 5:133171198-133171220 GAGGGCAAGCTGAAGCAGGGCGG - Intergenic
997809608 5:136954339-136954361 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
998387267 5:141764675-141764697 ATGAGAAAACAGAAGCAGAGAGG - Intergenic
998691905 5:144596290-144596312 GAGGGTGAACCGAAGCAGGGTGG - Intergenic
998772746 5:145564948-145564970 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
999030160 5:148281580-148281602 GAGGGTAAACAGAAGCAGAGTGG - Intronic
999344463 5:150803764-150803786 GAAGGTAAATAGAAGCATAAAGG - Intergenic
999365056 5:151017995-151018017 GAGGGCAATCAGAAGCAGCCTGG + Intergenic
999468576 5:151830993-151831015 GAAGGTGAGCTGAAGCAGAGTGG + Intronic
1000214250 5:159139692-159139714 GAGGGTAAGCCAAAGCAGGGCGG + Intergenic
1000547977 5:162625556-162625578 GAGGGCTAGCAGAAGCAGGGTGG + Intergenic
1000591574 5:163165196-163165218 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1000786440 5:165550046-165550068 CAGGGTGAGCTGAAGCAGAGTGG - Intergenic
1000820269 5:165973952-165973974 GAGGGCAACGAGAAGCAGGGTGG - Intergenic
1000996186 5:167960994-167961016 GAGGGCAAGCTGAAGCAGGGCGG - Intronic
1001056426 5:168453908-168453930 GCAGGTGAACAGAGGCAGAGCGG + Intronic
1001109222 5:168881971-168881993 GAGGGAACAGAGAAGCAGAGAGG - Intronic
1002944713 6:1750428-1750450 GAGGGTGAGCCGAAGCAGGGTGG + Intronic
1003150273 6:3542318-3542340 GAAGGTAGTCAGAGGCAGAGGGG + Intergenic
1003165915 6:3678147-3678169 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1003713590 6:8620090-8620112 GAGGGTTAGCCGAAGCAGGGTGG - Intergenic
1003970973 6:11299010-11299032 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1004024616 6:11806592-11806614 GAGGGTGAACAGTTGCCGAGAGG - Intronic
1004491621 6:16122629-16122651 CAGGGTAAGGAGAAGCAGACTGG + Intergenic
1004904460 6:20223337-20223359 GAGAGAAAACAGAAAGAGAGGGG + Intergenic
1005152419 6:22767524-22767546 GAAGGAAAAAAGAAGCATAGTGG - Intergenic
1005747093 6:28848590-28848612 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1005778437 6:29162307-29162329 GAGGGCAAGCAGAAGAAGGGTGG - Intergenic
1006198466 6:32263590-32263612 GAGGGCAAGCCGAAGCAGGGTGG - Intergenic
1006241203 6:32680280-32680302 GAGAGTGAAGAAAAGCAGAGTGG - Intergenic
1007755456 6:44096359-44096381 GAGGGGAAACTGATGCACAGGGG + Intergenic
1007787333 6:44288360-44288382 GCTGGGAAACTGAAGCAGAGAGG + Intronic
1007858049 6:44878770-44878792 GAGGGCAAGCCGAAGCAGGGTGG + Intronic
1008176281 6:48271341-48271363 AAGGGCAAATAGAAGCAGGGTGG - Intergenic
1008265184 6:49416395-49416417 GAAGGTAAACACAAGAAGAGAGG - Intergenic
1008372064 6:50744189-50744211 GAGGGTAAAAAGTAGGAGGGTGG - Intronic
1008407676 6:51136734-51136756 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
1008575558 6:52856853-52856875 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
1008782813 6:55127367-55127389 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
1008786067 6:55169767-55169789 GAAGGTAGAGAGATGCAGAGTGG - Intronic
1008896920 6:56566493-56566515 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1008997793 6:57679507-57679529 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1009186285 6:60578845-60578867 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1009290009 6:61869703-61869725 GAGGGTGAGCCGAAGCAGGGTGG + Intronic
1009335972 6:62491866-62491888 GAGTGCAAGCAGAAGCAGGGTGG + Intergenic
1009455181 6:63848530-63848552 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
1009482904 6:64182841-64182863 GAGGGTAGACAGGAGTAGGGTGG - Intronic
1009536589 6:64896279-64896301 GAGGGCAAGCAGATGCAGGGTGG + Intronic
1009570095 6:65374233-65374255 AAGGGTGAGCAGAAGCAGGGTGG + Intronic
1009628622 6:66166650-66166672 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1009718335 6:67428676-67428698 GAGGGCGAACAGAAGCAGGATGG - Intergenic
1009775822 6:68205455-68205477 GAGGGCCAGCAGAAGCAGGGTGG + Intergenic
1009795143 6:68456535-68456557 GAGGGTGAACCAAAGCAGGGTGG - Intergenic
1009959585 6:70501757-70501779 GAGGGTGAGTAGAAGCAGGGTGG - Intronic
1009998202 6:70920394-70920416 GAGGGCAAGCCGAAGCAGGGCGG - Intronic
1010003834 6:70974315-70974337 GAGGGCAAACTGAAGCAGGGTGG + Intergenic
1010006148 6:70997839-70997861 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1010171862 6:72984683-72984705 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1010276257 6:73971966-73971988 GAAGGCAAGCAGAAGCAGGGTGG + Intergenic
1010422186 6:75688366-75688388 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1010447080 6:75960165-75960187 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1010522139 6:76850254-76850276 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1010574870 6:77518357-77518379 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1010615280 6:78005471-78005493 GAGGGCAAGCAGAAGTAGGGTGG + Intergenic
1010668392 6:78656100-78656122 GAGGGCGAGCAGAAGCAGCGTGG - Intergenic
1010676938 6:78756269-78756291 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1010747205 6:79577793-79577815 GAGGGTGAGCCGAAGCAGGGCGG + Intergenic
1011020784 6:82809787-82809809 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
1011065417 6:83320999-83321021 GAGGGCAAGGAGAAGCAGGGTGG + Intronic
1011137489 6:84115874-84115896 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
1011235656 6:85213452-85213474 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1011245205 6:85314897-85314919 GAGGGTGAGAAGAAGCAGGGCGG - Intergenic
1011299009 6:85854198-85854220 GAGGGTGAGCAGAAACAGGGTGG - Intergenic
1011302724 6:85892937-85892959 GAGGGCAAGCCGAAGCAGAGTGG - Intergenic
1011348016 6:86392744-86392766 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1011417700 6:87139829-87139851 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1011526272 6:88268650-88268672 GAGGGAACTCAGATGCAGAGAGG - Intergenic
1011578107 6:88827235-88827257 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1011831315 6:91374987-91375009 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1012083159 6:94785735-94785757 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1012207548 6:96479190-96479212 GAGGGTGAACTGAAGCAAGGTGG - Intergenic
1012484136 6:99702270-99702292 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1012725908 6:102809418-102809440 GAGGGTGAGCTGAAGCAGAGCGG - Intergenic
1012870803 6:104670927-104670949 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1012940965 6:105415153-105415175 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1013024956 6:106262703-106262725 GAGGGTGACCAGAAGCAGGGTGG + Intronic
1013037910 6:106404727-106404749 GAGGGTGAGCAGAAGCAGTGTGG + Intergenic
1013672543 6:112421241-112421263 GAAGGCAAGCAGAAGCAGGGTGG + Intergenic
1013682506 6:112541095-112541117 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1013920239 6:115394892-115394914 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1014058569 6:117044388-117044410 GAGGGCTAGCTGAAGCAGAGTGG - Intergenic
1014122798 6:117745870-117745892 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1014177111 6:118342838-118342860 GAGGGCAAGCAGAAGCATGGTGG - Intergenic
1014223629 6:118823388-118823410 GAAGGTGAGCAGAAGCAGGGTGG - Intronic
1014422906 6:121267294-121267316 GAGTGTGAACCGAAGCAGGGCGG + Intronic
1014466234 6:121760344-121760366 GAGGGCAAGCTGAAGCAGATTGG + Intergenic
1014523981 6:122479044-122479066 AAGGGCAAGCAGAAGCAGGGTGG - Intronic
1014527905 6:122522706-122522728 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1014568960 6:122986019-122986041 GAGGGCAAGCCAAAGCAGAGTGG + Intergenic
1014640098 6:123898892-123898914 GAGAGAAGACAGAGGCAGAGAGG - Intronic
1014922347 6:127228332-127228354 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
1015290986 6:131538399-131538421 GAGGGTGAGCCAAAGCAGAGTGG + Intergenic
1015419158 6:132986442-132986464 GAGGGCAAGCTGAAGCAGGGCGG - Intergenic
1015829164 6:137348976-137348998 GAGAGCAAAAGGAAGCAGAGTGG + Intergenic
1016006046 6:139090401-139090423 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1016334839 6:142993891-142993913 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1016436919 6:144047169-144047191 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
1016439250 6:144066576-144066598 GAGGGAGAACAAAAGTAGAGGGG - Intergenic
1017529294 6:155272484-155272506 GAAGGCAAGCAGAAGCAGAGGGG - Intronic
1017709967 6:157158655-157158677 GAGGAGCCACAGAAGCAGAGTGG - Intronic
1018094601 6:160374302-160374324 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1018108628 6:160513532-160513554 GAGGGTTAGCAGAAGCAGGCTGG + Intergenic
1018114722 6:160572170-160572192 GAGGGTGACCTGAAGCAGGGTGG - Intronic
1018688031 6:166318746-166318768 GAGGGTGACAAGGAGCAGAGGGG - Intergenic
1018805715 6:167258152-167258174 GAGGGGGAGCAGAAGCAGGGTGG + Intergenic
1019203753 6:170341775-170341797 GAGGGTGACCAGAAGCAGGGTGG - Intronic
1019564852 7:1674185-1674207 GTGGGGAAACTGAGGCAGAGAGG + Intergenic
1019635547 7:2073704-2073726 GAGGGTAGACAGAGGCATAGGGG + Intronic
1019969439 7:4528323-4528345 GAGGTCAAACTGAACCAGAGAGG - Intergenic
1020011352 7:4807534-4807556 GAGGGGAGACAGAGGGAGAGAGG - Intronic
1020333315 7:7041978-7042000 GAGGGCAAGCAGAAGCAAGGTGG + Intergenic
1020339071 7:7089572-7089594 GAGGGTAAGCAGAAGCAGGGTGG - Intergenic
1020391501 7:7662610-7662632 GAGGGCGAACAGAAACAGGGTGG - Intronic
1020487749 7:8739442-8739464 GAAGGCAATCAGAAGCAGGGTGG - Intronic
1020583758 7:10038544-10038566 GAGTGTAAAACAAAGCAGAGAGG + Intergenic
1020608666 7:10368025-10368047 GAGGGTGAGCAGATGCAGGGTGG - Intergenic
1020629666 7:10625214-10625236 GAGGGCGAGCAGAAGCAGAGGGG + Intergenic
1020693905 7:11391891-11391913 GAGGGCAAGCTGAAGCAAAGTGG - Intronic
1020693960 7:11392240-11392262 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1020715974 7:11675113-11675135 GAGGGCAAGCAGAAGCAGGTGGG + Intronic
1020823930 7:13003261-13003283 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1020874353 7:13674313-13674335 GAGGGCAAGCAGAAGCAAGGTGG - Intergenic
1021014579 7:15517511-15517533 GAGGCCAAGCAGAAGCAGGGTGG + Intronic
1021347751 7:19548540-19548562 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1021749429 7:23780132-23780154 GAGGGCAAGCAAAAGCAGGGTGG - Intronic
1022058930 7:26770750-26770772 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1022136069 7:27449518-27449540 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1022351869 7:29573754-29573776 CAAGGGAAACAGAATCAGAGAGG - Intergenic
1022648970 7:32257747-32257769 GAGGCTAAACACCAGAAGAGGGG + Intronic
1023105098 7:36756092-36756114 GGGGGTAAACAAAGGCAAAGAGG + Intergenic
1023456874 7:40349056-40349078 GAGGATATACAGAAGGAGGGTGG - Intronic
1023511707 7:40959969-40959991 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1023568990 7:41553118-41553140 GAGGGTGAGCCAAAGCAGAGTGG - Intergenic
1023737625 7:43248766-43248788 GAGGGGAAACAGGAGGAGAACGG - Intronic
1023894230 7:44418771-44418793 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1024017643 7:45332692-45332714 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1024372968 7:48607339-48607361 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1024664993 7:51537073-51537095 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1024950590 7:54856321-54856343 GAGGGTGAACAGAAGCAGTGTGG - Intergenic
1024998604 7:55295208-55295230 GAGGGTGAACTGAAGCAGGGTGG - Intergenic
1025714316 7:63941108-63941130 GAGGGTTAGCAGAAGCAGAGTGG + Intergenic
1026110226 7:67453590-67453612 GAGGTTAGATAGAAGCAAAGCGG - Intergenic
1027454952 7:78378226-78378248 AAAGGTAAAAAGAATCAGAGAGG + Intronic
1027510407 7:79072087-79072109 GAGGGCAAGCTGAAGCAGAGTGG - Intronic
1027790311 7:82633242-82633264 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1027864656 7:83630081-83630103 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
1027910917 7:84249212-84249234 GTGGGTAAATACAAGTAGAGGGG - Intronic
1028080266 7:86567202-86567224 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1028210577 7:88069240-88069262 GAAGGAAAGCAGAAGGAGAGAGG - Intronic
1028267242 7:88741399-88741421 AAGGGTGAACAAAAGGAGAGTGG - Intergenic
1028326941 7:89539806-89539828 GAGGATAAGCCAAAGCAGAGTGG + Intergenic
1028396072 7:90369791-90369813 GAGGGCAAACCAAAGCAGGGTGG - Intronic
1028476416 7:91258172-91258194 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1028538291 7:91913916-91913938 GAAGGAAAACAGAGGCAGGGAGG + Intergenic
1028692094 7:93664008-93664030 GAGGGCAAGCTGAAGCAGGGCGG - Intronic
1029189719 7:98762772-98762794 GAGGGGAAACAGGTTCAGAGAGG + Intergenic
1029215987 7:98950038-98950060 GAGGGTCAAAAGAAGAAGACAGG - Intronic
1029493181 7:100883379-100883401 GAGGGAAAACAGAAGAAATGAGG - Intronic
1030482225 7:110119552-110119574 GAGGGTGAGCAGAAGCAGGCTGG + Intergenic
1030500898 7:110357078-110357100 GAGGATGAACAAAAGCAGGGTGG - Intergenic
1030555854 7:111022707-111022729 GACTAAAAACAGAAGCAGAGAGG + Intronic
1030703166 7:112662857-112662879 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1030705715 7:112690458-112690480 GAGGGCGAGCTGAAGCAGAGTGG - Intergenic
1030741014 7:113110085-113110107 GAAGGTAAAAGGAAGAAGAGAGG + Intergenic
1030771178 7:113476204-113476226 TAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1030781053 7:113600590-113600612 GAGTGCAAGCAGAAGCAGGGTGG + Intergenic
1030884582 7:114922335-114922357 GAGGGGAAAGAGAGGCAGAGAGG + Exonic
1031107226 7:117559506-117559528 GAGGGTAAAATTAAGCACAGTGG + Exonic
1031613852 7:123857477-123857499 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1031903065 7:127430581-127430603 GAGAGCAAGCAGAAGCAGGGTGG - Intronic
1032001561 7:128268654-128268676 GAGGCTAAACAGAAGACAAGGGG + Intergenic
1032015709 7:128379240-128379262 GAGGTGAACAAGAAGCAGAGTGG + Intergenic
1032275565 7:130452341-130452363 GAAGGTAACCAGATGAAGAGTGG - Intergenic
1032659834 7:133970640-133970662 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1032893225 7:136222315-136222337 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1032957201 7:136984741-136984763 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1033122755 7:138680442-138680464 GAGGTTAAAAAGAAGCAGCCAGG - Intronic
1033561214 7:142533529-142533551 GAGGGGAAACTGAAGAACAGGGG + Intergenic
1033617583 7:143031886-143031908 GAAGGTGAGCAGAAGCAGGGTGG + Intergenic
1033887493 7:145966733-145966755 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1034212801 7:149379699-149379721 GAGGAAAAACAGATGCAGAAAGG - Intergenic
1034314402 7:150116928-150116950 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1034715192 7:153235290-153235312 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1034792493 7:153983841-153983863 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1035793982 8:2336757-2336779 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1035798823 8:2384951-2384973 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1035998403 8:4574419-4574441 GAGGGTAAGCAGAAGAAGGGTGG - Intronic
1036553689 8:9838512-9838534 GAGGGCGAGCCGAAGCAGAGTGG + Intergenic
1037285559 8:17294725-17294747 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1037916641 8:22777191-22777213 GAGGGGAAGCAGAAGGAAAGAGG - Intronic
1039031493 8:33314484-33314506 GAGGGGAAACAGAGTCAGAGTGG - Intergenic
1039033397 8:33333259-33333281 GAAGGAAAACAGAGGCAGAGTGG + Intergenic
1039142498 8:34406818-34406840 AATGTTAAACAGAAGTAGAGTGG + Intergenic
1039145110 8:34438440-34438462 GAGGGCAAGCTGAAGCAGCGTGG + Intergenic
1039154045 8:34535545-34535567 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1039282892 8:36006258-36006280 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
1039284481 8:36026208-36026230 GAGGGTGAGCCGAAGCAGTGTGG + Intergenic
1039627388 8:39068187-39068209 GAGGGGAATAAGAAGCAGAGAGG + Intronic
1039680916 8:39735501-39735523 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1039742893 8:40398304-40398326 TAACGTAAACAGAAGCACAGAGG + Intergenic
1039832336 8:41225149-41225171 GAGGGCAAGCTGAAGCAGGGCGG + Intergenic
1040473012 8:47752132-47752154 GAGGGCAAGCTGAAGCAGGGCGG + Intergenic
1040473936 8:47760418-47760440 GAGGGCAAGCCAAAGCAGAGTGG - Intergenic
1040779815 8:51094823-51094845 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1041022358 8:53650623-53650645 GAGGCTAACAGGAAGCAGAGTGG - Intergenic
1041050707 8:53931747-53931769 GAGGGTGAGCAGAAGCAGTGTGG + Intronic
1041154969 8:54976733-54976755 GAGGACAAGCAGAAGCAGGGAGG + Intergenic
1041287222 8:56273386-56273408 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1041419160 8:57647278-57647300 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1041630658 8:60083230-60083252 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1041634793 8:60130635-60130657 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1041900718 8:62979009-62979031 GAGGGCAAGCAGAAGCAGGGTGG - Exonic
1041944273 8:63424215-63424237 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1042110836 8:65379781-65379803 GAGAGCAAGCAGAAGCAGAGTGG + Intergenic
1042140717 8:65675692-65675714 GTGAGAAAACAGAAGCATAGAGG + Intronic
1042478731 8:69280045-69280067 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1042614295 8:70631862-70631884 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
1042627244 8:70771208-70771230 GAGGGTAAGCTGAAGCAGGGTGG - Intronic
1042946110 8:74156350-74156372 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1042969386 8:74391475-74391497 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1043080838 8:75763177-75763199 GAGGGTGAGCAAAAGCAGAGTGG + Intergenic
1043118240 8:76286849-76286871 GACGATGAGCAGAAGCAGAGTGG - Intergenic
1043165883 8:76902067-76902089 GAGGGCAAGCGGAAGCAGGGTGG - Intergenic
1043244442 8:77979698-77979720 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1043253749 8:78106872-78106894 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1044312458 8:90709335-90709357 GAGGATGAACAGAAGCAGAGTGG - Intronic
1044503477 8:92990598-92990620 GAGGGCAAGCTGAAGCAGCGTGG + Intronic
1044509559 8:93058759-93058781 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1044577010 8:93780341-93780363 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
1044595354 8:93953565-93953587 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1044940346 8:97335434-97335456 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1044956651 8:97488121-97488143 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1045123365 8:99063241-99063263 GAGGGCAAGCCGAAGCAGGGCGG + Intronic
1045154139 8:99447591-99447613 GAGGGAAACCAGAAACACAGAGG - Intronic
1045185265 8:99830895-99830917 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1045390499 8:101710120-101710142 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1045638848 8:104224101-104224123 AAGGGTAAACCAAAACAGAGTGG - Intronic
1045646980 8:104308735-104308757 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1045797655 8:106065101-106065123 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1045802529 8:106117936-106117958 GAGTGTGAACTGAAGCAGGGTGG - Intergenic
1045973258 8:108103627-108103649 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1046014550 8:108589901-108589923 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1046048058 8:108986856-108986878 GAGGGCAAGCAGAATCAGGGTGG - Intergenic
1046153560 8:110258200-110258222 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1046295781 8:112217972-112217994 GAGGGTGAACAGAACCAGGGTGG + Intergenic
1046879257 8:119290291-119290313 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1046942560 8:119944979-119945001 AAGGTGATACAGAAGCAGAGAGG - Intronic
1046947555 8:119988306-119988328 GAGGGCGAGCAGAAGCAGAGTGG - Intronic
1046972629 8:120238902-120238924 GAGGGTGAGCATAAGCAGGGTGG - Intronic
1047133600 8:122051216-122051238 GAGGGTGAACTGAAGCACGGTGG + Intergenic
1047931513 8:129732831-129732853 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1047958889 8:129996500-129996522 GTGGGGAAACAGAAGCCAAGTGG + Intronic
1048194533 8:132321506-132321528 GAGAGCAAACAGAAGCAGGAGGG - Intronic
1049397704 8:142409276-142409298 GAGTGAAAAGAGAAGGAGAGAGG + Intergenic
1049470157 8:142771689-142771711 AAAGGTCAAAAGAAGCAGAGAGG - Intronic
1050031680 9:1393250-1393272 GAGGGCTAGCAGAAGCAGGGTGG + Intergenic
1050587002 9:7123437-7123459 AAGGGCAAAGAGAAGCAAAGGGG - Intergenic
1050591115 9:7161302-7161324 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
1050597263 9:7216405-7216427 GAGGGTGAGCCGAAGCAGGGCGG + Intergenic
1050604200 9:7283676-7283698 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
1050641580 9:7673494-7673516 GAGGGGAAAGAAAAGAAGAGTGG + Intergenic
1050645274 9:7713072-7713094 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1050686100 9:8171006-8171028 GAGAGGACACAGAAACAGAGTGG - Intergenic
1050952112 9:11610750-11610772 GAGGGGAAAGAGAAGGAGAGAGG - Intergenic
1050963256 9:11765413-11765435 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1051059971 9:13034464-13034486 GAGGGGAAACAGCAGAAGAATGG - Intergenic
1051124767 9:13791687-13791709 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1051298200 9:15618802-15618824 GAGAGCAAGCAGAAGCAGGGTGG - Intronic
1051308766 9:15746771-15746793 GAGGGTGAGCTGAAGCAGGGCGG + Intronic
1051322025 9:15914941-15914963 GAGGGTGAGCAGAAGCAGAGTGG - Intronic
1051452057 9:17207635-17207657 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1051611729 9:18968042-18968064 GAAGGTGAGCAGAAGCAGGGTGG - Intronic
1051695895 9:19767597-19767619 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1051814241 9:21087068-21087090 GAGGGTAAGCAGAAGGAGGGTGG + Intergenic
1051919444 9:22247688-22247710 GAGGGGGAACAGAGGGAGAGGGG - Intergenic
1052052800 9:23866893-23866915 GAGGGTAAGCCAAAGCAGGGTGG - Intergenic
1052134000 9:24888592-24888614 GAAGGCAAGCTGAAGCAGAGTGG + Intergenic
1052144127 9:25026158-25026180 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1052157258 9:25207687-25207709 GAGGGTTAAGACAGGCAGAGAGG - Intergenic
1052366278 9:27615214-27615236 GAGGGTGAGCAGAAGTAGGGTGG - Intergenic
1052506284 9:29358808-29358830 GAGGGTGAGCAGAAGTAGGGTGG + Intergenic
1052849952 9:33372021-33372043 GAAGGTAAACAGCAGGAGACAGG + Intergenic
1053268713 9:36735177-36735199 GTGGGGAAACTGAGGCAGAGGGG - Intergenic
1053311550 9:37023980-37024002 GAGGGTTCACAGAAGGGGAGAGG - Intronic
1055061345 9:72072342-72072364 GAGGGCGAGCAGAAGCAGGGTGG + Intronic
1055210237 9:73782887-73782909 GAGGGCAAGCAGAAGCAGAGTGG + Intergenic
1055345124 9:75327443-75327465 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1055537959 9:77268444-77268466 GAGGGCGAGCTGAAGCAGAGTGG - Intronic
1055628676 9:78200799-78200821 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1056160000 9:83879673-83879695 GAGAATAAACAGACTCAGAGAGG + Intronic
1056302713 9:85258445-85258467 CATGGCAAACAGAAGCAGGGTGG - Intergenic
1056360226 9:85850145-85850167 GAGAATAAACAGACTCAGAGAGG - Intergenic
1056385227 9:86091052-86091074 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1056844337 9:90024512-90024534 GAGGATAGAAGGAAGCAGAGTGG - Intergenic
1056997864 9:91479948-91479970 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1057320488 9:94007982-94008004 GGGTGTCAACAGAAGCCGAGGGG + Intergenic
1057353997 9:94320585-94320607 GAAGGTACACTGAGGCAGAGAGG + Exonic
1057653768 9:96937050-96937072 GAAGGTACACTGAGGCAGAGAGG - Exonic
1057671517 9:97094232-97094254 GAGTGTAAGAAGAAGCACAGTGG + Intergenic
1057871625 9:98722469-98722491 GTGGGGAAACAGGTGCAGAGAGG - Intergenic
1058074664 9:100638266-100638288 GAGGGCAAGCCGAAGCAGGGTGG - Intergenic
1058182436 9:101815365-101815387 GAGGGTGAGCAGAAGCAGCGTGG + Intergenic
1058259735 9:102814203-102814225 GAGGGTGAGTAGAAGCAGGGTGG + Intergenic
1058265712 9:102897255-102897277 GAGGGTGAGCAGAAGCAGGGAGG + Intergenic
1058941343 9:109815524-109815546 CAGGGTAGACAGAAACAGGGGGG + Intronic
1059341159 9:113598344-113598366 GAGGGGAAACAAAGGCACAGTGG - Intergenic
1059370332 9:113825626-113825648 GAGTGTCAACAGAGGCTGAGTGG + Intergenic
1059518668 9:114919427-114919449 AGGAGTTAACAGAAGCAGAGAGG + Intronic
1059864712 9:118501486-118501508 GAGGGCAAGCTGAAGCAGGGCGG - Intergenic
1060554545 9:124501536-124501558 GAGGGGAAAGAGCAGGAGAGAGG + Intronic
1061634843 9:131901006-131901028 GAGGGGAGACACAAGGAGAGGGG + Intronic
1061949212 9:133926842-133926864 CAGAGCACACAGAAGCAGAGAGG + Intronic
1062158413 9:135066784-135066806 GAGGGGAGACACATGCAGAGTGG + Intergenic
1203467772 Un_GL000220v1:103916-103938 GAAGGGAAAAAGAAACAGAGAGG - Intergenic
1203475597 Un_GL000220v1:147892-147914 GAAGGGAAAAAGAAACAGAGAGG - Intergenic
1186181400 X:6976496-6976518 GAGGGTGAGCAGAAACAGGGTGG - Intergenic
1186332833 X:8554292-8554314 GAGGGCGAGCAGAAGCAGGGTGG + Intronic
1186370094 X:8937687-8937709 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1186599890 X:11025091-11025113 GAAGGTGAGCAGAAGCAGAGTGG - Intergenic
1186673468 X:11791414-11791436 GAGGGAAAGCAGAAGCTGACAGG + Intergenic
1186773393 X:12839656-12839678 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1186774941 X:12855044-12855066 GAGGGTGAGCAGAAGCAAGGTGG - Intergenic
1186832432 X:13404141-13404163 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1187016913 X:15338290-15338312 GTGGGCAGACAGAAGAAGAGTGG + Intergenic
1187412590 X:19063860-19063882 GAGGGTCCCCAGAAGCAGAGTGG + Intronic
1187620445 X:21047354-21047376 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
1187660759 X:21544734-21544756 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1187705457 X:22005425-22005447 GAGGGCAAGCCGAAGCAGGGTGG - Intergenic
1187829207 X:23363625-23363647 GAGGGTGAGCCGAAGCAGGGCGG - Intronic
1187840019 X:23477200-23477222 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1187840496 X:23482177-23482199 GAGGGTGAGCCGAAGCAGAGTGG - Intergenic
1188123054 X:26334150-26334172 GAGGGTGAGCCGAAGCAGGGCGG + Intergenic
1188130097 X:26420061-26420083 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
1188193129 X:27196830-27196852 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1188504988 X:30873013-30873035 GAGGATGAAAAAAAGCAGAGAGG + Intronic
1188849954 X:35119827-35119849 GCAGGGAAAGAGAAGCAGAGTGG + Intergenic
1188954610 X:36418835-36418857 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1189338893 X:40189125-40189147 GAGGGTATTTAGAAACAGAGAGG + Intergenic
1189419417 X:40843444-40843466 GAGGGTAAAGGGAAGAAGGGTGG - Intergenic
1189575190 X:42343666-42343688 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1189800820 X:44690406-44690428 GGGAGGAAAAAGAAGCAGAGTGG + Intergenic
1190505792 X:51125074-51125096 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1190598176 X:52066740-52066762 GAGGGGAAAGAGGAGAAGAGAGG + Intronic
1190610648 X:52187333-52187355 GAGGGGAAAGAGGAGAAGAGAGG - Intronic
1190648999 X:52550908-52550930 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1190944045 X:55073351-55073373 GAGGGTGAGCAAAAGCAGGGTGG - Intergenic
1190959850 X:55235116-55235138 GAGGGCAAGCAGAATCAGGGTGG - Intronic
1190963805 X:55278395-55278417 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1191003836 X:55689100-55689122 GAGGGTAAGCCGAAGCAGGGTGG - Intergenic
1191004996 X:55702268-55702290 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191094428 X:56659427-56659449 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1191115334 X:56846582-56846604 GAGGGCAAGCAGAAACAGGGTGG + Intergenic
1191119660 X:56890468-56890490 GAGTGTAAGCAGAAGCAGGATGG + Intergenic
1191132703 X:57031301-57031323 GAGAGCAAGCAGAAGCAGGGTGG - Intergenic
1191135488 X:57059245-57059267 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1191148181 X:57190691-57190713 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1191153175 X:57242604-57242626 GAGGGTGAGCAGAAACAGGGTGG + Intergenic
1191174241 X:57482534-57482556 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1191194346 X:57705526-57705548 GTGGGCAAGCAGAAGCAGGGTGG + Intergenic
1191591253 X:62887957-62887979 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191606165 X:63065475-63065497 GAGGGGAAGCAGAAGCAGGGTGG + Intergenic
1191645621 X:63478164-63478186 GAGGGTGAGCTGAAGCAGGGAGG + Intergenic
1191657374 X:63613313-63613335 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1191676556 X:63797624-63797646 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191686658 X:63899282-63899304 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1191733441 X:64363760-64363782 GAGGGCAAGCTGAAGCAGGGTGG + Intronic
1191764453 X:64682111-64682133 GAGGGAAAACAGAACTAGGGAGG + Intergenic
1191766804 X:64706345-64706367 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
1191793699 X:64999287-64999309 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1191801407 X:65085087-65085109 GATGGTTACCAGAAGCTGAGAGG + Intergenic
1191802632 X:65098592-65098614 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1191809865 X:65175174-65175196 GAGGGTAAGCAGAAGCAGGGTGG - Intergenic
1191882455 X:65856630-65856652 GAGGGTGAGCTGAAGCAGGGAGG - Intergenic
1191941756 X:66489041-66489063 GAGGGTGAGCTGAAGCAGGGAGG + Intergenic
1191984762 X:66968296-66968318 GAGGGTGAACCAAAGCAGGGTGG + Intergenic
1191987306 X:66995435-66995457 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1192009176 X:67250062-67250084 GAAGGTGAACAGAAGCAGGGTGG + Intergenic
1192265132 X:69532454-69532476 GGGGTTAAACAAGAGCAGAGAGG - Exonic
1192395851 X:70780478-70780500 GAGGGTGAACCAAAGCAGGGTGG + Intronic
1192490866 X:71576451-71576473 AAGGGTAAATGAAAGCAGAGAGG - Intergenic
1192598470 X:72437184-72437206 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1192712695 X:73607784-73607806 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1192727469 X:73768066-73768088 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1192759273 X:74078346-74078368 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1192825879 X:74695860-74695882 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1192953251 X:76039897-76039919 GAGGGTGAACAGAAGCAGTGTGG - Intergenic
1192958257 X:76096140-76096162 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1192960561 X:76126613-76126635 GAGAGCAAAGAGAAGCAGGGTGG + Intergenic
1192964079 X:76159169-76159191 GAGGGTGAGCCAAAGCAGAGTGG + Intergenic
1192971222 X:76233496-76233518 GAAGGTGAGCAGAAGCAGTGTGG + Intergenic
1192980292 X:76332183-76332205 GAGGGTGAGCAGAAGCAGGCTGG + Intergenic
1192998102 X:76533692-76533714 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
1193010558 X:76670876-76670898 GAGGGTGAGCAGAAGCAGAGTGG + Intergenic
1193019981 X:76781082-76781104 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1193040540 X:76999266-76999288 CAGGGTAAGCAGAAGTAGGGTGG - Intergenic
1193043882 X:77032069-77032091 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1193065357 X:77253906-77253928 GAGGGCAAGCAGAAGCAGAGTGG + Intergenic
1193161454 X:78233352-78233374 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
1193228498 X:79013712-79013734 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1193254102 X:79325977-79325999 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1193266772 X:79481847-79481869 GAGGGTGAGCTGAAGCAGAGTGG + Intergenic
1193341384 X:80352970-80352992 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1193356077 X:80521465-80521487 GAGGGTGAGCCGAAGCAGAGTGG - Intergenic
1193382252 X:80828472-80828494 GAGGGCAAGCAGAAACAGGGTGG - Intergenic
1193394396 X:80967449-80967471 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1193398182 X:81010527-81010549 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1193402567 X:81063841-81063863 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1193404398 X:81083781-81083803 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1193419959 X:81271220-81271242 GAGGGCAAGCCAAAGCAGAGTGG - Intronic
1193514314 X:82445443-82445465 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1193542409 X:82788415-82788437 GAGGGTGAGCCAAAGCAGAGAGG + Intergenic
1193562581 X:83037636-83037658 GAGGGTGAGCAGTAGCAGGGTGG + Intergenic
1193645627 X:84065963-84065985 GAGGGTGAGCAGAAGTAGGGTGG + Intronic
1193897181 X:87128461-87128483 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1194203193 X:90979359-90979381 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1194242484 X:91469628-91469650 GAGGGCGAACAGAAGCAGGTGGG + Intergenic
1194254791 X:91622625-91622647 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1194315371 X:92369793-92369815 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1194355702 X:92881812-92881834 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1194391082 X:93319272-93319294 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1194631539 X:96291548-96291570 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1194643487 X:96429882-96429904 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1194783209 X:98049651-98049673 AAGGGCGAGCAGAAGCAGAGTGG - Intergenic
1194837558 X:98699409-98699431 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1194954499 X:100162856-100162878 GAGGGCAAGCAGAAGCGGGGTGG - Intergenic
1194959146 X:100215080-100215102 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1194963921 X:100266673-100266695 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
1195097981 X:101524483-101524505 GAGGGTGAGCTGAAGCAGGGCGG + Intronic
1195140021 X:101950016-101950038 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1195345041 X:103941006-103941028 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1195351272 X:103998711-103998733 GAGGGCAAGCCGAAGCAGGGTGG - Intergenic
1195547297 X:106126817-106126839 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1195675997 X:107507398-107507420 GAGGGGAATCAGAAGCTGGGAGG + Intergenic
1195810708 X:108825504-108825526 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1195820952 X:108944660-108944682 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1195826146 X:109003513-109003535 GAGGGTGAGCAGAAGCTGGGTGG + Intergenic
1195833807 X:109089555-109089577 GATGGTGAGCTGAAGCAGAGTGG - Intergenic
1195842670 X:109191853-109191875 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1195844358 X:109209872-109209894 GAGGGTGAGCAGAAGCAGAGTGG - Intergenic
1196133315 X:112181025-112181047 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1196139639 X:112246691-112246713 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1196167513 X:112551732-112551754 GAGGGAGAACTGAAGCAGAGTGG - Intergenic
1196281265 X:113825811-113825833 GAGGGCAAGCCGAAGCAGGGTGG - Intergenic
1196312301 X:114183328-114183350 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1196367891 X:114943465-114943487 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1196476518 X:116092469-116092491 GAGGGTGAGCAGACGCAGGGTGG - Intergenic
1196545818 X:116962885-116962907 GAGGGTTAGCCGAAGCAGAGTGG - Intergenic
1196603049 X:117623388-117623410 GAGGGTCAGCAGAAGCAGGGTGG - Intergenic
1197023284 X:121716808-121716830 GAAGGTGAAGAGAAGCAGAGTGG - Intergenic
1197051097 X:122060879-122060901 GAGGGCCAGCAGAAGCAGGGTGG + Intergenic
1197184665 X:123573356-123573378 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1197395676 X:125923625-125923647 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
1197505917 X:127305663-127305685 GAGGGCGAACAGAAGCAGGGTGG + Intergenic
1197614400 X:128675351-128675373 GAGGGTGAGCAGAAGCAGGGAGG - Intergenic
1197906161 X:131428110-131428132 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1197926853 X:131656071-131656093 TAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1198002358 X:132451964-132451986 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
1198060648 X:133042490-133042512 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
1198062520 X:133061646-133061668 GAGGGCGAGCAGAAGCAGGGTGG + Intronic
1198071278 X:133150923-133150945 TAGAATCAACAGAAGCAGAGTGG + Intergenic
1198085549 X:133278837-133278859 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1198098766 X:133405583-133405605 GAGGGTGACCAGAAGCTGAATGG - Intronic
1198278598 X:135120483-135120505 GAGGGTAAACAGTAACAGCTTGG + Intergenic
1198292363 X:135252033-135252055 GAGGGTAAACAGTAACAGCTTGG - Intronic
1198295482 X:135282783-135282805 GAGGGTGAGCAGAAGCAAGGTGG - Intronic
1198466740 X:136910210-136910232 GAGGGGAAAGAGAAGGAGATGGG - Intergenic
1198571251 X:137959825-137959847 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1198678665 X:139157952-139157974 GAGGGCAAGCTGAAGCAGGGTGG + Intronic
1198725866 X:139676295-139676317 GAGGGTGAACTGAAGCAGGGTGG - Intronic
1198753460 X:139958778-139958800 GAGGGCGAGCAGAAGCAGAGTGG + Intronic
1198757936 X:140000755-140000777 GAGGGCAAGCAGAAGTAGGGTGG + Intergenic
1198944624 X:141996603-141996625 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1199035914 X:143050792-143050814 GAGAGTGAACATAAGCAGGGTGG - Intergenic
1199171661 X:144740686-144740708 GAGGGTCAGGAGAAGCAGAGGGG - Intergenic
1199180952 X:144853792-144853814 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1199292304 X:146119007-146119029 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1199383738 X:147200442-147200464 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1199452282 X:147990283-147990305 GAGGGTGAGTAGAAGCAGGGTGG - Intronic
1199830608 X:151545915-151545937 GAGAGCAAGCAGAAGCAGAGTGG + Intergenic
1199939653 X:152612568-152612590 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1200206650 X:154321243-154321265 GAGGGTGAACAGCATCACAGAGG + Intronic
1200231353 X:154445287-154445309 GAGGGCAAACAAGAACAGAGTGG - Intronic
1200365497 X:155657899-155657921 GAGGGTGAGCAGAACCAGGGTGG - Intronic
1200378434 X:155808939-155808961 GAGGGTGAGCAAAAGCAGGGCGG + Intergenic
1200388581 X:155918603-155918625 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
1200405949 Y:2811580-2811602 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
1200549026 Y:4554785-4554807 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1200573577 Y:4862228-4862250 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1200623420 Y:5481328-5481350 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1200940373 Y:8774252-8774274 CAGGGTAAAGAGAGGCAGTGAGG - Intergenic
1201376662 Y:13330374-13330396 GAGGGCAAACAGAAGCAGGGTGG + Intronic
1201543145 Y:15131532-15131554 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1201563660 Y:15344161-15344183 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1201590552 Y:15610496-15610518 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1201611801 Y:15851524-15851546 GAAAGTGAGCAGAAGCAGAGTGG + Intergenic
1201761878 Y:17549275-17549297 CAAAGTAAACAGAAACAGAGTGG - Intergenic
1201839674 Y:18356715-18356737 CAAAGTAAACAGAAACAGAGTGG + Intergenic
1201922123 Y:19245213-19245235 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1201946313 Y:19514661-19514683 GAGGGCAAGCAGAAGCAAGGTGG + Intergenic