ID: 999035189

View in Genome Browser
Species Human (GRCh38)
Location 5:148341236-148341258
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999035187_999035189 -10 Left 999035187 5:148341223-148341245 CCCTGAGAAGGTAACTTATAAGC No data
Right 999035189 5:148341236-148341258 ACTTATAAGCAGAAACCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr