ID: 999036035

View in Genome Browser
Species Human (GRCh38)
Location 5:148350826-148350848
Sequence ACTACTATGCAGAAGCAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999036035_999036038 18 Left 999036035 5:148350826-148350848 CCATACTGCTTCTGCATAGTAGT No data
Right 999036038 5:148350867-148350889 GAAATAAAAAAAGAAAGGAGAGG No data
999036035_999036037 13 Left 999036035 5:148350826-148350848 CCATACTGCTTCTGCATAGTAGT No data
Right 999036037 5:148350862-148350884 GCTGAGAAATAAAAAAAGAAAGG No data
999036035_999036039 23 Left 999036035 5:148350826-148350848 CCATACTGCTTCTGCATAGTAGT No data
Right 999036039 5:148350872-148350894 AAAAAAAGAAAGGAGAGGAGAGG No data
999036035_999036040 24 Left 999036035 5:148350826-148350848 CCATACTGCTTCTGCATAGTAGT No data
Right 999036040 5:148350873-148350895 AAAAAAGAAAGGAGAGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999036035 Original CRISPR ACTACTATGCAGAAGCAGTA TGG (reversed) Intergenic
No off target data available for this crispr