ID: 999036039

View in Genome Browser
Species Human (GRCh38)
Location 5:148350872-148350894
Sequence AAAAAAAGAAAGGAGAGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999036035_999036039 23 Left 999036035 5:148350826-148350848 CCATACTGCTTCTGCATAGTAGT No data
Right 999036039 5:148350872-148350894 AAAAAAAGAAAGGAGAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999036039 Original CRISPR AAAAAAAGAAAGGAGAGGAG AGG Intergenic
No off target data available for this crispr