ID: 999036904

View in Genome Browser
Species Human (GRCh38)
Location 5:148361669-148361691
Sequence TTAAATCATCTCTACAAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999036904_999036906 -10 Left 999036904 5:148361669-148361691 CCTAGCTTGTAGAGATGATTTAA No data
Right 999036906 5:148361682-148361704 GATGATTTAAAATATACAGGAGG 0: 21
1: 220
2: 545
3: 900
4: 1130
999036904_999036907 1 Left 999036904 5:148361669-148361691 CCTAGCTTGTAGAGATGATTTAA No data
Right 999036907 5:148361693-148361715 ATATACAGGAGGATATGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999036904 Original CRISPR TTAAATCATCTCTACAAGCT AGG (reversed) Intergenic
No off target data available for this crispr