ID: 999036907

View in Genome Browser
Species Human (GRCh38)
Location 5:148361693-148361715
Sequence ATATACAGGAGGATATGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999036904_999036907 1 Left 999036904 5:148361669-148361691 CCTAGCTTGTAGAGATGATTTAA No data
Right 999036907 5:148361693-148361715 ATATACAGGAGGATATGTGAAGG No data
999036902_999036907 16 Left 999036902 5:148361654-148361676 CCCATGAAGTTCAAACCTAGCTT No data
Right 999036907 5:148361693-148361715 ATATACAGGAGGATATGTGAAGG No data
999036903_999036907 15 Left 999036903 5:148361655-148361677 CCATGAAGTTCAAACCTAGCTTG No data
Right 999036907 5:148361693-148361715 ATATACAGGAGGATATGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999036907 Original CRISPR ATATACAGGAGGATATGTGA AGG Intergenic
No off target data available for this crispr