ID: 999037878

View in Genome Browser
Species Human (GRCh38)
Location 5:148373844-148373866
Sequence CACAATGACTGTCCTGCATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999037873_999037878 22 Left 999037873 5:148373799-148373821 CCATAAAGGGTATTTAAAGTATG No data
Right 999037878 5:148373844-148373866 CACAATGACTGTCCTGCATAGGG No data
999037872_999037878 23 Left 999037872 5:148373798-148373820 CCCATAAAGGGTATTTAAAGTAT No data
Right 999037878 5:148373844-148373866 CACAATGACTGTCCTGCATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999037878 Original CRISPR CACAATGACTGTCCTGCATA GGG Intergenic
No off target data available for this crispr