ID: 999040841

View in Genome Browser
Species Human (GRCh38)
Location 5:148410098-148410120
Sequence TTTTCAATGGAGGAAGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 369}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999040835_999040841 18 Left 999040835 5:148410057-148410079 CCTTACACTTTGCAGATACTCCT 0: 1
1: 0
2: 0
3: 6
4: 154
Right 999040841 5:148410098-148410120 TTTTCAATGGAGGAAGTGGGAGG 0: 1
1: 0
2: 1
3: 27
4: 369
999040836_999040841 -2 Left 999040836 5:148410077-148410099 CCTTTGAAGAAAATATTTTTTTT 0: 1
1: 1
2: 28
3: 329
4: 2534
Right 999040841 5:148410098-148410120 TTTTCAATGGAGGAAGTGGGAGG 0: 1
1: 0
2: 1
3: 27
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999040841 Original CRISPR TTTTCAATGGAGGAAGTGGG AGG Intronic
902600080 1:17534969-17534991 TTTTCCATGGATGGGGTGGGGGG + Intergenic
902895718 1:19478683-19478705 GGTTAAATGGAGGAAGCGGGTGG - Intronic
903734617 1:25522322-25522344 TTCTCCAAGGAGAAAGTGGGTGG - Intergenic
904035599 1:27557068-27557090 TGTTCCAGGGAGGAAGGGGGTGG - Intronic
904517140 1:31065401-31065423 TTATCAAAGGAGGGAGGGGGTGG - Intronic
905924729 1:41741385-41741407 CTTTCCATGGTGGGAGTGGGAGG + Intronic
905978844 1:42204277-42204299 TTTTCAATCAAGGAGGTGGGTGG + Intronic
906863892 1:49394572-49394594 CTTTCTCTGGAGGAAGAGGGGGG - Intronic
907589457 1:55652286-55652308 TTTTTAAAGGAGGAAGGGGTAGG + Intergenic
908526829 1:64995984-64996006 CTTTCAATGGCCGAAATGGGTGG - Intergenic
909129863 1:71721335-71721357 TTTTTAATGGAAGATGTGGTTGG + Intronic
909167721 1:72249725-72249747 TTTTGAAAGGAGAAAGAGGGAGG + Intronic
910650047 1:89556884-89556906 TTTTCCATGGAGGAAGGTGTGGG - Intronic
911046954 1:93636704-93636726 TTTTTAAGGGAGGAAGTGATTGG - Intronic
911289845 1:96044083-96044105 TTTCCAATGGATGATGTGAGGGG + Intergenic
911330995 1:96525689-96525711 TTTCCAGTGAAGGAAGTAGGAGG - Intergenic
913134767 1:115877695-115877717 TGTGCACTGGGGGAAGTGGGTGG + Intergenic
915181392 1:154064068-154064090 TTTTTAATAGAGGTGGTGGGGGG + Intronic
915369426 1:155335899-155335921 TTTTCATTGCAGGGAGTGGGTGG - Intronic
916664886 1:166957731-166957753 TTTTGAATCTAGGAAATGGGAGG - Intronic
917642757 1:176998711-176998733 ATTTCAAAGGAGGATGTGAGAGG + Intronic
919359615 1:196575688-196575710 GTTTAAATTGAGGAAGAGGGCGG + Intronic
920377257 1:205515847-205515869 TTTGGAATGCAGGAAGTAGGCGG - Intronic
920680384 1:208068033-208068055 TGTTCATAGAAGGAAGTGGGAGG - Intronic
920787127 1:209051972-209051994 GTTGCATTGGAGGTAGTGGGTGG - Intergenic
922303268 1:224322034-224322056 ATTTCAATGGAGTGAGTGGCGGG + Intronic
922743451 1:228029745-228029767 ATTTCAATGTAGGAATTGGGGGG - Intronic
924365630 1:243290421-243290443 TTTTCTATGGAGAAATTGGAGGG - Intronic
1064241306 10:13632007-13632029 TTTCCAAATGAGGGAGTGGGAGG - Intronic
1065074916 10:22067735-22067757 TTTTGAAATCAGGAAGTGGGAGG + Intergenic
1066177653 10:32926238-32926260 TTTTCAATGTAGGAATTTTGGGG - Intronic
1066441280 10:35441461-35441483 TTTTCAATGGAAAAAGCGGTAGG + Intronic
1068571310 10:58632478-58632500 TTTACAATGGAGGAAACGGAGGG + Intronic
1070330413 10:75412639-75412661 TTTTCAAATGAGGAAGGTGGAGG - Intergenic
1070519507 10:77239647-77239669 TTTTCAAAGTAGGAAGTAGATGG - Intronic
1070556602 10:77532661-77532683 GTTTCCATGGGGGAAGAGGGTGG + Intronic
1070751378 10:78965841-78965863 TATAAAATGGAGGTAGTGGGAGG + Intergenic
1070959362 10:80488037-80488059 TTCTCACTGGCGGATGTGGGTGG + Intronic
1071370533 10:84946746-84946768 CTTTTAATAGAGGAAGAGGGAGG - Intergenic
1071434542 10:85635059-85635081 TTCTTATTAGAGGAAGTGGGAGG - Intronic
1073107151 10:101038733-101038755 TTGTCCATGGTGGATGTGGGTGG + Intronic
1074159386 10:110824555-110824577 TTTTCAATGGTGGAAGTGTTGGG + Intronic
1074548431 10:114420423-114420445 TTTTAAATGGATGAACTGTGTGG - Intergenic
1074859037 10:117496285-117496307 ATTTCCATGGAGGAAGAGTGAGG - Intergenic
1074960396 10:118439968-118439990 TTAAAAATGGAGGAAGTGAGAGG - Intergenic
1075581328 10:123620673-123620695 ATATCAATGGAGGAAGTGGATGG - Intergenic
1078303804 11:10161687-10161709 TTTTAAAAGGAGGAAGAGGGTGG + Intronic
1079625537 11:22612516-22612538 TTTTCTATGGATGGGGTGGGTGG + Intergenic
1080596297 11:33776972-33776994 TTTGCAAGGTAGGAAGTGGCAGG - Intergenic
1081122435 11:39284083-39284105 TTTTCACTGGTGGAACAGGGAGG - Intergenic
1081953805 11:47071078-47071100 TTTTGAATGGAGGCAGGGGAGGG - Intronic
1082965796 11:58965008-58965030 TGTACAATGGAAGAAGTGGCAGG - Intronic
1084945402 11:72635676-72635698 TTGTAAAAGGAGGAAGTTGGGGG - Intronic
1086489883 11:87348612-87348634 TTTTCCATGGAGGGAGTTGCGGG - Intergenic
1086846083 11:91751360-91751382 TTTTGAGAGAAGGAAGTGGGAGG - Intergenic
1088235802 11:107721418-107721440 TTGTCCATAGAGGAAGTGGCAGG - Intergenic
1088302408 11:108373520-108373542 TTTAAAAAGGAAGAAGTGGGAGG + Intronic
1088452131 11:109993659-109993681 TTTTGAATTGAGCAAGTGGAAGG - Intergenic
1089370581 11:117953145-117953167 TTTTCAAGAGAGGAAGTAGGTGG - Intergenic
1089750246 11:120646467-120646489 TTGTGAGTGGAGGGAGTGGGGGG + Intronic
1090310715 11:125735325-125735347 TTTTCAATAAAAGAAGTGGAAGG + Intergenic
1090599250 11:128353406-128353428 TTATTCATGGAGGAAGTGGAAGG - Intergenic
1091016724 11:132058234-132058256 ATTCTGATGGAGGAAGTGGGCGG + Intronic
1091336906 11:134777733-134777755 TTTTCAAGTCAGGAAGTGTGAGG - Intergenic
1091643983 12:2259562-2259584 TTTTGACAGGAGGAAGTGGTTGG + Intronic
1092315239 12:7405422-7405444 TTTTGAATGGTGAAAGTGGTTGG + Intronic
1092857465 12:12688158-12688180 TTTTCAGTGAAGAGAGTGGGAGG + Intronic
1093168764 12:15835730-15835752 TTTTCCATGGATGGAGTTGGGGG - Intronic
1093793104 12:23278200-23278222 TTTTCCATGGATTGAGTGGGAGG + Intergenic
1094142223 12:27192964-27192986 TTTTCAGTAGTGGAAGTGAGAGG - Intergenic
1094181497 12:27596967-27596989 TCTTCCAGGGAGGAGGTGGGTGG - Intronic
1096140845 12:49241386-49241408 TTTCCATTGGAGGAACTGGCAGG + Intronic
1096183063 12:49561303-49561325 TTGTCAACTGAGGAAGTGAGGGG + Intronic
1098563928 12:71909734-71909756 GTTTCAGTGTAGGCAGTGGGGGG - Intronic
1101345827 12:103885258-103885280 TTTTCCATGGTGGGAGGGGGAGG + Intergenic
1101917981 12:108911106-108911128 TTTTCAAAGGAAGCAGTGGGAGG - Exonic
1102435123 12:112916804-112916826 TTGGAAATGGAGGAGGTGGGAGG + Intronic
1103673247 12:122635569-122635591 TTTTCCCTGGAGGATGTGGTTGG + Intergenic
1106658333 13:31771483-31771505 TTTTCTATGGATGGAGAGGGGGG - Intronic
1107719160 13:43229814-43229836 TTTTCACTTGAGCAACTGGGTGG + Intronic
1108238633 13:48436912-48436934 TTAACAATAGAGGAAGTGGAAGG - Intronic
1108785152 13:53891473-53891495 TTTTCAATTTAAGAAGTGGCTGG + Intergenic
1109068567 13:57734063-57734085 CTTTCAAGGGAGGAAATGAGAGG + Intergenic
1109935984 13:69284946-69284968 TTTTCAAGGGAAGAAGAGGAAGG + Intergenic
1110358160 13:74593102-74593124 TTTTAAATGGAGGAATGGTGAGG - Intergenic
1111558571 13:89913265-89913287 TTGTCTTTGGTGGAAGTGGGGGG + Intergenic
1111993282 13:95137968-95137990 TTTTCTTTGGGGAAAGTGGGCGG + Intronic
1112858843 13:103805860-103805882 CTTTTAATCAAGGAAGTGGGTGG + Intergenic
1114526484 14:23369949-23369971 TCTTCAATTGTAGAAGTGGGTGG - Intergenic
1115728011 14:36238453-36238475 TTTTCAAAAGACAAAGTGGGGGG - Intergenic
1117269268 14:54125070-54125092 TTTTCATTGGTGGGAGTGGAAGG - Intergenic
1117793132 14:59362030-59362052 TTTTTAATGTAGGGAGTAGGGGG + Intronic
1118014757 14:61648547-61648569 ACTTCACTGAAGGAAGTGGGAGG + Intronic
1118159027 14:63270500-63270522 TTTTCATTGGAGCACATGGGGGG - Intronic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1119710111 14:76815541-76815563 TATGTAATGGAGCAAGTGGGAGG + Intronic
1120330522 14:83087434-83087456 TTTTCACTGGAGTGAGAGGGAGG + Intergenic
1121927453 14:97941304-97941326 TTTTGCATGGAGGAAGGGGAAGG + Intronic
1123055246 14:105566380-105566402 TTTGCATTGGGGGAGGTGGGGGG - Intergenic
1123079695 14:105686224-105686246 TTTGCATTGGGGGAGGTGGGGGG - Intergenic
1125298761 15:38232006-38232028 TTTTCAAGGAAGGAAATGTGTGG + Intergenic
1125459892 15:39895664-39895686 TTTTTAATGGATGATGAGGGTGG + Intronic
1125526135 15:40376224-40376246 TTTTGAAAGGCTGAAGTGGGAGG + Intergenic
1126511232 15:49477117-49477139 TTTATAATGGAGGAACTGTGGGG - Intronic
1126699165 15:51352385-51352407 GTTTCAATGTAGGAATTTGGGGG + Intronic
1126815795 15:52452120-52452142 TTTTCAGTGGGGGGAGGGGGTGG - Intronic
1127589902 15:60412486-60412508 TTTTTAATGGGGGGGGTGGGTGG - Intergenic
1128556347 15:68634494-68634516 TTTCTGATGGAGGAACTGGGAGG + Intronic
1128909602 15:71500891-71500913 TTTTGAATCCAGGAAGTGTGAGG + Intronic
1129265490 15:74391161-74391183 TTTAGAAAAGAGGAAGTGGGTGG + Intergenic
1129386336 15:75198200-75198222 TTTTCTCTGGAGGTAGTGGGGGG + Intronic
1130527646 15:84721124-84721146 TTCTCAATGTAGGAAGTGGTGGG + Intergenic
1130731598 15:86499112-86499134 TTTTAAATGGAGGGAGTAGAGGG + Intronic
1131376670 15:91930140-91930162 TTTTAAATGCAGGAAGAGAGAGG - Intronic
1131602235 15:93861271-93861293 TTTTCACTGGACAAAATGGGAGG + Intergenic
1132071670 15:98783104-98783126 TTTTTAATGGGGGCAGGGGGAGG - Intronic
1133378241 16:5307377-5307399 TTTTAAATGGAGGGAGGGAGGGG - Intergenic
1133565270 16:6987312-6987334 TTTTCAAAGGAGGAAGTGAGTGG + Intronic
1133710118 16:8393259-8393281 TTTGCTATGGAGGAAGGGGAAGG - Intergenic
1133932311 16:10242435-10242457 TTCTCAATGGAGGAACCAGGGGG - Intergenic
1135247931 16:20873301-20873323 TTTTCCTTGGAGGGAGTGTGAGG - Intronic
1137643617 16:50055540-50055562 TCTTTAATGAAGGAACTGGGAGG + Intergenic
1138394054 16:56690910-56690932 TCTTCTATGCAGGGAGTGGGAGG + Intronic
1140184428 16:72754653-72754675 TTTAGAATAGAGGAAATGGGAGG + Intergenic
1141287668 16:82687649-82687671 ATGTCATGGGAGGAAGTGGGTGG - Intronic
1142133189 16:88440198-88440220 TTTTTAATGGGGGTATTGGGTGG + Exonic
1143143538 17:4757646-4757668 ATTTCCATAGAGGAAGTGGTTGG - Intergenic
1144060575 17:11580455-11580477 CTTTCTCTGGAGGAAGGGGGTGG + Intergenic
1144477621 17:15602322-15602344 AAATCAATGGAGGAAGTGGCAGG + Intronic
1146570828 17:33951082-33951104 TTTACAATGGAGAAAATGGATGG - Intronic
1147180384 17:38681089-38681111 TTTTTAAGTGAGGAAGTGGGTGG - Intergenic
1147837418 17:43344337-43344359 TATTCAAGGGAGGAAGTTTGAGG - Intergenic
1148443615 17:47724833-47724855 TCTTCAGTAGAGGAGGTGGGAGG + Intergenic
1149183678 17:53972183-53972205 TTATCAATGGAGGGAGTAAGAGG + Intergenic
1151169051 17:72231090-72231112 TCTTCTTTTGAGGAAGTGGGTGG + Intergenic
1151469327 17:74308220-74308242 ATTGCAATGGAGGAAGGGAGAGG + Intronic
1151502522 17:74500492-74500514 TTTTCACTTGAGCAATTGGGAGG + Intergenic
1152422757 17:80202952-80202974 TTTTCAATGGAGCAAGGCAGGGG - Intronic
1153368798 18:4289577-4289599 TTTTCAATGGAGGTGGTAGGAGG + Intronic
1154488219 18:14896075-14896097 TTTATAATGGAGGAACTGTGGGG + Intergenic
1155510977 18:26576616-26576638 TTTCCTCTGGAGGAAGGGGGTGG - Intronic
1155944636 18:31834514-31834536 TTTTCACTGGATGCAGTGGTGGG - Intronic
1156437206 18:37144989-37145011 TTTTCAAAGGCTGAGGTGGGTGG + Intronic
1156782396 18:40866431-40866453 TGGGCACTGGAGGAAGTGGGCGG + Intergenic
1157032373 18:43927666-43927688 TTAACAATGGAGGATGTGGTGGG - Intergenic
1157622484 18:49024451-49024473 ACTTCAGTGGAGGAACTGGGGGG - Intergenic
1158983335 18:62787478-62787500 TTTTGAAGGGAGGAACTGAGGGG + Intronic
1159390311 18:67784491-67784513 TGTTCATTGGAGGAAGAGGTGGG - Intergenic
1159424901 18:68272411-68272433 TTTTCTATGTGGGAGGTGGGGGG + Intergenic
1160146267 18:76367541-76367563 ATTCCACTGGAGGAACTGGGTGG - Intronic
1161285270 19:3465135-3465157 TTTTTTAAAGAGGAAGTGGGGGG - Intronic
1162006131 19:7780734-7780756 TTTTCAATTGAAGCTGTGGGTGG - Intergenic
1165014620 19:32871468-32871490 TATTCAAGGGAGGGAGAGGGTGG - Intergenic
1165152431 19:33768910-33768932 CTTTCAAAGGAGGAAGTTGCAGG + Intronic
1167381510 19:49140961-49140983 TTTTAAACAGAGGAAGAGGGTGG + Intronic
1167670636 19:50851309-50851331 ATTTCAAAGGAGGAAGAGGCTGG + Intergenic
925438491 2:3863176-3863198 TTTTCCATGGACCAACTGGGGGG - Intergenic
926438730 2:12864186-12864208 CTTTCTATGCAGCAAGTGGGAGG + Intergenic
927403766 2:22744438-22744460 ATCTCAATGGATGAAGTAGGTGG + Intergenic
927450215 2:23202851-23202873 GTTTCAATGTATGAATTGGGGGG + Intergenic
927510000 2:23638563-23638585 TGTCCTATGGAGGAAGTGTGGGG - Intronic
927740679 2:25566780-25566802 ATTTCAATGGAGACAGGGGGTGG + Intronic
928477956 2:31650585-31650607 TTTTATATGGTGGAAGTGAGAGG - Intergenic
930317595 2:49816560-49816582 TTTTCCATGGATGAAGGTGGTGG + Intergenic
931739027 2:65225570-65225592 TTTTCAATGAATGATGTGGGAGG - Intergenic
932083277 2:68734732-68734754 CTTGCATTTGAGGAAGTGGGTGG - Intronic
932293982 2:70609189-70609211 TGTTCAAGGCAGGAAGTGGAAGG - Intronic
932321995 2:70829209-70829231 TCACCAATGGAGGAAATGGGAGG - Intergenic
932802961 2:74758858-74758880 TCTTCAATGGAGGAATAGGTAGG - Intergenic
935473065 2:103482808-103482830 TTTTAAAGGGAGCAAGTGAGTGG + Intergenic
936521527 2:113214837-113214859 TTTTGGGTGGTGGAAGTGGGAGG + Intergenic
937761734 2:125612520-125612542 TTCTCCATGGAGGAAGTGCTAGG + Intergenic
937907670 2:127060304-127060326 TTAGCAATGGAGGACGTGGCTGG - Intronic
940664211 2:156587570-156587592 CTTTCAGTAGAGGAGGTGGGAGG + Intronic
942158623 2:173158330-173158352 TTTTAAAGGGAGAAAGGGGGAGG + Intronic
944096100 2:195969451-195969473 TTTTCATTAGAGGAAGCTGGAGG - Intronic
945685409 2:212963001-212963023 TTTTCAATGGTGTAAATGAGAGG - Intergenic
946637092 2:221741570-221741592 TTCTTAATGGAGGAAGTGTAAGG + Intergenic
947794369 2:232884952-232884974 GTTTACATGGAGGATGTGGGGGG - Intronic
948680570 2:239631548-239631570 TTTCCAAAGGAGGAAGTTGATGG + Intergenic
1168866669 20:1092553-1092575 TGTTCAAGGTAGGAAGAGGGAGG + Intergenic
1169353161 20:4886293-4886315 TTTTAAAGGGAGGAGGAGGGAGG - Intronic
1169875629 20:10294172-10294194 TTTTAGAAGGGGGAAGTGGGAGG - Intronic
1169895589 20:10502213-10502235 ATTTCTGTGTAGGAAGTGGGAGG + Intronic
1170385218 20:15809139-15809161 TTTTAAAAGGTAGAAGTGGGAGG - Intronic
1170561063 20:17558936-17558958 TTTTCCATGCTGGAAGTGGAAGG - Intronic
1171202781 20:23255315-23255337 TTTACAAAGGAGGAACCGGGCGG + Intergenic
1171283224 20:23918550-23918572 GTTTAATTGCAGGAAGTGGGGGG + Intergenic
1172901843 20:38340883-38340905 TTTTCAAAGGAGGAAATAGAGGG - Intergenic
1173582750 20:44159214-44159236 TAGTCAATGAAGGAATTGGGTGG + Intronic
1173748661 20:45458384-45458406 TTTTCTTTGCAGGATGTGGGCGG - Intergenic
1173948703 20:46973028-46973050 TTTATAATGGAGGAAGCAGGTGG + Intronic
1174479033 20:50818063-50818085 CTTTCAAAGGAGGCAGTGGAAGG + Intronic
1174561964 20:51437569-51437591 TTTTTCATGGGGGAGGTGGGTGG - Intronic
1175234616 20:57501480-57501502 TTTTTAATGGAGGAAGGGGCTGG - Intronic
1176728532 21:10465763-10465785 TTTTCTAGGGAGGAGGTGGAGGG + Intergenic
1177779787 21:25609703-25609725 TTTTCAATGGAGAAATCTGGTGG + Intergenic
1178124902 21:29505805-29505827 TTTTCAATGGTTGAATTTGGTGG + Intronic
1178620478 21:34169755-34169777 TTTTCAGAGGCCGAAGTGGGTGG - Intergenic
1179067459 21:38039366-38039388 ATTTCAACGCAGGAACTGGGGGG - Intronic
1180699795 22:17774986-17775008 TTTTTAGTGGAGGTGGTGGGGGG + Intergenic
1180703675 22:17795815-17795837 TTTTCAAAAGAAGAAGTGGAAGG + Intronic
1180822625 22:18841460-18841482 TTTCCAATGGAGGGGGTGGAGGG - Intergenic
1181190338 22:21134567-21134589 TTTCCAATGGAGGGGGTGGAGGG + Intergenic
1181208864 22:21275956-21275978 TTTCCAATGGAGGGGGTGGAGGG - Intergenic
1181503035 22:23330240-23330262 TTTCCAATGGAGGGGGTGGAGGG + Intergenic
1181612868 22:24030712-24030734 TTCTTTATGGAGGAGGTGGGAGG + Intronic
1181653840 22:24278616-24278638 TTTCCAATGGAGGGGGTGGAGGG + Intronic
1182074987 22:27489339-27489361 TTGCCATTGGAGGAAGCGGGGGG + Intergenic
1184637459 22:45845329-45845351 TTTTCTAAGTAGGAAGTGTGGGG + Intergenic
1184713842 22:46269049-46269071 TTTGTACTGGAGGACGTGGGAGG + Intronic
1185381780 22:50512027-50512049 CTTTCAAAGGATGAGGTGGGCGG - Intronic
1203218075 22_KI270731v1_random:19490-19512 TTTCCAATGGAGGGGGTGGAGGG + Intergenic
1203272763 22_KI270734v1_random:67365-67387 TTTCCAATGGAGGGGGTGGAGGG - Intergenic
949269757 3:2200975-2200997 TTTTAAAAGGAAGTAGTGGGTGG + Intronic
949398083 3:3636360-3636382 TTTTCAATGCAGGTAGTCAGGGG - Intergenic
949642566 3:6054579-6054601 TCTTCAATGTTGGAAGTGGAGGG - Intergenic
949871737 3:8595107-8595129 TTTTCAATGGAAGGAGGGGAAGG + Intergenic
951840558 3:27029325-27029347 TTGTCAATGGAGGGAGAGGTTGG + Intergenic
952053435 3:29414321-29414343 ATGTTAATGGAGAAAGTGGGTGG - Intronic
952327532 3:32334868-32334890 TTTTCAACTGAGGCAGTGGAGGG - Intronic
953007846 3:38994714-38994736 GTTTCTATGGACGAAGTGGGAGG + Intergenic
954716701 3:52530389-52530411 TGTACAATGGAGAAAGTGGAAGG + Intronic
954995444 3:54877079-54877101 TTTTCAATGTGGGGAGTTGGAGG + Intronic
956101757 3:65775695-65775717 TTTTCAGAGGCGGAGGTGGGCGG + Intronic
956101779 3:65775831-65775853 TATGCAATGGCTGAAGTGGGAGG + Intronic
956826346 3:73000532-73000554 TTTACAATGGAGGAGGTTGTAGG + Intronic
957231222 3:77518196-77518218 TTGTCACAGGAGCAAGTGGGAGG + Intronic
958753082 3:98216070-98216092 TGTTGAAGGGAAGAAGTGGGAGG - Intergenic
958859506 3:99429126-99429148 TTTACAAAGGAGGAAATGAGAGG + Intergenic
959047016 3:101485361-101485383 TTTCCAGTGGAGGTAGTGGCGGG - Intronic
960597118 3:119416230-119416252 TTCTGGATGGAAGAAGTGGGAGG + Exonic
962309776 3:134317204-134317226 TTTCTCATGGAGGAAGTGAGAGG - Intergenic
962585036 3:136833507-136833529 TTTTCCATGGAAGGAGTCGGCGG + Intronic
962860295 3:139393401-139393423 TGTTGAATTGAGGGAGTGGGAGG + Intergenic
963137380 3:141919358-141919380 TTTTCAAAGGCGGAGGTGGGTGG - Intronic
963433345 3:145236998-145237020 TTTTACATGTAGGAAGTGTGAGG - Intergenic
963751877 3:149188721-149188743 TTTCCACTGGGAGAAGTGGGAGG - Intronic
964407934 3:156369064-156369086 TCTTCTAGGGAGGCAGTGGGTGG - Intronic
964626511 3:158764945-158764967 TTTTCCATGTAAGAAGTGGTTGG - Intronic
964866438 3:161267344-161267366 TTTTCAATGGTGTAGGTGGCGGG + Intergenic
966038140 3:175446052-175446074 ATTTCAATGGAGGATGTTGTGGG + Intronic
966443312 3:179972337-179972359 TTTGCAATGGAGGAAATAGATGG - Intronic
967104184 3:186242220-186242242 TTTGCAGGGGAGGAGGTGGGAGG - Intronic
967527159 3:190508302-190508324 TTTTAAATGGAGAATGAGGGAGG - Intergenic
967718548 3:192790343-192790365 TTCTTAATGGAGGTAGGGGGAGG + Intergenic
968126792 3:196166011-196166033 TTTTCAAAGCAGGAAGAAGGCGG + Intergenic
969632087 4:8344699-8344721 AGGTCAATGGAGGAAGTGAGAGG + Intergenic
970605761 4:17680747-17680769 TTTGCCTGGGAGGAAGTGGGAGG - Intronic
972417486 4:38856165-38856187 TATTAAATGGAGGAAGTGGCCGG - Intronic
973069316 4:45836723-45836745 TTTTCAAAGGCCGAGGTGGGAGG - Intergenic
973229126 4:47821978-47822000 TTTTCAATTGAAGAAGTTAGGGG + Intronic
973565031 4:52176873-52176895 TTTTCAATGCATGAATTTGGGGG + Intergenic
976728250 4:88237127-88237149 TGTTCAATGATGAAAGTGGGGGG + Intergenic
977286611 4:95115759-95115781 TTTTCAATGGAGGCAGTGTAGGG - Exonic
979839358 4:125418914-125418936 TTTTAAATGGAGCAAGTAGCAGG + Intronic
979906990 4:126306608-126306630 GTTTCAAGGGAGTAAGTGGAGGG - Intergenic
980843149 4:138291191-138291213 CTTTCAATGGGAGAAGGGGGAGG - Intergenic
981472709 4:145154827-145154849 TGTTCAATGGTGGTGGTGGGGGG + Intronic
981716613 4:147758376-147758398 TTTTAAATGGATGAACTGTGTGG - Intronic
982002677 4:151035600-151035622 TTTCTGATGGGGGAAGTGGGAGG + Intergenic
982718103 4:158830104-158830126 TTATAAATGAAGGAGGTGGGTGG + Intronic
985365391 4:189226559-189226581 TATTCAATGCTGGAAGTGGGAGG - Intergenic
986064207 5:4219939-4219961 ATTTCAATGTAGGAATTTGGGGG + Intergenic
986324786 5:6664134-6664156 TTTTGAGTGGATGAAGTGGGTGG - Intronic
987505982 5:18772805-18772827 TTTTCAAAGGAAAAAGTGAGTGG - Intergenic
988224669 5:28397876-28397898 TTTTAAAGGGAGAACGTGGGAGG + Intergenic
989338375 5:40346782-40346804 TTTTCAATGAAAGTAGAGGGAGG - Intergenic
989800063 5:45526504-45526526 TTTTGAATAGAGGAAGTAGTGGG - Intronic
990052223 5:51517834-51517856 TTTTCAATGGACAAAGTGGTTGG + Intergenic
990232348 5:53727191-53727213 CTTTCAGTGTTGGAAGTGGGAGG + Intergenic
990624944 5:57600188-57600210 TTGTCTGTGGAGGAAGTTGGAGG - Intergenic
990800732 5:59599742-59599764 TGTGCAGTGGAGTAAGTGGGTGG + Intronic
990988971 5:61666472-61666494 TTTTCAGCTGAGGAAGTGGGTGG + Intronic
991482666 5:67099845-67099867 TTTTCTTTGGAGGGAGTAGGGGG - Intronic
991512923 5:67399682-67399704 ATTTCAATGGTGGAGGGGGGGGG + Intergenic
992168240 5:74076174-74076196 CTTTTAATGCAGGAGGTGGGGGG - Intergenic
992657654 5:78926501-78926523 CTTTCAATGGAGTCACTGGGAGG + Intronic
993125422 5:83829509-83829531 TTTTCAAGGGATGGAGTAGGTGG + Intergenic
993983593 5:94570638-94570660 TTTTCGATTGAGGAGGTGGCTGG - Intronic
994065575 5:95536558-95536580 TTTTTAATGGTGGAAATTGGAGG - Intronic
994626764 5:102229890-102229912 TTGAAGATGGAGGAAGTGGGGGG + Intergenic
995880000 5:116833886-116833908 TTTTAAAAGGAAGAAGAGGGAGG - Intergenic
995909338 5:117167028-117167050 TTTTTATTTGAGCAAGTGGGAGG - Intergenic
996405162 5:123096873-123096895 TTGTCTATGGAGGTAGTGGCTGG + Intronic
997825386 5:137102134-137102156 TTTTCAGCAGAAGAAGTGGGAGG - Intronic
998201040 5:140121456-140121478 TTTTAAATGCAGGTAGTTGGTGG + Exonic
998472859 5:142396868-142396890 TTTGCAATGCAGAAAGGGGGTGG + Intergenic
999040841 5:148410098-148410120 TTTTCAATGGAGGAAGTGGGAGG + Intronic
999115698 5:149161362-149161384 TTGGCCATGGAGGAAGTAGGTGG - Intronic
999338051 5:150741054-150741076 TTTTAAATGGCTGAGGTGGGAGG + Intronic
999949041 5:156628763-156628785 TTTGGTAGGGAGGAAGTGGGAGG + Intronic
1000029184 5:157387334-157387356 TTTTCATTGGCTGTAGTGGGTGG + Intronic
1000414417 5:160968274-160968296 CTTTCAATGGAGGAAGGGGTAGG - Intergenic
1002092768 5:176814574-176814596 TTTGCAGGGGAGGAGGTGGGAGG - Intronic
1003390071 6:5706046-5706068 TTTTCCATGGATGGGGTGGGTGG + Intronic
1003669748 6:8145774-8145796 TCTTCAATGGAGGAAGAGATGGG - Intergenic
1003740468 6:8932115-8932137 TTATCCATAGAGGAAGTAGGAGG + Intergenic
1003848511 6:10198383-10198405 TTTCAAATGGAGAAAGTGGGTGG - Intronic
1004260926 6:14107071-14107093 TTTGCAATGGAGGCATTTGGTGG + Intergenic
1006166209 6:32067198-32067220 ATTCTAGTGGAGGAAGTGGGTGG + Intronic
1006860420 6:37168957-37168979 TTTCCAAGGGAGGCAGAGGGTGG + Intergenic
1007182540 6:39940599-39940621 TTTTCCATGGGGGCAGTGGTGGG + Intergenic
1007234423 6:40380023-40380045 CCTTCAAAGGGGGAAGTGGGAGG - Intergenic
1007810849 6:44484762-44484784 TTTTTAAGGGGTGAAGTGGGGGG + Intergenic
1008022317 6:46593861-46593883 TTTTCTATGGACAAAGTAGGAGG - Intronic
1008824990 6:55683238-55683260 TTTTCTGTGGATGAAGTCGGGGG - Intergenic
1009244780 6:61223343-61223365 TTTTTAATGGAGGATCTGAGAGG - Intergenic
1009423753 6:63491479-63491501 TTTTCCATGGAGGCTTTGGGAGG - Intergenic
1009576645 6:65471285-65471307 TACTCAATGGCTGAAGTGGGAGG + Intronic
1009623457 6:66105422-66105444 ATTTGAATGGCTGAAGTGGGAGG - Intergenic
1010698320 6:79006986-79007008 TTTTAAAAGGAGGAGATGGGAGG + Intronic
1011743923 6:90390763-90390785 GTTTAAATGGAGAAAATGGGTGG - Intergenic
1011797629 6:90974590-90974612 TTTTCAAAGGAGTAAGTAGAGGG + Intergenic
1012741458 6:103020813-103020835 GTTTCCATGGTGGAAGTGGTGGG + Intergenic
1014222106 6:118808022-118808044 TTTTCAATGGAGCAATAAGGAGG + Intergenic
1014431761 6:121379557-121379579 TCTTGAAAGGATGAAGTGGGAGG - Intergenic
1016166118 6:140945632-140945654 TTTTCAAGGGAGGGAGCAGGTGG + Intergenic
1016942676 6:149496430-149496452 TGTTGTATGGAGGAGGTGGGAGG - Intergenic
1017434024 6:154398719-154398741 ATTTCATTGAAGGAAGTGGAAGG + Exonic
1018379147 6:163241707-163241729 TTTTGAATGGAGAAGGTAGGAGG + Intronic
1019016865 6:168886276-168886298 TTATCACTTGAGGAGGTGGGAGG + Intergenic
1019202859 6:170333173-170333195 TTTTCAATACAGGAATTGCGGGG - Intronic
1019258483 7:66522-66544 TCTGCAATGGAGGGAGTGTGTGG - Intergenic
1019596855 7:1862091-1862113 TTCTCTGTGGAGGAAATGGGTGG - Intronic
1019826019 7:3285026-3285048 TTTTTAATGGAGGCAGAGGCTGG - Intergenic
1020408762 7:7867004-7867026 TATTGCATGGAGGAAGTGAGAGG + Intronic
1022321238 7:29289682-29289704 ATTTCAATGTAGGAAGTGCTGGG - Intronic
1022859618 7:34354158-34354180 TTTTGGAGGGTGGAAGTGGGCGG + Intergenic
1022866231 7:34423987-34424009 TTTTCAAAGGAGAAAAAGGGAGG - Intergenic
1022949894 7:35328119-35328141 TTTTCAAAGGAGGCAGAGGAAGG - Intergenic
1025780326 7:64595726-64595748 TTTTTTTTGGGGGAAGTGGGGGG - Intergenic
1027484943 7:78749813-78749835 TTTTCTTTGGAGGAAGTAGCAGG - Intronic
1028440318 7:90852138-90852160 TTTTGAAAGGTGGAGGTGGGAGG - Intronic
1028900429 7:96093300-96093322 TTTACAATTGAGGCAGTGAGAGG + Intronic
1030214266 7:107027870-107027892 GGTTGAATGGAGGAAATGGGAGG + Intergenic
1031556446 7:123182470-123182492 CCTGCAGTGGAGGAAGTGGGTGG - Intronic
1032731507 7:134647618-134647640 TTTGCAAGGGAGGCAGTAGGGGG - Intronic
1033116441 7:138629999-138630021 TTTTAAATAGAGGCATTGGGAGG - Intronic
1033427711 7:141260287-141260309 GTTTCATTGGAGGAAGAGGTGGG + Intronic
1034191907 7:149219554-149219576 TTTTCAATGGAGGTTGGGTGTGG + Intronic
1035689633 8:1551523-1551545 TGTTCCTGGGAGGAAGTGGGTGG - Intronic
1037706117 8:21316540-21316562 TTTTCCTTGTAGGTAGTGGGAGG - Intergenic
1037773135 8:21814763-21814785 TTTTCCATGGAGGAATTCTGAGG + Intergenic
1038141568 8:24850752-24850774 TTTTAAATGGAGGGAGTGAGAGG - Intergenic
1039295816 8:36152619-36152641 TTTTAAATGGATGAATTGTGTGG - Intergenic
1039681335 8:39740263-39740285 TTTTCATGGGAGGAAGGGGAAGG - Intergenic
1040922054 8:52632046-52632068 TCATCAGTAGAGGAAGTGGGTGG - Intronic
1041283719 8:56238406-56238428 TTTTCAATAGAGTAAAAGGGAGG - Intergenic
1041558242 8:59184082-59184104 TTTTTAAAGGAGGGGGTGGGAGG - Intergenic
1042559313 8:70061086-70061108 TTATCAATGGAGGAGGGAGGAGG + Intronic
1042789115 8:72583663-72583685 TTTTCAATGCAGGAGCTGAGGGG - Intronic
1043207913 8:77470908-77470930 TTTTAAATAGAGGGAGTTGGAGG + Intergenic
1043579758 8:81698654-81698676 TTTGCAATGGACTAAGTGGCTGG + Intergenic
1045521447 8:102906355-102906377 ATTCCAATGGAAGAAATGGGAGG + Intronic
1047379807 8:124349414-124349436 TTTTGAATGGAGGTATTAGGTGG + Intronic
1047673138 8:127170851-127170873 TTTTCCATGTAAGAAGTAGGTGG - Intergenic
1049756182 8:144312195-144312217 TTTTCAGGGGTGGAGGTGGGCGG - Exonic
1050113455 9:2240351-2240373 TTGTAAATTGGGGAAGTGGGTGG + Intergenic
1050709006 9:8438504-8438526 CATTCTATGGAGGAAGTGTGAGG + Intronic
1051355708 9:16238123-16238145 TTTTCCATAGAGGAAGAGGGTGG + Intronic
1051766972 9:20535310-20535332 TTTTCCATGGATGGGGTGGGGGG - Intronic
1051850033 9:21495495-21495517 TTTTCAATGGAGTATTAGGGTGG + Intergenic
1053621574 9:39824914-39824936 TTTATAATGGAGGAACTGTGGGG + Intergenic
1053883524 9:42619391-42619413 TTTATAATGGAGGAACTGTGGGG - Intergenic
1053889145 9:42674907-42674929 TTTATAATGGAGGAACTGTGGGG + Intergenic
1054222543 9:62426855-62426877 TTTATAATGGAGGAACTGTGGGG - Intergenic
1054228167 9:62482320-62482342 TTTATAATGGAGGAACTGTGGGG + Intergenic
1055056665 9:72030227-72030249 CTTACAGTGGAGGGAGTGGGAGG + Intergenic
1055554957 9:77464574-77464596 TTTTGAATGGATGAATTGTGTGG - Intronic
1056990970 9:91410576-91410598 TTCTCAGTGAAGGAAGTGTGGGG - Exonic
1057247256 9:93467253-93467275 TATTCAATGGGGGAAAAGGGGGG - Intronic
1057920805 9:99095125-99095147 TCTTCTGTGGAGGAAATGGGAGG - Intergenic
1058779317 9:108317526-108317548 TTTTCCATGGATGAGGTGGTGGG - Intergenic
1058881292 9:109288040-109288062 TTTTCAATGTATGAATTTGGAGG - Intronic
1059110009 9:111548072-111548094 TTTTGAAATGAGGAAGTGTGAGG + Intronic
1059177951 9:112184526-112184548 TTTTTAATGGAGGCCGGGGGTGG - Intergenic
1060431576 9:123555416-123555438 TTTTCTTTGGAGCAATTGGGTGG - Intronic
1062470608 9:136701985-136702007 TTTGCAAAGGTGTAAGTGGGGGG - Intergenic
1185729588 X:2450812-2450834 ATTTCAATGCAGGAATTTGGGGG - Intronic
1185731127 X:2462883-2462905 ATTTCAATGCAGGAATTTGGGGG - Intronic
1188762010 X:34044004-34044026 CTTTCAAGGGAGGCAGAGGGAGG + Intergenic
1189204941 X:39229758-39229780 ATTTTAATGGAGGAAGTTTGGGG + Intergenic
1190151521 X:47954016-47954038 TCTTCAGTGGAGGACGTGGGCGG + Intronic
1191919243 X:66236748-66236770 TTTTTTATGGAGGATGTGGCTGG + Intronic
1192603932 X:72493930-72493952 TTTTGGAAGGATGAAGTGGGAGG - Intronic
1193619394 X:83732693-83732715 TTGTCAGTGGTGGCAGTGGGTGG + Intergenic
1194135369 X:90134139-90134161 TTTTCAAGGGAGAATGAGGGAGG - Intergenic
1194958467 X:100208381-100208403 CTTTCAAGGGAGGAGGAGGGAGG - Intergenic
1196502946 X:116406936-116406958 TTTTCAAAAGTGGAAGAGGGAGG - Intergenic
1196835419 X:119809275-119809297 GTGTCAAGGGAGGAAGTTGGTGG - Intergenic
1199565588 X:149212333-149212355 TTTTCAGATGAGGAAGTGGAGGG + Intergenic
1199754852 X:150854485-150854507 ATTTCAATGTATGAATTGGGAGG - Intronic
1199829847 X:151538614-151538636 TATGCACTGGGGGAAGTGGGTGG - Intergenic
1199830374 X:151543880-151543902 TATGCACTGGGGGAAGTGGGTGG - Intergenic
1200961088 Y:8996815-8996837 TTTTAAATGGAGAAATTGAGAGG - Intergenic
1200986742 Y:9308942-9308964 TTTTCAGAGGATGAGGTGGGTGG + Intergenic
1201277565 Y:12313161-12313183 ATTACAAAGGAGGAAATGGGAGG + Intergenic