ID: 999041869

View in Genome Browser
Species Human (GRCh38)
Location 5:148422801-148422823
Sequence AAACCACTAGGTTTTTATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 203}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999041869_999041874 18 Left 999041869 5:148422801-148422823 CCTGCATAAAAACCTAGTGGTTT 0: 1
1: 0
2: 2
3: 20
4: 203
Right 999041874 5:148422842-148422864 CAATTCTAAGCTTTTTAGCAAGG 0: 1
1: 1
2: 5
3: 28
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999041869 Original CRISPR AAACCACTAGGTTTTTATGC AGG (reversed) Intronic
902905048 1:19550291-19550313 AAACCAGCAAGTTTTTATGAGGG + Intergenic
909082805 1:71134318-71134340 AAACCAGCAGGTTTTTATTAAGG + Intergenic
909506959 1:76403093-76403115 TTACCACTAGCTTTATATGCTGG + Intronic
910638817 1:89438794-89438816 AAACCAGCAGGTTTTTATTAAGG - Intergenic
911030186 1:93479187-93479209 AAACCAGCAGGTTTTTATTAAGG + Intronic
911269094 1:95778679-95778701 TAACCAATAGGTTTTTCTGGTGG + Intergenic
911688434 1:100803648-100803670 AAACCAGCAGGTTTTTATTAAGG - Intergenic
911831357 1:102554427-102554449 AAACCAGCAGATTTTTATGAAGG - Intergenic
912112321 1:106358377-106358399 AAACCAGCAGGTTTTTATTAAGG + Intergenic
915403590 1:155642350-155642372 AAACCAGCAGGTTTTTATTAAGG + Intergenic
915704417 1:157830379-157830401 AAAGCACTAGGTTTTAATGAAGG - Intergenic
916340262 1:163725898-163725920 AATGCAATGGGTTTTTATGCAGG - Intergenic
917381168 1:174410091-174410113 AAACCAGTAGGTTTTTATTAAGG - Intronic
918461788 1:184784219-184784241 AAACCAGCAGGTTTTTATTAAGG - Intergenic
918655551 1:187021617-187021639 AAACCATTATTGTTTTATGCAGG - Intergenic
919947890 1:202334884-202334906 AAAGGACTAGGTTTTAATCCTGG - Intronic
920879596 1:209867466-209867488 AAACCAACAGGTTTTTATTGAGG - Intergenic
923048324 1:230371712-230371734 ACACCACTGGGGATTTATGCAGG + Intronic
923129615 1:231064165-231064187 AACTCACTAGGTTTTTCTGTAGG - Intergenic
1063708585 10:8454946-8454968 AAAGCAGTAGGATATTATGCTGG - Intergenic
1064522948 10:16222730-16222752 AAACCAGCAGGTTTTTATTAAGG + Intergenic
1064983351 10:21185841-21185863 AAACTACTAGAATTTTATGAAGG - Intergenic
1067612001 10:47726740-47726762 AAAGCACTTGGTTTTTATGCAGG - Intergenic
1068097119 10:52505220-52505242 AAACCAGCAGGTTTTTATTTGGG + Intergenic
1069094438 10:64241497-64241519 AAACCAGCAGGTTTTTATTAAGG - Intergenic
1069198463 10:65583363-65583385 AAACCAGCAGGTTTTTATTAAGG - Intergenic
1070456576 10:76623088-76623110 AAACCAATAGGGTTTGAAGCGGG + Intergenic
1071175230 10:82918410-82918432 AAACCACAAGGTTATTTTGAAGG + Intronic
1071599692 10:86952566-86952588 AAACCAGCAGGTTTTTATTAAGG + Intronic
1071627419 10:87186984-87187006 AAAGCACTTGGTTTTTATGCAGG - Intronic
1078630331 11:12997250-12997272 AGAGCACTAGGTTTCTAAGCAGG - Intergenic
1078672100 11:13374810-13374832 AAAGCAGGAGGTTTTTAAGCAGG - Intronic
1079783348 11:24637928-24637950 AAACCAGTAAGTTTTTATTAGGG - Intronic
1082115912 11:48328051-48328073 AAACCAGCAAGTTTTTATTCGGG + Intronic
1082143283 11:48634698-48634720 AAACCAGAAGGTTTTTATTAAGG + Intergenic
1082661570 11:55918524-55918546 AAACAACCAGGTTTTTCTGAAGG - Intergenic
1083092800 11:60218425-60218447 AAACCAGTAAGTTTTTATTAAGG - Intronic
1083470782 11:62882345-62882367 AAAACAGTAGGTTTTTTTGGGGG + Intronic
1086133866 11:83427417-83427439 AAGCCACTAGGTTTTGAGGTGGG - Intergenic
1091680836 12:2525400-2525422 AAAGCACAAGGTGTTTATCCTGG - Intronic
1092328106 12:7555587-7555609 AAACCTGTAGGTATTTAAGCAGG + Intergenic
1099724550 12:86409972-86409994 AAACCAGCAGGTTTTTATTAAGG + Intronic
1099800932 12:87455574-87455596 AAACCAGCAGGTTTTTATTAAGG + Intergenic
1100737543 12:97553746-97553768 AAACTAGTAGGTATTGATGCTGG - Intergenic
1100970609 12:100065910-100065932 AAACCAGCAGGTTTTTATTAAGG - Intronic
1104277884 12:127346639-127346661 AAACCAGCAGGTTTTTATTAAGG + Intergenic
1105244439 13:18636092-18636114 AAACCAGCAGGTTTTTATTAAGG - Intergenic
1105309850 13:19196704-19196726 AATCCAGTAGGTGTTTTTGCGGG - Intergenic
1106685052 13:32049596-32049618 AACCCCATAGGTTTTTAAGCAGG + Intronic
1108086076 13:46795249-46795271 AAAACCCTAGGCTTTCATGCAGG - Intronic
1109081111 13:57902832-57902854 AAACCAGTAAGTTTTTATTAGGG + Intergenic
1109768922 13:66944397-66944419 AAACCACTCAGTTTTTTTGTAGG - Intronic
1109963402 13:69660692-69660714 AAACCAGCAGGTTTTTATCAAGG - Intergenic
1112623920 13:101080810-101080832 AAACCACTACTTTTTTATTGTGG + Intronic
1112852703 13:103726360-103726382 TAATCAATAGGTTTTTATGCTGG - Intergenic
1113842793 13:113369901-113369923 AAACCACCAGGGTTATAGGCCGG - Intergenic
1114855472 14:26435748-26435770 AAAGCAGTAGGTTTTTATGTAGG + Intergenic
1115280177 14:31653000-31653022 AAACCAGCAGGTTTTTATCAAGG + Intronic
1115848631 14:37567923-37567945 AAACAACCAGGCTGTTATGCTGG - Intergenic
1116554682 14:46288132-46288154 AAACCAGCAGGTTTTTATTAAGG + Intergenic
1116725953 14:48561836-48561858 AAACCAGCAGGTTTTTATTAGGG - Intergenic
1120120944 14:80679801-80679823 AAACCAGCAGGTTTTTATTAAGG - Intronic
1121051795 14:90824026-90824048 AAACCAGCAGGTTTTTATTAAGG - Intergenic
1127072262 15:55298407-55298429 AAACCACCAAGTTTTTATTAGGG + Intronic
1131976600 15:97952721-97952743 ATACCATTAGGTTCCTATGCCGG + Intergenic
1133065819 16:3206475-3206497 AAACCAGGAGGTTTTTATTAAGG - Intergenic
1133361607 16:5178295-5178317 AAACCAGCAGGTTTTTATTAAGG + Intergenic
1134463388 16:14449790-14449812 CACCCACTAGGTTTTTAGACTGG + Intronic
1134755183 16:16660699-16660721 AAACCCCTTGATTTTTATGGAGG + Intergenic
1134990881 16:18698474-18698496 AAACCCCTTGATTTTTATGGAGG - Intergenic
1137647736 16:50090623-50090645 AAACCAATAGCTTTTAATGAAGG - Intronic
1137764527 16:50967681-50967703 AGACCACTAGCTTTTCAGGCTGG - Intergenic
1139599451 16:67977836-67977858 AAACAATTAGGTTTTTTTGTGGG + Intronic
1139951687 16:70675447-70675469 AAACCAATAGGTTTTTTGGTGGG - Intronic
1146780649 17:35668578-35668600 AAACCTCCAGGTTTTTATGAAGG + Intronic
1147364127 17:39949344-39949366 AAAAGACTAGGCTTTTAGGCTGG - Intergenic
1149196448 17:54127351-54127373 AAACCAGCAGGTTTTTATTAAGG - Intergenic
1152219750 17:79056694-79056716 TAACCATTAGGTTTTTATTGTGG + Intergenic
1152746369 17:82041680-82041702 AAACCAGCAGGTTTTTATTAAGG + Intergenic
1153992056 18:10409367-10409389 AAAGCACTGGGATTATATGCAGG - Intergenic
1154049476 18:10940422-10940444 AAAACACTAGGATATTCTGCAGG - Intronic
1154444495 18:14423810-14423832 AAACCAGCAGGTTTTTATTAAGG + Intergenic
1155725055 18:29071071-29071093 AAATCACTAGGTATTTAGTCTGG - Intergenic
1157706157 18:49808612-49808634 AAACCAGCAGGTTTTTATTAAGG + Intronic
1158987068 18:62828719-62828741 AAACCACTTGGTATTTATGTTGG + Intronic
1159366422 18:67471201-67471223 AAACCACGAGGTTTTCATTTAGG + Intergenic
1159815747 18:73072113-73072135 AAACCAGCAGGTTTTTATTAAGG - Intergenic
1164288669 19:23847488-23847510 AAACCAGCAGGTTTTTATTAAGG + Intergenic
1164289788 19:23856785-23856807 AAACCAGCAGGTTTTTATTAAGG + Intergenic
1165254909 19:34570620-34570642 AAACCAGCAGGTTTTTATTAAGG - Intergenic
926643116 2:15258890-15258912 AAACCAGCAGGTTTTTATTAAGG - Intronic
927079696 2:19615276-19615298 AAACCAACAGGTTTTTATTAAGG + Intergenic
928242484 2:29598421-29598443 TCACCTCTAGGTTTCTATGCTGG - Intronic
929939508 2:46322233-46322255 CACCCGCTAGGTTCTTATGCTGG + Intronic
930423220 2:51179288-51179310 AAACCAGCAGGTTTTTATTAAGG - Intergenic
932169708 2:69542794-69542816 AGACAACTAGGTTTTAATCCTGG - Intronic
932513131 2:72315768-72315790 AAAGGAATAGGTTTTTATGGGGG + Intronic
935244502 2:101206410-101206432 AAGCCACTGGGCTTTTAAGCAGG + Intronic
940165318 2:150764403-150764425 AAGCCACTAGGGCTTTAAGCAGG - Intergenic
941073971 2:160986738-160986760 AAACCAGCAGGTTTTTATTAAGG + Intergenic
943239843 2:185368463-185368485 CAAGCACTAGGATTTTAGGCAGG - Intergenic
943820750 2:192317000-192317022 AAACCACTAGGTGTTTATTGAGG - Intergenic
945578397 2:211560922-211560944 AAACCACTATGTTATTATTTTGG + Intronic
1170229525 20:14029178-14029200 AAACAACTAAGTTCTTATACAGG + Intronic
1179343555 21:40535053-40535075 AAGTCACTAGGTTTTCATGCTGG + Intronic
1184954714 22:47878219-47878241 AATCCACTGAGATTTTATGCTGG + Intergenic
949514275 3:4793106-4793128 AATCAACTAGGTATTTATCCAGG - Intronic
950231228 3:11277557-11277579 AAACCAGCAGGTTTTTATTAAGG + Intronic
951859539 3:27236639-27236661 AAACCAGCAGGTTTTTATTAAGG + Intronic
951978465 3:28540605-28540627 AAACCAGCAGGTTTTTATTAAGG + Intergenic
952288764 3:31994976-31994998 AAACCAGTAAGTTTTTATTCAGG + Intronic
953324615 3:42002537-42002559 AAATAACTATGTTTGTATGCTGG + Intergenic
953846596 3:46432369-46432391 AAACCAGCAGGTTTTTATTAAGG - Intergenic
956220607 3:66898683-66898705 AAACCAGAAGGTTTTTATTAAGG - Intergenic
956831766 3:73056871-73056893 AAAACATTAGGTTTTAATGTGGG + Intronic
957465935 3:80591032-80591054 AAACCTCTAATTTTTTATGTTGG - Intergenic
957792791 3:84960680-84960702 AAATCACTGGGTTTGGATGCCGG + Intronic
958424426 3:93964732-93964754 AAACCAGCAGGTTTTTATTAAGG - Intronic
958621865 3:96572906-96572928 AAACCAGCAGGTTTTTATTAAGG + Intergenic
958879782 3:99656767-99656789 TAACTACTAGTTTTTTATGCAGG - Intronic
959005210 3:101012149-101012171 AAACCAGCAGGTTTTTATTAAGG + Intergenic
959888020 3:111524969-111524991 AAACCAGCAGGTTTTTATTAAGG - Intronic
959888686 3:111530274-111530296 AAACCAGCAGGTTTTTATTAAGG - Intronic
962366925 3:134793091-134793113 GAGCCACTAGGTTGCTATGCAGG + Intronic
962730185 3:138274860-138274882 AAACCACTATTTATTTATCCTGG - Intronic
963176535 3:142303786-142303808 AAACCAGCACGTTTTTATGAGGG + Intergenic
963414921 3:144983272-144983294 AAACCAGTAAGTTTTTATTAGGG + Intergenic
969266657 4:6068514-6068536 AACCCCTCAGGTTTTTATGCTGG + Intronic
970876981 4:20882989-20883011 AAACCACCAGATTTTTTTGGTGG - Intronic
970956530 4:21818069-21818091 AAACCAGCAGGTTTTTATTAAGG - Intronic
972164654 4:36267855-36267877 AAAACAGTATGTTTTTAAGCTGG - Intergenic
972990553 4:44818449-44818471 AAACCTCTAGGTGTTTATTCTGG - Intergenic
973024285 4:45248035-45248057 AAACCAGCAGGTTTTTATTCAGG + Intergenic
973223283 4:47753168-47753190 AAACCAGCAGGTTTTTATTAAGG + Intronic
973232978 4:47864080-47864102 ATACCACAAAGTTTTTATGCTGG + Intronic
974164608 4:58185367-58185389 AAACCAGCAGGTGTTTATCCAGG + Intergenic
975790588 4:77945732-77945754 AAACCAGCAGGTTTTTATTGAGG + Intronic
977140601 4:93366657-93366679 AAACCAGTAAGTTTTTATTAGGG - Intronic
978058163 4:104299393-104299415 AAAGCACTAAGTTTTTACTCAGG + Intergenic
979503570 4:121467785-121467807 AAACCAGCAGGTTTTTATTAAGG + Intergenic
979970063 4:127123747-127123769 AAACCAGTAAGTTTTTATTAGGG + Intergenic
980232019 4:130057450-130057472 AAACCAGTAAGTTTTTATTAAGG - Intergenic
980245963 4:130243351-130243373 AAACCAGTAAGTTTTTATTAGGG + Intergenic
981190411 4:141855912-141855934 AAACCAGTAAGTTTTTATTAGGG - Intergenic
981236767 4:142425638-142425660 AGACCTCTAGGTGCTTATGCAGG - Intronic
982513626 4:156317095-156317117 AAACCAGCAGGTTTTTATTAAGG + Intergenic
985332313 4:188851675-188851697 AAACCAGCAGGTTTTTATTAAGG - Intergenic
989317915 5:40103795-40103817 AAACCAGTAAGTTTTTATTAGGG - Intergenic
989318948 5:40112594-40112616 AAACCAGTAAGTTTTTATTAGGG - Intergenic
989818553 5:45765783-45765805 AAAGCACTAGGTTTAGATCCAGG + Intergenic
992400687 5:76408597-76408619 AAACCTCTAGCTATTTATGCTGG + Intronic
992598852 5:78376066-78376088 AAACCAGCAGGTTTTTATTAAGG - Intronic
993750365 5:91658280-91658302 AAACCAGCAGGTTTTTATTAAGG - Intergenic
995187378 5:109286485-109286507 AAACCAGTAGGTTTTTATTAAGG + Intergenic
999041869 5:148422801-148422823 AAACCACTAGGTTTTTATGCAGG - Intronic
1002202897 5:177540743-177540765 AAACCACTAGGTTTTGGAGGTGG + Intronic
1002666478 5:180829409-180829431 AAACCAGCAGGTTTTTATTAAGG - Intergenic
1005985297 6:30869697-30869719 AAACCAGCAGGTTTTTATTAGGG - Intergenic
1009766607 6:68085521-68085543 AAACCACCAAGTTTTTATTAGGG + Intergenic
1009789693 6:68385818-68385840 AAACCAGCAGGTTTTTATTAAGG - Intergenic
1009876306 6:69509578-69509600 AAATCAATAGGTTTTCATGTAGG - Intergenic
1010816572 6:80364986-80365008 AAACCAGTAAGTTTTTATTAAGG + Intergenic
1011590835 6:88969263-88969285 AAACCAGCAGGTTTTTATTAAGG + Intergenic
1011838183 6:91459702-91459724 AAAACACTATTTTTTTATACTGG + Intergenic
1011878412 6:91992016-91992038 AAACCAGCAGGTTTTTATTAGGG + Intergenic
1014057066 6:117028375-117028397 AAACCATTTGGTTTTCAGGCAGG + Intergenic
1014277912 6:119407468-119407490 ATCCCACTGGGTTTTTATGCAGG - Intergenic
1015180799 6:130360461-130360483 AAACCAGTAAGTTTTTATTAGGG + Intronic
1015820444 6:137254894-137254916 AAACCAGCAGGTTTTTATTAAGG - Intergenic
1016912424 6:149212383-149212405 AAACAAATAGGTTCTAATGCTGG - Intergenic
1019072047 6:169354817-169354839 AAACCAGCAAGTTTTTATGAAGG + Intergenic
1020108572 7:5434730-5434752 AAACCACCCAGTTTTTATTCTGG - Intronic
1020847049 7:13299140-13299162 AAAACACTGGGTTTTAATCCAGG - Intergenic
1021447574 7:20749591-20749613 AAACCACTGGGCTTTTATTTAGG + Intronic
1024833215 7:53485766-53485788 AAACCAGCAGGTGGTTATGCTGG + Intergenic
1027291449 7:76716402-76716424 AAACCAGCAGGTTTTTATTAAGG + Intergenic
1028331546 7:89600939-89600961 AAACCAGCAGGTTTTTATTGAGG + Intergenic
1029292791 7:99515443-99515465 AAACCACTAGGATTGTGTGCAGG + Intronic
1029355175 7:100046460-100046482 AAACCATTAAGTGGTTATGCTGG - Intergenic
1030272701 7:107686945-107686967 AAACCACAGGGTTTTTTTCCTGG + Intronic
1031595374 7:123643947-123643969 AAAGCACTTGGTTTTTGTGCTGG + Intergenic
1031785673 7:126028414-126028436 TTGCCACAAGGTTTTTATGCTGG - Intergenic
1033627291 7:143122871-143122893 AAACCAGCAGGTTTTTATTAAGG + Intergenic
1038816176 8:30906691-30906713 AAAACACTAGGTTTAACTGCTGG + Intergenic
1039580427 8:38661705-38661727 AAACCAGCAGGTTTTTATTAAGG - Intergenic
1039933884 8:42022335-42022357 AAATATCTAGGTTTTTTTGCTGG - Intronic
1040329621 8:46379220-46379242 AAACCCCGAGGTTTTGAAGCAGG + Intergenic
1040426010 8:47287107-47287129 AAACCAGCAGGTTTTTATTAAGG + Intronic
1040842699 8:51801480-51801502 AAACCAGCAGGTTTTTATTAAGG - Intronic
1040949364 8:52920625-52920647 AAGCCACTAAGTTTTTTTGGGGG + Intergenic
1041907771 8:63052526-63052548 AAACCAGCAGGTTTTTATTAAGG - Intronic
1043320750 8:78982841-78982863 AAACCACTGGATTCTTCTGCTGG + Intergenic
1043726347 8:83616234-83616256 ATCCAACTAGGTTTTTGTGCAGG + Intergenic
1044307763 8:90657381-90657403 AAACCAGCAGGTTTTTATTAAGG + Intronic
1044762171 8:95531654-95531676 AAAGTACAAGGTTTTTGTGCTGG + Intergenic
1045515400 8:102855038-102855060 AATCCCCTAGGTCTTGATGCTGG - Intronic
1047937542 8:129797425-129797447 AAATCACCAGGTTTATATCCAGG + Intergenic
1048178908 8:132177586-132177608 AGACGTCTAGGTTTTTGTGCTGG + Intronic
1048602128 8:135929745-135929767 AAACCAGCAGGTTTTTATTAAGG + Intergenic
1048670372 8:136712526-136712548 AAACCACGAAGTTTTTATAAGGG - Intergenic
1048820289 8:138374076-138374098 AAACCAGTAAGTTTTTATTAGGG - Intronic
1052456094 9:28700089-28700111 AAACCAGCAGGTTTTTATTAAGG - Intergenic
1058137874 9:101327434-101327456 AAACCAGCAAGTTTTTATGAAGG + Intergenic
1059774146 9:117458200-117458222 AAACCACTACATGTGTATGCTGG + Intergenic
1059990443 9:119860320-119860342 CAACTCCTAGCTTTTTATGCTGG + Intergenic
1060353543 9:122881646-122881668 AAACCACTGACTTTTTTTGCAGG + Intronic
1188403263 X:29774155-29774177 AAACCATTCCCTTTTTATGCGGG - Intronic
1188761700 X:34040405-34040427 AATACACTAGGTTTTTATTTTGG + Intergenic
1190442437 X:50488527-50488549 AAACCACTCTGTTTTTCTCCTGG - Intergenic
1192752184 X:74004918-74004940 AAACCAGTAAGTTTTTATTAGGG + Intergenic
1193025767 X:76844269-76844291 AAACCAGTAAGTTTTTATTAGGG - Intergenic
1193224690 X:78968755-78968777 AAACCAGCAGGTTTTTATTAAGG + Intergenic
1194062513 X:89221998-89222020 AAACATCTGGGTTTTTATGAAGG - Intergenic
1194071143 X:89327770-89327792 AAACCACCAGGTTTTTATTGAGG - Intergenic
1194314059 X:92352202-92352224 AAAACACTATGTTTTTTTGTAGG - Intronic
1195258275 X:103109348-103109370 AAACCAGCAGGTTTTTATTAAGG + Intergenic
1195400955 X:104460677-104460699 AAACCAGCAGGTTTTTATTAAGG - Intergenic
1196944286 X:120808761-120808783 AAACCAGCAGGTTTTTATTAAGG - Intergenic
1197162817 X:123343240-123343262 CCACCACCAGGTTTTTATCCAGG + Intronic
1198122654 X:133609273-133609295 AGACCACTAGACTCTTATGCGGG + Intronic
1198610515 X:138394822-138394844 AAACCAATAAGTTTTGAGGCAGG - Intergenic
1200372424 X:155740849-155740871 AAACCAGCAGGTTTTTATTAAGG - Intergenic
1200716382 Y:6550963-6550985 AAACATCTGGGTTTTTATGAAGG - Intergenic
1200725372 Y:6663515-6663537 AAACCACCAGGTTTTTATTGAGG - Intergenic
1200975601 Y:9209331-9209353 AAACCAGCAAGTTTTTATGAGGG + Intergenic
1201313483 Y:12620257-12620279 AAACTGCTAGATCTTTATGCAGG - Intergenic