ID: 999045828

View in Genome Browser
Species Human (GRCh38)
Location 5:148468457-148468479
Sequence AGATTCAGTTCTTCCTTCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 259}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999045828_999045831 0 Left 999045828 5:148468457-148468479 CCTTAGAAGGAAGAACTGAATCT 0: 1
1: 0
2: 1
3: 21
4: 259
Right 999045831 5:148468480-148468502 ATCCCACCATAGGGATCCATAGG 0: 1
1: 0
2: 0
3: 8
4: 148
999045828_999045837 14 Left 999045828 5:148468457-148468479 CCTTAGAAGGAAGAACTGAATCT 0: 1
1: 0
2: 1
3: 21
4: 259
Right 999045837 5:148468494-148468516 ATCCATAGGGGTGTCTTTCTAGG No data
999045828_999045840 19 Left 999045828 5:148468457-148468479 CCTTAGAAGGAAGAACTGAATCT 0: 1
1: 0
2: 1
3: 21
4: 259
Right 999045840 5:148468499-148468521 TAGGGGTGTCTTTCTAGGAAGGG 0: 1
1: 0
2: 0
3: 12
4: 184
999045828_999045841 22 Left 999045828 5:148468457-148468479 CCTTAGAAGGAAGAACTGAATCT 0: 1
1: 0
2: 1
3: 21
4: 259
Right 999045841 5:148468502-148468524 GGGTGTCTTTCTAGGAAGGGAGG No data
999045828_999045839 18 Left 999045828 5:148468457-148468479 CCTTAGAAGGAAGAACTGAATCT 0: 1
1: 0
2: 1
3: 21
4: 259
Right 999045839 5:148468498-148468520 ATAGGGGTGTCTTTCTAGGAAGG No data
999045828_999045832 1 Left 999045828 5:148468457-148468479 CCTTAGAAGGAAGAACTGAATCT 0: 1
1: 0
2: 1
3: 21
4: 259
Right 999045832 5:148468481-148468503 TCCCACCATAGGGATCCATAGGG 0: 1
1: 0
2: 0
3: 14
4: 179
999045828_999045830 -9 Left 999045828 5:148468457-148468479 CCTTAGAAGGAAGAACTGAATCT 0: 1
1: 0
2: 1
3: 21
4: 259
Right 999045830 5:148468471-148468493 ACTGAATCTATCCCACCATAGGG 0: 1
1: 0
2: 0
3: 4
4: 66
999045828_999045834 2 Left 999045828 5:148468457-148468479 CCTTAGAAGGAAGAACTGAATCT 0: 1
1: 0
2: 1
3: 21
4: 259
Right 999045834 5:148468482-148468504 CCCACCATAGGGATCCATAGGGG 0: 1
1: 0
2: 1
3: 5
4: 46
999045828_999045829 -10 Left 999045828 5:148468457-148468479 CCTTAGAAGGAAGAACTGAATCT 0: 1
1: 0
2: 1
3: 21
4: 259
Right 999045829 5:148468470-148468492 AACTGAATCTATCCCACCATAGG 0: 1
1: 0
2: 0
3: 5
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999045828 Original CRISPR AGATTCAGTTCTTCCTTCTA AGG (reversed) Intronic
903651345 1:24924037-24924059 AGATTCAATTCTTCCTGGGAGGG + Intronic
903736854 1:25535366-25535388 AGCCTCTGTTCTTCCTTCTGCGG + Intergenic
907547595 1:55275446-55275468 AGATTAACTGATTCCTTCTAGGG - Intergenic
908874447 1:68655176-68655198 AAATTGAATTCTTCTTTCTACGG - Intergenic
909556810 1:76963370-76963392 AGATACAGTTCTGCCTGCAAAGG + Intronic
910016618 1:82533254-82533276 ATATTTAGTGCTTCCTTCCAGGG + Intergenic
910084494 1:83383316-83383338 AAATGCAGTCTTTCCTTCTATGG + Intergenic
910858620 1:91720946-91720968 AGATACATTTATTCCTTCAAAGG + Intronic
911064116 1:93772527-93772549 AGTTTCAGCTCTTCCTTTTGGGG + Intronic
912178406 1:107188860-107188882 AGAGTAAGTTATTCCATCTAAGG + Intronic
915009103 1:152667852-152667874 AGATACTGTTCTTCCTACTCTGG - Intergenic
917098906 1:171426464-171426486 TCATTGAGTTCTTCCTTCTGAGG + Intergenic
918318669 1:183344718-183344740 ATATTCTGTTCTGCCTTCTCTGG - Intronic
919045399 1:192445238-192445260 AGATACAGTTCTTTCCTCAAAGG + Intergenic
919663286 1:200268881-200268903 AGATTAAAATCTTCCTTCTTGGG - Intergenic
919681087 1:200435492-200435514 AAATTCAGTTCCTCCTTTCAAGG + Intergenic
920160585 1:203995052-203995074 AGACTCAATTCTTGCTTCCAAGG + Intergenic
921308075 1:213816983-213817005 AGACTCTGTTCTCCCTTATAGGG + Intergenic
1063874047 10:10453375-10453397 AGATACAGTTTTTGCTCCTAAGG + Intergenic
1064337851 10:14459735-14459757 AAATACAGTTCTGCCCTCTAGGG + Intronic
1067700919 10:48571372-48571394 TTATTCAGTTATTCCTCCTATGG + Intronic
1068177263 10:53477480-53477502 CGATTAGGTTCTTCCTTTTATGG - Intergenic
1068220480 10:54038713-54038735 ACATTCAGCTCTACCTTCAAGGG + Intronic
1068956738 10:62825140-62825162 AGATTGTGTGCTTCCCTCTAAGG + Intronic
1070671854 10:78383076-78383098 TGATTCAGATATTCATTCTAAGG - Intergenic
1070733345 10:78846755-78846777 AGGCTCAGTTCTTCCTTAGAAGG - Intergenic
1072545576 10:96434512-96434534 TGAATCAGTTCTTCATTTTATGG + Intronic
1073585654 10:104707594-104707616 TGATTCAGGTCCTCCTTCTATGG - Intronic
1076236243 10:128865376-128865398 AGACTCATTTCCTCCTTCCATGG - Intergenic
1077728054 11:4696601-4696623 AAATTTAGTGCCTCCTTCTAAGG - Intronic
1077901201 11:6490443-6490465 AGATTCTGTTTTTCCTTTTCTGG + Intronic
1080936330 11:36867865-36867887 AGATTAATCTCTTCCCTCTAAGG - Intergenic
1082843771 11:57711237-57711259 AGTTGCCATTCTTCCTTCTAAGG - Intronic
1084096437 11:66914551-66914573 AGACTCAGTCCTTCCCTCAAAGG - Intronic
1087185555 11:95189421-95189443 GGCTTCTGTTCTCCCTTCTACGG - Intronic
1087222296 11:95559623-95559645 AGATTCTTTTCTTACTGCTATGG + Intergenic
1087603298 11:100343311-100343333 CGAATCAATTCTTCCTTCTCAGG - Intronic
1088319135 11:108536675-108536697 AGATTCACTTGTTCCCTTTAAGG - Intronic
1088648968 11:111940703-111940725 ACATTCAGTTCCTGCTTCCAAGG + Intronic
1088823731 11:113476621-113476643 GGACTCAGTTCTCCCTTCTGAGG - Intergenic
1089206614 11:116769350-116769372 AAATTCAGTTTTTCATTCTAGGG + Intronic
1089865493 11:121627783-121627805 AGAGTCGGTTCTTCCTCCCAGGG + Intronic
1090744563 11:129695836-129695858 AGTTTCAGTTATTCCATGTATGG + Intergenic
1090988528 11:131795258-131795280 ATAATCATTTCTTCCTTATAGGG + Intronic
1091072519 11:132581467-132581489 AGATACAGTTCTTCCTTTCCTGG - Intronic
1092332944 12:7602301-7602323 AGCTACAGATCTTCCTACTAGGG + Intergenic
1092768354 12:11873186-11873208 TGATTCAGTCCTACCTTCTTCGG - Intronic
1093429321 12:19066111-19066133 TAACTCAGTTCCTCCTTCTATGG + Intergenic
1093707075 12:22286363-22286385 AGATTCAGTCCCACTTTCTAAGG + Intronic
1094592560 12:31835321-31835343 AGATTCAGTTTCTGCTTCTTAGG + Intergenic
1097168648 12:57099629-57099651 AGCTTCTCTTCTTCCTTCTGTGG - Intronic
1097865714 12:64557653-64557675 AGATCCATTTATTCTTTCTACGG + Intergenic
1097978462 12:65712600-65712622 AAATTTAGTCCTTCCTTCTCTGG + Intergenic
1099298200 12:80857403-80857425 ACATTCTGTCCTTCCTTCTCAGG - Intronic
1099362865 12:81727892-81727914 AAATTCATTTCTTCCATCCATGG + Intronic
1101236386 12:102794309-102794331 AGATTCAGTTCTCCCTTCTGTGG + Intergenic
1101825972 12:108220230-108220252 AGAATGAGATCTTCCTGCTAAGG + Intronic
1102718982 12:115000326-115000348 AGCTTCAGTTCTGTCTTCTTGGG - Intergenic
1102880875 12:116483611-116483633 AGTGTCAGTACTTCCTTCTATGG + Intergenic
1104411574 12:128562579-128562601 AGCTGCAGTGCTTCCTTCTAAGG - Intronic
1109798161 13:67342999-67343021 AGCTACAGATCTTCCTACTATGG - Intergenic
1110837655 13:80103120-80103142 AGATTCAATCCTTGCCTCTATGG - Intergenic
1111148360 13:84215181-84215203 AGATACATTTCTTCCCCCTATGG + Intergenic
1111406664 13:87815577-87815599 AGTTTCAGTGATTTCTTCTAAGG - Intergenic
1111534824 13:89589515-89589537 AGAGTTAGTTCTTCATTCCAAGG - Intergenic
1111639401 13:90947881-90947903 AGCTTGTGTTCTTCCTTTTAGGG - Intergenic
1114174226 14:20305242-20305264 GAACTCAGTTCTTCGTTCTAAGG - Intronic
1115766002 14:36624458-36624480 TGATTCATTTCTTGCTTCCAAGG + Intergenic
1115956864 14:38791013-38791035 AGATTCATTTCTTTCTTATTTGG + Intergenic
1116489856 14:45492762-45492784 AGACTCAGTCCTTCCGTTTAAGG + Intergenic
1117919120 14:60709251-60709273 AGGTACACTTCTTCCTTTTAAGG + Intergenic
1118123599 14:62874057-62874079 ACGTTCAGTTCTTTCTTCTGTGG - Intronic
1118158676 14:63267052-63267074 AGATTCAATTCTTCCTGCCATGG - Intronic
1119088921 14:71761969-71761991 AGATTCTGTTCTGCCTTTCAGGG - Intergenic
1119861577 14:77939940-77939962 AGCTGCATTTCTTCCTTCTCTGG - Intergenic
1120480427 14:85042526-85042548 AGTTTCATTTCTTCCTTCTTAGG - Intergenic
1121124058 14:91394662-91394684 AGATTCAGTGCCTGCTTTTAAGG + Intronic
1121839943 14:97125358-97125380 AGTTTCCGTTTTCCCTTCTAGGG - Intergenic
1124019556 15:25907042-25907064 TCATTCAGTTCTATCTTCTAGGG - Intergenic
1124622813 15:31286053-31286075 TGTTTCAGTACTTCCTTTTATGG - Intergenic
1124850105 15:33328412-33328434 ATCTTCAGTTATTCCTTCTCAGG + Intronic
1124998408 15:34746460-34746482 AGATCCCATTCTGCCTTCTAGGG + Intergenic
1125355221 15:38810586-38810608 AGTTACAGTTCTTCCTTTTCTGG + Intergenic
1126274310 15:46858327-46858349 AGATTCTTTTCTTCCATCTGTGG - Intergenic
1127280111 15:57482301-57482323 CAATTTAGTTTTTCCTTCTATGG + Intronic
1131235272 15:90691508-90691530 TGATTCTGTTCTTCTTGCTATGG - Intergenic
1131544056 15:93300995-93301017 TGATCTTGTTCTTCCTTCTAGGG + Intergenic
1133708601 16:8379434-8379456 AGATCCATTTCTTCCTCCGAAGG + Intergenic
1134004320 16:10807748-10807770 AGATTCAGGGCTTCCATCTTAGG - Intronic
1135077265 16:19404137-19404159 AGATTCAGTTTTCCTTTCCAGGG + Intergenic
1136744503 16:32573140-32573162 ATATTCTGTTTTTCCTTATAGGG - Intergenic
1139677745 16:68536757-68536779 GGATTAAGTTCTGCATTCTAAGG - Intronic
1139798300 16:69500427-69500449 AGATTGAGTACATCCTTCTGTGG - Intergenic
1139844540 16:69910793-69910815 ATATTCAGTGGTACCTTCTAAGG + Intronic
1140350137 16:74254399-74254421 ACATTCACTTCTTCATTCAAAGG + Intergenic
1140655863 16:77138531-77138553 TGGTTAAGTTCTTCCATCTAGGG + Intergenic
1141026728 16:80555742-80555764 AGATTCAGTGTTCTCTTCTATGG - Intergenic
1141887564 16:86903080-86903102 CCAATGAGTTCTTCCTTCTAGGG + Intergenic
1203025093 16_KI270728v1_random:502092-502114 ATATTCTGTTTTTCCTTATAGGG + Intergenic
1203046628 16_KI270728v1_random:832339-832361 ATATTCTGTTTTTCCTTATAGGG - Intergenic
1148404652 17:47400222-47400244 AGATTCAGATCTGGCTTCAATGG - Intronic
1149857093 17:60092324-60092346 AGACTCATTTCTTCTTTCTGAGG + Intergenic
1150262998 17:63811910-63811932 TGTTTCATTTCTTCCTTCTCAGG + Exonic
1153161716 18:2212617-2212639 AGATTCCTATCTACCTTCTATGG - Intergenic
1153387754 18:4517805-4517827 AGATTCAGGTCTTGCTTATTGGG + Intergenic
1153580488 18:6568479-6568501 GAATTCAGATCTTCCTTCTTAGG - Intronic
1158256943 18:55561998-55562020 AGATACATTTCTTTCATCTAGGG + Intronic
1158936257 18:62367348-62367370 AGTTGCAGTTCATCCTTCTTAGG - Intronic
1159136014 18:64337722-64337744 AGATTCTGTTCTTTCTTCATGGG - Intergenic
1159486750 18:69070509-69070531 AGAATCTGTTCTTATTTCTAAGG + Intergenic
1159511100 18:69399969-69399991 ACATTTAGTACTTACTTCTAAGG - Intergenic
1163225122 19:15955163-15955185 AGATGCAGTCCTTCCTACTAGGG + Intergenic
1164219993 19:23184743-23184765 AAATTCAGCTCTTTCTTTTAAGG + Intergenic
1167263776 19:48473290-48473312 AGGTTCAGTTCTTCCCTGGAAGG - Exonic
925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG + Intronic
927049755 2:19315467-19315489 ATATCCAGTTTTTCTTTCTAGGG + Intergenic
927123726 2:19993815-19993837 AAAATCAGTTCTTTCTTCAAAGG - Intronic
928259686 2:29755516-29755538 AGCTTCAAGTCTTCCTTCTCTGG + Intronic
928459445 2:31456984-31457006 AGATCCAGTTTTCCTTTCTAGGG + Intergenic
929135472 2:38619734-38619756 AGCTTCACTTCTACCTTCTGTGG - Intergenic
929342179 2:40834006-40834028 ATTTTTAGTTCTTCCTTATAAGG + Intergenic
930924416 2:56799327-56799349 TGATCCATTTCTTCCTTCTCTGG - Intergenic
932781751 2:74562984-74563006 AAATTCAGTTCTTCTTTTGAGGG + Intronic
933318670 2:80745297-80745319 AGAGTGAGTTCTTCCTTCGACGG - Intergenic
933498059 2:83076350-83076372 TGATTCTGTCTTTCCTTCTATGG + Intergenic
936978175 2:118239717-118239739 AGCTCCAGTTCTTCCTTCCAGGG + Intergenic
937636636 2:124163378-124163400 AGATACAGGCTTTCCTTCTAAGG - Intronic
938210736 2:129464145-129464167 GGTTTCAGTTCTTCCATCTAAGG - Intergenic
939317136 2:140566275-140566297 AGCTTCAGCTCAGCCTTCTAGGG - Intronic
939635676 2:144579952-144579974 AGGTTAAGTTATTCCTTTTAGGG + Intergenic
940487435 2:154313772-154313794 AGAATAAGTACTACCTTCTAGGG + Intronic
941768437 2:169324996-169325018 AGATTCCATTTTTCTTTCTATGG - Intronic
942839265 2:180340080-180340102 AGATCCAGTTTTCCTTTCTAGGG - Intergenic
943501609 2:188696586-188696608 TTACTCAGTTCTTCCTGCTAAGG - Intergenic
943808205 2:192150711-192150733 ACATTCAGTTCTAACTTCTCAGG + Intronic
944695739 2:202198885-202198907 ACCTTGAGTTCTTCCTTCTCTGG + Intergenic
944732294 2:202528985-202529007 AGGTTCAATTCTTCCTTATTCGG - Intronic
945377369 2:209094703-209094725 ACATTAAGTTCTTCTTTCTTAGG + Intergenic
945623974 2:212176828-212176850 AGATGGAGTTCTTACTTCCATGG - Intronic
946882918 2:224194217-224194239 ATTTTCAGTTCTTCCTTGGAGGG + Intergenic
948353008 2:237356075-237356097 GGACTCAGTTCTTCCTTTTGTGG - Intronic
1168818824 20:760058-760080 ACACTCAGATCTTCCTTCAAAGG - Exonic
1169396845 20:5239893-5239915 ATATTTAGTGCTTCCTTCAAGGG + Intergenic
1173393831 20:42659681-42659703 TTATTGACTTCTTCCTTCTAAGG + Intronic
1177179499 21:17729633-17729655 ACTCTCAGTTCTTCCTGCTAAGG + Intergenic
1180749038 22:18111607-18111629 ACACTCAGTTCCTCTTTCTAGGG + Intronic
1181016926 22:20075845-20075867 AGAGTCAGTTATTCCTTTAAGGG + Intergenic
1181761578 22:25062412-25062434 AGGTACAGTGCTTCCTTCTGGGG - Intronic
1181928811 22:26382266-26382288 GGATTGAGTTCTGCCTTTTAAGG - Intronic
1183789624 22:40055551-40055573 AGATTCAGATCATTATTCTAAGG - Intronic
950965986 3:17146049-17146071 AGTTGCAGTTCCTCCTGCTAGGG - Intergenic
952108121 3:30092429-30092451 AGATCCAGTTTTCCCTCCTAGGG + Intergenic
953035875 3:39210630-39210652 AGATTCAGTCCATTCTTCTTTGG - Intergenic
955229230 3:57084323-57084345 AGATGCAGTTTTCTCTTCTAGGG + Intergenic
956020371 3:64927387-64927409 AGATTCAGGTCTTCTGTCTTTGG - Intergenic
956095922 3:65716013-65716035 AGACTCAGTTCTGTATTCTAAGG + Intronic
957339116 3:78870510-78870532 AGAATCATTTCTTCCCTGTAAGG - Intronic
957631389 3:82720578-82720600 AGAAATAGCTCTTCCTTCTAGGG + Intergenic
958591977 3:96170273-96170295 AGATCCAGTTTTACTTTCTAGGG - Intergenic
959431551 3:106260497-106260519 AGATCCAGTTTTCCCTCCTAGGG - Intergenic
959677415 3:109051999-109052021 AGACTTAATTCTTTCTTCTAAGG + Intronic
960610827 3:119553507-119553529 AGACTCAGGTCTTCCTAGTATGG - Intronic
960707580 3:120495302-120495324 CTATTCAGTTATTCCTTTTATGG - Intergenic
961606441 3:128098964-128098986 AGAGTCAGTGCTGCTTTCTAAGG + Intronic
962331367 3:134481613-134481635 AGATACAGTTCCTCCTCCTGAGG - Intronic
963761280 3:149289157-149289179 AGATTTGGTTTTTCTTTCTATGG - Intergenic
963867247 3:150375928-150375950 AGATTCAGTTCTTTTTAGTAAGG - Intergenic
964272361 3:154971131-154971153 TGATTCTGTTTTTCCTTCTCAGG - Intergenic
964758475 3:160110797-160110819 AGTTTCAGTTGTTCCTACTGAGG + Intergenic
964830707 3:160881276-160881298 AGATTCAGGACTTGGTTCTAAGG + Intronic
965104434 3:164339798-164339820 AAATTCAGCTCTTTCTTTTAAGG + Intergenic
965156237 3:165060581-165060603 AGCTTCATTTCTTCCTCCTGGGG + Intronic
965249250 3:166321216-166321238 AGATTCAGTGATTCCATCCATGG + Intergenic
966663574 3:182444886-182444908 ATGTACAGTTTTTCCTTCTATGG + Intergenic
968865618 4:3209447-3209469 AGGTTCAGTCCTGCCTTCTTAGG + Intronic
968944584 4:3656884-3656906 AGTTTGAGATCATCCTTCTAGGG - Intergenic
970309256 4:14765048-14765070 AGATTCAGTTCTTCAATCAAAGG + Intergenic
971978883 4:33728440-33728462 AGATAGAGTTCTTGCTTCCAAGG - Intergenic
972604460 4:40601152-40601174 AGATTCAGGTCTTCCTGATTTGG - Intronic
972989983 4:44813059-44813081 ATATTCAGTGCTTCCTTCAGGGG + Intergenic
974648183 4:64720307-64720329 TAATTCTGTTTTTCCTTCTAAGG - Intergenic
976900085 4:90162753-90162775 AAATTCATTTTTTTCTTCTATGG + Intronic
977862162 4:101975135-101975157 GAAGTCAGTTCTTCCTTCTAAGG - Intronic
979399872 4:120236378-120236400 AGACTCAGTTCTTTCTTTCAAGG + Intergenic
981300163 4:143178161-143178183 AGCTACAGATCTTCCTACTATGG - Intergenic
981712175 4:147720385-147720407 ATATCCAGTTCTCTCTTCTAGGG - Intergenic
982061505 4:151608711-151608733 GGATTCAGTTTTGTCTTCTATGG + Intronic
984156835 4:176204648-176204670 AAATTGAGTTCTTCCTTACAAGG + Intergenic
984506562 4:180626163-180626185 ACATTCAAATCTTCCTTCTGAGG - Intergenic
987907015 5:24090102-24090124 ATATTTAGTGCTTCCTTCAAGGG - Intronic
990191303 5:53263137-53263159 ATATTCAGTCCTTCCCTCTGGGG - Intergenic
990240777 5:53814193-53814215 AGATTTACTTCTTTCTTCTCGGG + Intergenic
990716595 5:58644330-58644352 AGCTTCAGTTGTTTCTTCTAGGG + Intronic
990963144 5:61415812-61415834 AGATCCAATTATTCCTTCTGAGG - Intronic
993605077 5:89979968-89979990 AGATACAGTTCTTCATTCTGTGG - Intergenic
993912546 5:93702214-93702236 AAATTCTGTTCTTCCTTTAAGGG - Intronic
995155256 5:108903563-108903585 ATATTCATTTCCTCCCTCTACGG - Intronic
996122037 5:119683574-119683596 AGCTTCACTGCTTCCTTATATGG - Intergenic
996443264 5:123514506-123514528 AGACTCAGTACTGCCTTCAAGGG + Intronic
998619437 5:143778149-143778171 AGAATCAGTACTTACTTCTTGGG - Intergenic
999045828 5:148468457-148468479 AGATTCAGTTCTTCCTTCTAAGG - Intronic
999396396 5:151231714-151231736 AGATTCAATTCTCCTTTCCAAGG - Intronic
1000857267 5:166414427-166414449 TGTCTCAGTTCTTCCTTGTATGG - Intergenic
1001046149 5:168373368-168373390 AGATAGAATTCTTCCTGCTATGG - Intronic
1003396533 6:5758050-5758072 GGATTCATTTTTACCTTCTAGGG - Intronic
1003717208 6:8660483-8660505 AAATTCAATTATTACTTCTAAGG + Intergenic
1005224747 6:23628898-23628920 AGGTTCAGTTCTTTATTCTGAGG + Intergenic
1008956272 6:57219901-57219923 AGTATCAGTTTTTCCTTTTATGG - Intronic
1009909583 6:69909306-69909328 AGATACGGTTCTTGCCTCTAGGG + Intronic
1011383024 6:86763042-86763064 AAATTCTGTTCTTTTTTCTAGGG - Intergenic
1012583683 6:100897991-100898013 AGATCCATTTTTTCTTTCTAGGG - Intergenic
1013547683 6:111175110-111175132 AGCTCCAGTTCTGCCTTCTGAGG + Intronic
1016813535 6:148283110-148283132 AGATTTACTTCTTCCTTCTTGGG + Intronic
1017123025 6:151041658-151041680 AGATTCAGTCCTTCCCTCACAGG + Intronic
1017376956 6:153781828-153781850 AGATTCAGTTTGTCCATCTGTGG - Intergenic
1017620841 6:156294893-156294915 AGTTTCAGATCTTCCTCCTGTGG - Intergenic
1017620880 6:156295535-156295557 AGACTCAGATCTTCCTCCCATGG - Intergenic
1017947803 6:159109864-159109886 AGATCCAGTTCCTCCTTCCCGGG + Intergenic
1020818082 7:12931001-12931023 TGTTTCAGTTCTTCATTGTAGGG - Intergenic
1020845716 7:13279674-13279696 CGTTTCAGTTTTTCCTTTTATGG + Intergenic
1021580980 7:22153138-22153160 TCATTCAGCTCTTCCTTCTCTGG + Intronic
1021604839 7:22399404-22399426 AGATCCAGTTCTTTCATTTAAGG - Intergenic
1022170963 7:27830480-27830502 CCATTCAGTTCCTCATTCTAAGG - Intronic
1022232387 7:28426805-28426827 AGATTCAGTTCTTGCTGTCATGG - Intronic
1022404182 7:30071218-30071240 AGATTCTGATCTTCCACCTAAGG - Intronic
1023634796 7:42198704-42198726 AAAATCAGTACTTCCCTCTAGGG + Intronic
1023781723 7:43661822-43661844 AGATACAGTTTTTCCTTTTCAGG - Intronic
1027301313 7:76839435-76839457 AAATGCAGTCTTTCCTTCTATGG + Intergenic
1027449580 7:78315459-78315481 ACATTGAGTTCTTCCTTGGAGGG + Intronic
1027619284 7:80463463-80463485 AGATTTCCTTCTTCCTTCCAAGG + Intronic
1027782973 7:82542569-82542591 AGACTCATTTCTCCCTTCTCAGG + Intergenic
1028712235 7:93922165-93922187 ATTTTCAGTTTTTCCTTCTCTGG - Exonic
1029167978 7:98608925-98608947 AGATTTTTTTCTTCATTCTAAGG + Intergenic
1031291150 7:119937211-119937233 ATATTCAGCTCTTTGTTCTAAGG - Intergenic
1031399334 7:121313218-121313240 ACTCTCATTTCTTCCTTCTATGG + Intergenic
1032630903 7:133650638-133650660 AGATTCACTTCCTCATTCCAAGG - Intronic
1032754606 7:134877040-134877062 CGAAACAGTTCTTCCTTATAAGG + Intronic
1032853481 7:135815090-135815112 GAATTCAGTTCTACCTCCTAAGG - Intergenic
1033263096 7:139860475-139860497 AAAATCAGTTCTGCCATCTAAGG - Intronic
1033617865 7:143034008-143034030 ATATTTAGTGCTTCCTTCAAGGG - Intergenic
1033682384 7:143607475-143607497 AATTTCAGTTATTCTTTCTAGGG + Intergenic
1033702505 7:143854438-143854460 AGTTTCAGTTATTCTTTCTAGGG - Intronic
1035301303 7:157899147-157899169 ACATTCAGCTTTGCCTTCTACGG - Intronic
1038884724 8:31650531-31650553 AATTTCTGTTCTTCCTTCTAGGG + Intronic
1039552675 8:38454283-38454305 AGATCCACTTCTCCCTTCTTGGG + Intronic
1039632326 8:39125528-39125550 AGAATGAGTTCTTCATCCTAGGG + Intronic
1040281318 8:46048611-46048633 AGATTCAGTTTTTCACTATAGGG - Intergenic
1040321367 8:46307950-46307972 AAATTCAGTTTTTCATTATAAGG + Intergenic
1040348355 8:46534274-46534296 ATATTCAGTTTTTCATTATAGGG - Intergenic
1040357698 8:46635716-46635738 AGATTCAGTACCTCATTCCAAGG - Intergenic
1041360481 8:57047604-57047626 AAATTCAAGTCCTCCTTCTAAGG + Intergenic
1042865585 8:73354123-73354145 AGATTCACTTCTCCCATCTCAGG - Intergenic
1044250161 8:89997168-89997190 TAATTCAGGTCTTCCTACTAGGG - Intronic
1045670029 8:104540444-104540466 AAATTCAGTACATTCTTCTAAGG + Intronic
1046214245 8:111121583-111121605 TGATTCAGATCATCCCTCTAGGG - Intergenic
1050911716 9:11079974-11079996 ACATCCACTCCTTCCTTCTAAGG - Intergenic
1053405619 9:37872938-37872960 AGTTTCAGTTGTTCCTTTTCTGG - Intronic
1053433511 9:38059473-38059495 AAATTCAGTTCTTCCTGCCTCGG + Intronic
1055341343 9:75287329-75287351 ATATTTAGTTCTTCCTTGTAAGG + Intergenic
1055695044 9:78874294-78874316 ATATTCAGTTTTCCCTTCTGGGG - Intergenic
1056381122 9:86058058-86058080 AGATTAACTTTTTCATTCTAAGG - Intronic
1058484418 9:105429203-105429225 CCTTTCAGTTCTTCCTTTTAAGG - Intronic
1059290513 9:113220090-113220112 ATACTCAGTTCTGCCTTGTAGGG - Intronic
1059879407 9:118673300-118673322 AGATTTATTTCTTCTTTCTTTGG - Intergenic
1186670248 X:11759375-11759397 AGTTTTAGTTGTTCCCTCTAGGG + Intronic
1187452426 X:19410796-19410818 AGTTTCAGATGTTCCTTCTCAGG - Intronic
1187865448 X:23719457-23719479 AGATGCATTTTTTCCTGCTATGG - Intronic
1188368988 X:29346072-29346094 AGATTCATTTCTTCTCTCTTTGG + Intronic
1190143506 X:47869133-47869155 AGATTCCTTTTTTCCCTCTAAGG + Intronic
1190404626 X:50074356-50074378 AGAGTCAGTTCTTTCTTCTCTGG - Intronic
1190633977 X:52416812-52416834 TGATGCAGTTCTTCCTTCAATGG + Intergenic
1191209980 X:57874789-57874811 AGTTTCAGGTCTTACATCTAAGG - Intergenic
1191584897 X:62813947-62813969 ATATTCAGTTTTTCATTATAGGG + Intergenic
1193151535 X:78129464-78129486 ACCTCCAGTTCTTCCTTTTATGG - Intergenic
1194402779 X:93458868-93458890 AGATCCAGTTATTCTTTTTAGGG + Intergenic
1195650064 X:107274718-107274740 TGTTACAGTTCTCCCTTCTAAGG - Intergenic
1197105119 X:122704039-122704061 AGAATTAGTTATTCCTTCTAGGG - Intergenic
1197365831 X:125563556-125563578 AGATCCAGTTTTACATTCTAGGG + Intergenic
1197605910 X:128584878-128584900 AGATCTAGTTCTTTTTTCTATGG - Intergenic
1197675438 X:129324918-129324940 AGATTCAGGTATTCCTCCGAGGG + Intergenic
1198604825 X:138325433-138325455 ATTTTCAGCTCTTCCTTTTATGG - Intergenic
1200871574 Y:8104860-8104882 AGATTTTGTTCTTCCTCTTACGG + Intergenic