ID: 999046240

View in Genome Browser
Species Human (GRCh38)
Location 5:148472750-148472772
Sequence CACTTCCTATTTCAGCTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 211}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999046240_999046246 15 Left 999046240 5:148472750-148472772 CCTGAGAGCTGAAATAGGAAGTG 0: 1
1: 0
2: 1
3: 19
4: 211
Right 999046246 5:148472788-148472810 TTACTTATTGTACTCTGAATTGG No data
999046240_999046248 30 Left 999046240 5:148472750-148472772 CCTGAGAGCTGAAATAGGAAGTG 0: 1
1: 0
2: 1
3: 19
4: 211
Right 999046248 5:148472803-148472825 TGAATTGGGCACTGTGTTGTAGG 0: 1
1: 0
2: 0
3: 8
4: 193
999046240_999046247 16 Left 999046240 5:148472750-148472772 CCTGAGAGCTGAAATAGGAAGTG 0: 1
1: 0
2: 1
3: 19
4: 211
Right 999046247 5:148472789-148472811 TACTTATTGTACTCTGAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999046240 Original CRISPR CACTTCCTATTTCAGCTCTC AGG (reversed) Intronic
901665557 1:10824275-10824297 CACTTCCAGCATCAGCTCTCTGG - Intergenic
901853656 1:12031052-12031074 CTCCTCCCATTTCAGCTCTCAGG + Intronic
904326920 1:29732584-29732606 GACTTCCTGTTTCAGCTTCCTGG + Intergenic
906190482 1:43895995-43896017 CACTTCCAATTTCACCTTTAAGG - Intronic
908393699 1:63706155-63706177 CTCTTTCTATTCCAGATCTCAGG - Intergenic
908545560 1:65158882-65158904 CACTTGATGTTTAAGCTCTCAGG + Intronic
909179827 1:72409037-72409059 AAGTTCCTAGTTCAGTTCTCTGG + Intergenic
911105269 1:94125275-94125297 CTCTTCCTAGTTCAACCCTCAGG - Intergenic
912900533 1:113643234-113643256 CACTTACTCTTTTATCTCTCTGG + Intronic
912993615 1:114511855-114511877 CACTTCCTGATTCAGGTCTGGGG - Intergenic
915951451 1:160192263-160192285 GACCTCTTATCTCAGCTCTCTGG + Intronic
919592434 1:199521392-199521414 CACTTGCTGTTTCATCTCCCTGG + Intergenic
921345764 1:214183857-214183879 GACTTTGTATTTCTGCTCTCTGG + Intergenic
921561482 1:216663904-216663926 CATTTCCTGTGTCAGTTCTCTGG - Intronic
921815418 1:219557718-219557740 CACCTCTCATTTCAGCTCTTTGG + Intergenic
923048687 1:230374764-230374786 AACTTCCTAATCCTGCTCTCTGG - Intronic
923150090 1:231225275-231225297 AACTTCCTAATTCAGTTCTCAGG + Intronic
923345210 1:233045016-233045038 CACATCCTATTTCTGTTGTCTGG - Intronic
1065388210 10:25155263-25155285 CCCTTCATATTTCTGCTCTAAGG + Intergenic
1067510359 10:46889915-46889937 CACTTTATAATTCAGCTCTCAGG - Intergenic
1067651894 10:48161942-48161964 CACTTTATAATTCAGCTCTCAGG + Intronic
1067779433 10:49188742-49188764 CATTTCCTATTTCTGCTCCAAGG - Intergenic
1068039334 10:51803056-51803078 CACTTCCTGTTCCAACTCTTAGG + Intronic
1068395754 10:56459072-56459094 AATTTGCAATTTCAGCTCTCAGG - Intergenic
1068980992 10:63062031-63062053 CACTTCCTAACTCAGCCCTTTGG + Intergenic
1069234840 10:66058287-66058309 CATTTTCTATTCCATCTCTCAGG + Intronic
1071446375 10:85752146-85752168 CACATACAATCTCAGCTCTCCGG + Intronic
1071456036 10:85852382-85852404 CACTTCCTGTTTCAGGTGTCTGG - Intronic
1072572052 10:96666935-96666957 CACTTCCTATTCCTGGTCTGGGG + Intronic
1072764271 10:98083253-98083275 CACTTGCTCTTTCAGCTGTTGGG - Intergenic
1074497327 10:113991529-113991551 AACATCCTATTTTACCTCTCTGG - Intergenic
1074669859 10:115777942-115777964 CACTGCCTATTTAAGCCCTTTGG + Intronic
1075835140 10:125446521-125446543 TTCTTTCTATTGCAGCTCTCAGG - Intergenic
1077542560 11:3154135-3154157 CACCTCCTACAGCAGCTCTCTGG - Intronic
1083152650 11:60802159-60802181 CACTTCTAATTTCAGCACTTTGG - Intergenic
1084563878 11:69918903-69918925 CACCGTCTATTTCAGCTCGCCGG + Intergenic
1085011830 11:73146653-73146675 CTCTTCCACTATCAGCTCTCAGG + Intergenic
1086228530 11:84541238-84541260 TATTTCCTGTTTCAGCTCTAAGG + Intronic
1087922406 11:103881577-103881599 CATTTCCTAATTGAGCTATCAGG - Intergenic
1088130183 11:106479260-106479282 CACTTCCTCTTTCGCCTATCTGG + Intergenic
1088654335 11:111985020-111985042 CTCTGGCTCTTTCAGCTCTCTGG - Intronic
1089130811 11:116210517-116210539 CACTTCGTTTTTCAGCATTCAGG - Intergenic
1090415677 11:126538696-126538718 CAGTCACTGTTTCAGCTCTCAGG + Intronic
1090538048 11:127667587-127667609 CTTTTCCTTTTTTAGCTCTCAGG - Intergenic
1091112232 11:132980441-132980463 CACTTCCTATTTTAGTTCTAGGG - Intronic
1091854503 12:3728585-3728607 CTCTTCCTCTTTCAGCTGGCTGG + Intronic
1094262508 12:28517310-28517332 CACTTCTGAATTCAGATCTCAGG - Intronic
1094303131 12:28988533-28988555 CACTTCCTAATTAATCTCTGAGG + Intergenic
1095978317 12:47954886-47954908 CTCTTCCAACTTCAGCCCTCGGG - Intergenic
1096036302 12:48474037-48474059 GACTGCCATTTTCAGCTCTCTGG - Intergenic
1097084306 12:56455818-56455840 CACCTCGAATTTCTGCTCTCTGG - Intronic
1097884878 12:64718898-64718920 GACTTCCTATTTCAGGTAACTGG + Intronic
1100816185 12:98389353-98389375 CACTTCCCATCTCAGCTTCCTGG - Intergenic
1101334010 12:103780178-103780200 AACATCCTATTTTAGCTCCCAGG - Intronic
1102768748 12:115454655-115454677 CACTCCCTGTTCCAGATCTCTGG + Intergenic
1104629134 12:130385657-130385679 AACTTATTATTTCAGCTTTCCGG + Intergenic
1107978423 13:45712585-45712607 GCCTTCTTGTTTCAGCTCTCAGG + Intronic
1108471896 13:50775634-50775656 CACTTTCTGCTTCAGCTCTGTGG + Intronic
1108809032 13:54197852-54197874 CTCTGCATTTTTCAGCTCTCTGG + Intergenic
1109083238 13:57934739-57934761 CAAATTCTATTTCAGCTCTGGGG + Intergenic
1109191170 13:59325992-59326014 CCCTTCCAATTCCAACTCTCAGG - Intergenic
1110538573 13:76681547-76681569 CTCTTCATATTCTAGCTCTCAGG + Intergenic
1111224103 13:85246841-85246863 TTCTTCCTATTTCTGTTCTCAGG + Intergenic
1113183978 13:107664892-107664914 CACATCCTACTCCAGCTCTTTGG + Intronic
1115959383 14:38818253-38818275 CATTACCTTTTTCATCTCTCTGG + Intergenic
1116746414 14:48824927-48824949 CACTTCCAATTCCAGCACTTTGG + Intergenic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1118953688 14:70459405-70459427 CCCTTCATATTGCAGGTCTCAGG - Exonic
1120390175 14:83896993-83897015 CATTTCCAATTTCAGATTTCTGG - Intergenic
1121900043 14:97685540-97685562 CTCATCCTAAGTCAGCTCTCTGG + Intergenic
1127673220 15:61215244-61215266 CAGGTCCTATTTCTGCTCTTAGG + Intronic
1127885122 15:63192151-63192173 CACTTCCTGTTGGAGCTCTGGGG - Intronic
1128883257 15:71262633-71262655 CACTCTTTAGTTCAGCTCTCAGG - Intronic
1129439911 15:75573920-75573942 CTCTTCATCCTTCAGCTCTCAGG - Intronic
1130121035 15:81047800-81047822 CTCTTCCTATTCCCACTCTCTGG + Intronic
1131823967 15:96301866-96301888 CATCTCCTATTTGAGCTCTATGG + Intergenic
1132067512 15:98744397-98744419 CACTTCATTCATCAGCTCTCAGG - Intronic
1132535195 16:475590-475612 CACTTCCCAATTCAGCCCTGCGG - Intronic
1132576201 16:665595-665617 CATTTCCTATTCCAGCCCCCAGG - Intronic
1133540739 16:6750853-6750875 CACTCACTATTTCAGCTTCCTGG - Intronic
1135621627 16:23960775-23960797 CACTCCCTACTGCTGCTCTCTGG + Intronic
1137482006 16:48859605-48859627 CATTTCTTATTTCTGCTCTCAGG - Intergenic
1137514197 16:49128707-49128729 CACTTCCACTTACAGCTCACTGG + Intergenic
1137532999 16:49295211-49295233 CTCTACCTATTACAGCTCTGGGG - Intergenic
1137793219 16:51192858-51192880 CAGTTCCAATGTCAGCACTCAGG + Intergenic
1139761632 16:69188281-69188303 GACTTGCTGTTTCAGCTTTCTGG - Intronic
1139798178 16:69499779-69499801 CCCTTTCTCTTCCAGCTCTCAGG - Intergenic
1141014270 16:80433713-80433735 CACTTTCTATCTCTTCTCTCAGG - Intergenic
1147351296 17:39847525-39847547 CAGGTCCTAGTTCAGCTTTCTGG + Intronic
1147727888 17:42577921-42577943 AACTTCCTCTTTCTGCTCCCGGG + Intergenic
1148735558 17:49862863-49862885 TCCTTCCTATTTCAGGCCTCTGG + Intergenic
1152596961 17:81242489-81242511 CACCTCCAAACTCAGCTCTCAGG + Intergenic
1153878621 18:9400200-9400222 CACTGCCTATGTCAGCACTTTGG - Exonic
1154334807 18:13456919-13456941 CACCTCCTTTCTCAGCTCCCAGG + Intronic
1156443949 18:37220631-37220653 CAGTTCCTATCCCAGTTCTCAGG + Intronic
1156996978 18:43480459-43480481 CACTTACTAGTTTATCTCTCAGG + Intergenic
1157279542 18:46336775-46336797 CACTTCATTTTTCAGTTATCTGG + Intronic
1157440491 18:47707889-47707911 CACTGGCTCTTCCAGCTCTCAGG + Intergenic
1158028680 18:52935704-52935726 CTCTTCCTACTTCAGCTTGCTGG + Intronic
1158185108 18:54762583-54762605 CACTTGCTATTTCCTCTCTTGGG + Intronic
1163764188 19:19153296-19153318 CACTTTCTATCTCAGCTCTCAGG - Intronic
1164398228 19:27884807-27884829 TACTTCCTACTTCAGCTGTGAGG - Intergenic
1164476495 19:28579634-28579656 CACTTCTTATTCCAGCTTCCTGG - Intergenic
1166325230 19:42045839-42045861 CACTTACTACTTCACTTCTCTGG - Intronic
1202676470 1_KI270711v1_random:11367-11389 CATTCTCTATTTGAGCTCTCAGG + Intergenic
925065778 2:928100-928122 GACTTCCTGGGTCAGCTCTCGGG + Intergenic
925065822 2:928301-928323 GACTTCCTGGGTCAGCTCTCGGG + Intergenic
925065866 2:928502-928524 GACTTCCTGGGTCAGCTCTCGGG + Intergenic
925065903 2:928703-928725 GACTTCCTGGGTCAGCTCTCGGG + Intergenic
925982959 2:9191926-9191948 CACTTGCTCTTTCACATCTCTGG - Intergenic
928442145 2:31301531-31301553 CACCTCCTCTTTCATCTCTACGG + Intergenic
929291777 2:40200585-40200607 CACTTACTATATCACCTCTGTGG + Intronic
932457353 2:71858072-71858094 CACTTCCTGTCCCAGCTCCCAGG - Intergenic
934014829 2:87868702-87868724 CCCTTGCTATTCCATCTCTCTGG + Intergenic
934072308 2:88395822-88395844 CCCTGCCCATTTCTGCTCTCTGG - Intergenic
935652719 2:105396104-105396126 CCCTGACTATTACAGCTCTCTGG - Intronic
936470475 2:112794276-112794298 CACTTCCTCTCACAGTTCTCTGG - Intergenic
936631944 2:114213090-114213112 CACTTCCTATCTTATCTCTCCGG + Intergenic
938716320 2:134025404-134025426 CACTTGCTATTTCATCTGCCTGG + Intergenic
941683101 2:168420266-168420288 CAATTCCTATCTCAGTTCTGTGG - Intergenic
942820278 2:180105646-180105668 CACTTGCTATTTCTTCTCCCAGG - Intergenic
947742579 2:232491363-232491385 CACTTGCTGTTTCAGCTGCCTGG + Intergenic
1169377836 20:5081325-5081347 CCCTTCCGATTCCAGCTTTCTGG - Intronic
1171568419 20:26219785-26219807 CTCTTCCTATTTGAGCCTTCTGG - Intergenic
1171855647 20:30340423-30340445 CACTTCCTAGTGCAGCTGTGAGG + Intergenic
1172031974 20:31988721-31988743 CACTTTCTCTAACAGCTCTCAGG - Intronic
1172442209 20:34973831-34973853 CACTGCCACTTCCAGCTCTCAGG + Intergenic
1174093141 20:48065953-48065975 CACTTCCTCTTTCATGTCACTGG + Intergenic
1176231411 20:64034931-64034953 CACTGGCCATTTCAGCTCTGAGG - Intronic
1177811935 21:25934207-25934229 CACTGCCTCTTACAGCTCTAGGG - Intronic
1178493250 21:33067670-33067692 CACTTCCTCTTTCTGCTGGCAGG + Intergenic
1179554124 21:42161971-42161993 CACTTCCTCTGTCTTCTCTCAGG - Intergenic
1181570543 22:23765902-23765924 CACTTCCAATCCCAGCTATCTGG + Exonic
1182309216 22:29392838-29392860 CACATGCTATTTAAGTTCTCAGG - Intronic
1182466828 22:30522109-30522131 CACCTGTAATTTCAGCTCTCTGG - Intergenic
1183774406 22:39954051-39954073 GACTTCCTCCTTCAGCTCTGAGG - Intronic
949539099 3:5018302-5018324 CAATTCCTATCTCTGCTCCCTGG + Intergenic
950142389 3:10624357-10624379 CTCTGCCTCTTCCAGCTCTCAGG + Intronic
952179380 3:30901992-30902014 CACTTCACATTTCTTCTCTCTGG - Intergenic
952437646 3:33288076-33288098 CACTTCCTCTTCCAGCACTAGGG + Intronic
956535671 3:70273222-70273244 CACTTGCTATTCCATCTCTGGGG - Intergenic
958507263 3:94996122-94996144 CAAGTCCTATTTCACCACTCAGG - Intergenic
960807416 3:121597601-121597623 CACTCCCTATTTCATCTCATTGG + Intronic
960945883 3:122966235-122966257 CACTTCCTTTTTCAGCCTCCAGG + Intronic
960995986 3:123340582-123340604 AACTTACTATTTTAGCTCTCTGG - Intronic
961383792 3:126512905-126512927 CACTTCAGATTTCTGATCTCTGG + Intronic
961854368 3:129854648-129854670 CACTTGCTATTTCTTCTGTCTGG + Intronic
962115084 3:132497133-132497155 TATTTCCTATTGTAGCTCTCAGG + Intronic
962962051 3:140320273-140320295 CACTTCCATTTTCAGTTTTCAGG + Intronic
963560413 3:146857263-146857285 CATTTCTTGTTTCAGCTCTTTGG - Intergenic
964799267 3:160535993-160536015 CACTTCATATTTCAGTTTTTAGG - Intronic
967412056 3:189176698-189176720 CACTTCCTGTTCCAGCTGCCTGG - Intronic
967418617 3:189248791-189248813 CTCTTACTATTTCTACTCTCTGG + Intronic
969062921 4:4452961-4452983 CACTTCCAATCTTAGTTCTCTGG - Intronic
972242961 4:37213762-37213784 CACTTCCTCTTCGAGCTCTAGGG + Intergenic
972315272 4:37920495-37920517 TACTTCCTATTTCCCATCTCAGG - Intronic
976871267 4:89796533-89796555 CCCTTCCTATTTTACTTCTCTGG + Intronic
977177606 4:93835530-93835552 CACTTTGTTTTTCAGCTCTGTGG - Intergenic
977618827 4:99113764-99113786 GCCTTCCTAGTTCTGCTCTCTGG - Intergenic
980130727 4:128813100-128813122 CACTACCTAAATCAGCTTTCAGG - Intronic
980681534 4:136168717-136168739 AACTTCCAATTTCAGCCCTTGGG - Intergenic
983087934 4:163470186-163470208 CACCTGCTATTTCTTCTCTCTGG + Intergenic
983311668 4:166071679-166071701 CACTTTCTATTTCTGCTCTTAGG - Intronic
986108428 5:4685318-4685340 CACTTCCCATTGCAGCACACAGG + Intergenic
987080925 5:14424639-14424661 CACTACCAAGATCAGCTCTCAGG + Intronic
987922066 5:24295997-24296019 CTCTTCCTATTTCTGATCTTAGG + Intergenic
990638660 5:57758259-57758281 CATTTCCTAATTAAGCTTTCAGG + Intergenic
991123288 5:63041387-63041409 CACTGCCTATTTCTGCTCCCAGG + Intergenic
991634446 5:68690083-68690105 ACCTTTCTATTTCTGCTCTCAGG - Intergenic
992666856 5:79018782-79018804 AACTTCACATTTCAGCTCTTAGG + Intronic
993998078 5:94746075-94746097 CACATCCTTTTCCAGCTCTTTGG + Intronic
996227144 5:121013801-121013823 CACCTACAATTTCAGCACTCTGG - Intergenic
996455216 5:123673885-123673907 CAATGCCAATTTCAACTCTCTGG - Intergenic
996911107 5:128657858-128657880 TACTTGCTATTTCTGATCTCAGG - Intronic
997600161 5:135133666-135133688 TACCTCCTCTGTCAGCTCTCTGG - Intronic
998141544 5:139702346-139702368 CACTTGCTGTTTCTGCTCTGTGG + Intergenic
998587563 5:143443470-143443492 GACTTGCTATTGCAGCTCACTGG + Intergenic
999046240 5:148472750-148472772 CACTTCCTATTTCAGCTCTCAGG - Intronic
1000182100 5:158821440-158821462 CAGCTCCTATTTCTGCTCTTGGG - Intronic
1004475388 6:15966712-15966734 CACTTACTATTCCAGCTGTTGGG + Intergenic
1007825477 6:44596689-44596711 CACTTCCCATTTCACCTCATAGG + Intergenic
1007909595 6:45500532-45500554 GATTTCCAATTTCAGCTCTGAGG - Intronic
1009676376 6:66827916-66827938 TACTCCCTATTTCCTCTCTCTGG + Intergenic
1015236302 6:130975023-130975045 CACATGTTATTTCACCTCTCTGG - Intronic
1016479496 6:144466965-144466987 CACTTCCTGTCTCTTCTCTCTGG + Intronic
1018724194 6:166598108-166598130 TCCTTACTATTTCACCTCTCAGG + Intronic
1019944877 7:4319482-4319504 GACTTCATCCTTCAGCTCTCCGG + Intergenic
1022682647 7:32564729-32564751 CACTTCCTGAATCAGCTCTCAGG - Intronic
1024730055 7:52243749-52243771 GAATTCCCATATCAGCTCTCTGG - Intergenic
1026701869 7:72654284-72654306 CAAATTCTATTACAGCTCTCTGG + Intronic
1028707514 7:93867323-93867345 TGCTTTTTATTTCAGCTCTCTGG + Intronic
1029852407 7:103476856-103476878 CACTTCTTATTTCAGTTATAAGG - Intronic
1032897972 7:136273342-136273364 AACTTCCTATTTGAGCTCTTTGG - Intergenic
1035329026 7:158084585-158084607 CACCTAATATTACAGCTCTCGGG + Intronic
1038904865 8:31889485-31889507 CTCTTCCTGTTTCTGCTCTCTGG - Intronic
1041857210 8:62471649-62471671 CACTTTCTACTTCAGCTCACTGG + Intronic
1042974220 8:74447425-74447447 CACTTCAGATTTCAGTTTTCCGG - Intronic
1044596396 8:93962872-93962894 CCCTTCCTCTTTCCCCTCTCTGG + Intergenic
1045058400 8:98389880-98389902 CACTTCATAGTTTAGCTGTCCGG - Intergenic
1046652367 8:116851161-116851183 CACTTCCTATATCTTCTCTCAGG + Intronic
1047630120 8:126697700-126697722 CACTTCCTGCCTTAGCTCTCTGG + Intergenic
1049103192 8:140594091-140594113 CACCTCCTACTCCTGCTCTCAGG + Intronic
1050222305 9:3406334-3406356 CACTTTGTCTTTCAGGTCTCAGG + Intronic
1050861295 9:10434957-10434979 CAATTCCTAGTCCAGCGCTCGGG - Intronic
1051161956 9:14218721-14218743 CACTTCCAATTTCAGCTCCTGGG - Intronic
1052003364 9:23315956-23315978 CCCTTCCTAATTCATGTCTCTGG - Intergenic
1052023092 9:23546807-23546829 CACTTCCTATTTCCTCTGTGTGG - Intergenic
1054151707 9:61611116-61611138 CACTTCCTATTGGAGCTGTGAGG - Intergenic
1054739867 9:68794209-68794231 CACATCCTTCTTCAGCTATCTGG - Intronic
1055486826 9:76764432-76764454 CACTTGCTATTTCTTCTGTCTGG - Intronic
1057105557 9:92411701-92411723 CCCTTCCTTTTTCAGAGCTCTGG - Intronic
1060278232 9:122198310-122198332 CCCTCTGTATTTCAGCTCTCAGG + Intronic
1060909938 9:127341459-127341481 CACATACAATTTCAGCTTTCTGG - Intronic
1061277492 9:129577791-129577813 CACTTCCTCTCTCTGGTCTCTGG - Intergenic
1187124181 X:16438163-16438185 GCCTTCTTGTTTCAGCTCTCAGG + Intergenic
1187710480 X:22048422-22048444 CATTTCCTATTTCCCTTCTCTGG + Intronic
1188813006 X:34675821-34675843 CACTTGCTATTTCTTCTGTCAGG - Intergenic
1189599521 X:42607926-42607948 CCCTTTCTCTTTCAGCTCTCTGG + Intergenic
1192301257 X:69905395-69905417 CAATTACTAGTTCAGCTGTCTGG + Intronic
1195202951 X:102567053-102567075 TCCTACCTACTTCAGCTCTCTGG - Intergenic
1195513374 X:105743419-105743441 CACTTGCTGTTTCATCTGTCTGG + Intronic
1196274168 X:113747416-113747438 CACTGCCTCTATCAGCCCTCAGG + Intergenic
1198280389 X:135135968-135135990 CAATTCCTATCTCTTCTCTCGGG + Intergenic
1198290570 X:135236546-135236568 CAATTCCTATCTCTTCTCTCGGG - Intergenic
1198303837 X:135360171-135360193 CAGTTTCTATTTCTTCTCTCAGG + Exonic
1199036301 X:143054201-143054223 CAGTGCCTATTTCAGCTATATGG + Intergenic
1199129650 X:144169809-144169831 CCCTTGCTATTCCATCTCTCTGG - Intergenic
1199706129 X:150426994-150427016 CACTTCCTCTGACAGCTCTAGGG + Intronic
1200272023 X:154694783-154694805 CACTTCCTTTTTCTGTTCTCTGG + Intronic
1200773890 Y:7152388-7152410 CACTTCCCATTCCACCTCCCCGG - Intergenic
1200867701 Y:8062775-8062797 CACTTCTGAATTCAGCTCACAGG + Intergenic
1201719705 Y:17083113-17083135 CACTTCCTGTTTTGGCTCTGTGG + Intergenic