ID: 999048913

View in Genome Browser
Species Human (GRCh38)
Location 5:148500486-148500508
Sequence GAAGCTAGGCCAACTCTAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 82}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999048908_999048913 28 Left 999048908 5:148500435-148500457 CCAGGAAAGTATGGTGTTAAGGA 0: 1
1: 0
2: 2
3: 10
4: 135
Right 999048913 5:148500486-148500508 GAAGCTAGGCCAACTCTAAGAGG 0: 1
1: 0
2: 1
3: 6
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999048913 Original CRISPR GAAGCTAGGCCAACTCTAAG AGG Intronic
917465607 1:175273259-175273281 GTAGCTAGCCCAACTAAAAGGGG + Intergenic
922339179 1:224641705-224641727 GAAGATCGGCCAACTCTCAGAGG + Intronic
1069987334 10:72293325-72293347 GGAGCCAGGCCACCTCAAAGAGG - Intergenic
1072973216 10:100035555-100035577 AAAGGTAGGACAACTCGAAGTGG - Intergenic
1081933657 11:46889844-46889866 GAAGAAATGGCAACTCTAAGGGG + Intronic
1088753516 11:112865932-112865954 GAAGCTGTACCAACTCTGAGGGG - Intergenic
1089693964 11:120204922-120204944 GAACCTAGGCCAGCTGTAAGTGG - Intergenic
1089694157 11:120206305-120206327 GAACCTAGGCCAGCTGTAAGTGG - Intergenic
1090096055 11:123742532-123742554 GAAGGCAGGACAACTCAAAGCGG + Intergenic
1091874058 12:3919060-3919082 GAAGCAAGGCCAGCTCTGGGAGG - Intergenic
1097256216 12:57676598-57676620 GATGCTAGGCCAACACTGACAGG + Intergenic
1097343303 12:58464443-58464465 GAAGCTAGGCCAGCACTGACTGG - Intergenic
1097964201 12:65561769-65561791 GAAGCTAGGCCATCTCTCCCTGG - Intergenic
1104764600 12:131318892-131318914 AAAGGTAGGACAACTCGAAGTGG + Intergenic
1105822336 13:24090613-24090635 GAAGCTGTGGTAACTCTAAGTGG - Intronic
1109390593 13:61686136-61686158 GAAGCTCAGTGAACTCTAAGAGG + Intergenic
1111350624 13:87024445-87024467 GAAGCTAAGTGAACTCAAAGTGG + Intergenic
1114505339 14:23207906-23207928 AAAGGTAGGCAGACTCTAAGCGG + Intronic
1115453425 14:33574651-33574673 GAAGCTGAGGCAACTTTAAGTGG + Intronic
1120402044 14:84044222-84044244 AAAGGTAGGACAACTCAAAGTGG - Intergenic
1122134986 14:99627635-99627657 GAAGCTGGGGCAACTGCAAGAGG + Intergenic
1123755960 15:23397897-23397919 AAAGCTAGGTCAACTGAAAGAGG + Intergenic
1124033103 15:26029199-26029221 AAAGGTAGGACAACTCCAAGTGG + Intergenic
1126145644 15:45470678-45470700 AAAGGTGGGCCAACTCGAAGGGG + Intergenic
1130696374 15:86135792-86135814 GACGCTAGTCCAAATTTAAGGGG - Intergenic
1131645826 15:94342412-94342434 GAAACCAGGCCTACACTAAGAGG - Intronic
1138556465 16:57773877-57773899 GCAGCTAGGCCAGCTCTGAGTGG + Intronic
1138819502 16:60242080-60242102 GAAGCTTAGCAAACTCCAAGTGG - Intergenic
1146441397 17:32898321-32898343 GAAGGCAGGACAACTCAAAGTGG + Intergenic
1148266725 17:46231909-46231931 GAAGAGAGGCCAAATCCAAGGGG + Intergenic
1148548177 17:48532509-48532531 GAAGCTAGGGCAAGTCCAGGAGG + Intergenic
1149349039 17:55768821-55768843 GAGGCTACTCCAGCTCTAAGTGG - Intronic
1149411270 17:56410019-56410041 AAAGCCAGGCCAATTTTAAGAGG + Intronic
1150394170 17:64808593-64808615 CTGGCTGGGCCAACTCTAAGTGG + Intergenic
1154172102 18:12059851-12059873 ACAGCTAGGCCAACTCTGATTGG + Intergenic
1164937125 19:32223704-32223726 GAAGCCAGGCCCACTCTAGCAGG - Intergenic
928249035 2:29658607-29658629 GAAGCCAGGTCAACTCTGTGTGG - Intronic
929950954 2:46409124-46409146 GAAACAAAACCAACTCTAAGTGG + Intergenic
931315578 2:61127872-61127894 GAAGCTCAACAAACTCTAAGAGG + Intronic
932063946 2:68533449-68533471 CAAGCTACTCCAACTCTTAGTGG + Intronic
933416216 2:81989729-81989751 GAAGCTCAGCAAACTCCAAGAGG - Intergenic
933859763 2:86454236-86454258 GAAGCTTGGTCAGCTTTAAGGGG + Intronic
936948780 2:117956120-117956142 GTAGCTAGGCCAACTGGATGAGG - Intronic
947975481 2:234362227-234362249 AAAGCCAGGACAACTCCAAGGGG - Intergenic
948242840 2:236452661-236452683 GAAGCAAGGCAACCTCTTAGCGG + Intronic
1169642464 20:7769550-7769572 ATAGCTGGGCCAACTCCAAGGGG + Intergenic
1170869553 20:20192570-20192592 CAAGCTACTCCCACTCTAAGAGG - Intronic
1183254395 22:36753082-36753104 GAAATGAGGACAACTCTAAGGGG + Intergenic
952612076 3:35223793-35223815 GAAGCAAGGCCAACTCTGAGAGG + Intergenic
965114429 3:164469732-164469754 GAAGGCAGGACAACTCAAAGTGG - Intergenic
967967836 3:194976099-194976121 GGAAATAGGCCAACTCCAAGAGG - Intergenic
970854638 4:20637822-20637844 AAAGGTAGGACAACTCGAAGCGG + Intergenic
980219676 4:129899707-129899729 GAAACTGGGCCAACTGTAAATGG + Intergenic
988314071 5:29601390-29601412 AAAGGTAGGACAACTCAAAGTGG - Intergenic
989017111 5:36950404-36950426 GAAAGTAGCCCACCTCTAAGTGG - Intronic
989809435 5:45655683-45655705 GAATGTAGGCAAACTCTCAGTGG - Intronic
998878868 5:146627289-146627311 GAAGATATGCCAAATCTCAGGGG + Intronic
999048913 5:148500486-148500508 GAAGCTAGGCCAACTCTAAGAGG + Intronic
1003033600 6:2623683-2623705 GGAGCCAGGCCCGCTCTAAGGGG - Exonic
1003374316 6:5561296-5561318 GAAGAAAAGCAAACTCTAAGAGG - Intronic
1004337782 6:14780252-14780274 GAAGCTTTGCTAACTCTAACAGG + Intergenic
1004785807 6:18966059-18966081 GAAGGAAGGCCAACATTAAGAGG + Intergenic
1006255418 6:32828902-32828924 GAAGCTTGCCCAGCTCTAGGAGG - Intronic
1007160063 6:39783678-39783700 GAAGCTCAACAAACTCTAAGTGG - Intergenic
1007478148 6:42132928-42132950 GGAGCTAGGCCAGGTCTGAGGGG - Intronic
1009496576 6:64356406-64356428 GAAGCTGTGCCAACTCTTATGGG - Intronic
1017739106 6:157390393-157390415 GAAGCTCGGCAAACCCCAAGCGG - Intronic
1021147921 7:17111824-17111846 GAAGGTGGGACAACTCGAAGTGG - Intergenic
1023062215 7:36338941-36338963 AAAGATAGGACAACTCAAAGAGG - Intronic
1024122116 7:46254032-46254054 AAAGGTAGGACAACTCAAAGTGG - Intergenic
1029818419 7:103121269-103121291 TAAGCTAGGCCAACAAAAAGTGG + Intronic
1030396298 7:108990803-108990825 GAAGGCAGGACAACTCAAAGTGG + Intergenic
1031199474 7:118661411-118661433 CAAGTTTGGCCAACTCTAAAGGG + Intergenic
1031424538 7:121589180-121589202 AAAGGTAGGACAACTCGAAGTGG - Intergenic
1032700368 7:134373697-134373719 AAAGGCAGGACAACTCTAAGCGG + Intergenic
1034162871 7:149005662-149005684 TCAGCTACGTCAACTCTAAGAGG + Intronic
1037960401 8:23093172-23093194 AAAGCATGGTCAACTCTAAGAGG - Intronic
1039829539 8:41202045-41202067 GATGCTAGGCCAGGTCTAAGAGG + Intergenic
1042274682 8:66991945-66991967 TAGACTAGGCCAACTCCAAGTGG - Intronic
1044158768 8:88886260-88886282 GAAGCTAGGAGAGCTCTAAGTGG + Intergenic
1044801124 8:95957531-95957553 TAATCTAGCCCAAATCTAAGGGG - Intergenic
1046866677 8:119158891-119158913 AAAGGTAGGACAACTCAAAGAGG + Intergenic
1049527965 8:143138602-143138624 GATTCCAGGCCAATTCTAAGTGG + Intergenic
1052380538 9:27766375-27766397 GGAGCTGTGCCAACTGTAAGAGG + Intergenic
1057382951 9:94585138-94585160 GAAGCTAGGCCAATACTCATTGG - Intronic
1058739757 9:107931076-107931098 GAAGCAAGGACAGCCCTAAGTGG - Intergenic
1187013047 X:15299339-15299361 GAAGGTTGGACAACTCAAAGTGG + Intronic
1189176120 X:38959128-38959150 AAAGGTAGGGCAACTCGAAGTGG + Intergenic
1191961519 X:66708013-66708035 GAAGCTAGGCTGGATCTAAGGGG - Intergenic
1200408225 Y:2836431-2836453 AAAGGTAGGGCAACTCAAAGTGG + Intergenic