ID: 999049608

View in Genome Browser
Species Human (GRCh38)
Location 5:148508187-148508209
Sequence TGATTAGTATTCAGCTGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999049608_999049609 12 Left 999049608 5:148508187-148508209 CCAGAACAGCTGAATACTAATCA 0: 1
1: 0
2: 0
3: 15
4: 152
Right 999049609 5:148508222-148508244 TTAAATGCTTGTTTCAAAGAAGG 0: 1
1: 1
2: 2
3: 40
4: 412

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999049608 Original CRISPR TGATTAGTATTCAGCTGTTC TGG (reversed) Intronic
905535731 1:38720400-38720422 TGATTAGCATTCTGGGGTTCTGG - Intergenic
907633780 1:56111901-56111923 TGCTTAGGATTTAGCTATTCAGG - Intergenic
908315719 1:62930374-62930396 TGACTTCTATTCAGTTGTTCAGG - Intergenic
908736829 1:67285280-67285302 AGATTCTGATTCAGCTGTTCTGG + Intergenic
909267532 1:73579732-73579754 CTATTAGAATTCAGCTGGTCTGG - Intergenic
910652466 1:89584217-89584239 TGCATAGTACTCAACTGTTCAGG - Exonic
912175042 1:107144367-107144389 TCATAAATATTCAGCTTTTCAGG - Intronic
912885740 1:113471927-113471949 TTATTAATATTTAGATGTTCTGG + Intronic
916369809 1:164079609-164079631 TGAATAGTCTTCTGTTGTTCTGG - Intergenic
917822009 1:178772603-178772625 TGTTTAGTTTCAAGCTGTTCAGG + Intronic
918747613 1:188225313-188225335 TACTTATTATTCATCTGTTCAGG + Intergenic
918873307 1:190005701-190005723 TGAGTAGTATTAATCTGCTCAGG - Intergenic
918921517 1:190717269-190717291 TAATTAATATTCAGCTATCCTGG + Intergenic
919149934 1:193683157-193683179 TGATTAGTATTCAGCAGAAATGG - Intergenic
922300470 1:224294989-224295011 AAAATAGTCTTCAGCTGTTCTGG + Intronic
922668756 1:227493552-227493574 AGATCAGTATTCAGCTGGCCTGG + Intergenic
922670840 1:227507747-227507769 AGATCAGTATTCAGCTGGCCTGG - Intergenic
923489516 1:234472001-234472023 TGATATGTATGCTGCTGTTCTGG - Intronic
924074074 1:240314947-240314969 TAATAACTATTCAGCTCTTCTGG + Intronic
1063505261 10:6592101-6592123 TGATTTGTATTCAGCTGAGATGG + Intergenic
1065066753 10:21975878-21975900 TGATTACTATTCAACTTTTTTGG + Intronic
1065503833 10:26409395-26409417 AGATTATGATTCAGCTGGTCGGG + Intergenic
1068242534 10:54322594-54322616 AGCTTAATATTCATCTGTTCAGG - Intronic
1069116441 10:64512611-64512633 TTATTAATATGCAGATGTTCAGG - Intergenic
1069158918 10:65066062-65066084 AGCTTATTATTCATCTGTTCAGG + Intergenic
1071068877 10:81668780-81668802 TGATTCATATTCAGCAGGTCTGG + Intergenic
1071131913 10:82404332-82404354 TGGGTAGGATGCAGCTGTTCAGG + Intronic
1072130468 10:92489180-92489202 TCCCTAGTATTCAGCTGTTCTGG - Intronic
1075113397 10:119606203-119606225 GGAATAGTATTCAGCTATTAAGG + Intergenic
1079647584 11:22885527-22885549 TGATATGTATTCTCCTGTTCTGG - Intergenic
1079944759 11:26728082-26728104 CCATTAGAATTCAGCTTTTCAGG + Intergenic
1080401430 11:31940023-31940045 AGATTAGCATTAATCTGTTCTGG + Intronic
1083582662 11:63835055-63835077 TGTTTTGTTTTCAGTTGTTCAGG + Intergenic
1083722679 11:64611238-64611260 TGTTTAGAACTCAGCTGCTCTGG - Intronic
1087523560 11:99277304-99277326 TTATTAGTATTCAACTGCTGGGG - Intronic
1089263842 11:117243030-117243052 TGCTGAGTAATCAGCTGTTTGGG + Intronic
1092624000 12:10305635-10305657 TGATGATTATTCAGCACTTCCGG + Intergenic
1093001757 12:14004766-14004788 TGCTTATTATTGATCTGTTCAGG + Intergenic
1093123232 12:15298728-15298750 TAATTATTATTGATCTGTTCAGG - Intronic
1099283214 12:80679538-80679560 GGGTTACTGTTCAGCTGTTCGGG - Exonic
1102108118 12:110343270-110343292 TGATTCCTGTTCAGCTGCTCTGG + Exonic
1105542085 13:21324596-21324618 TGAATCGTATTCTACTGTTCTGG - Intergenic
1107173969 13:37378580-37378602 TAATTAAAATTCAGCTGTACTGG + Intergenic
1109120971 13:58456798-58456820 AGTTCAGTATTCATCTGTTCAGG - Intergenic
1112153754 13:96794322-96794344 TGATAAGTATTCCTCTGTGCAGG + Intronic
1112201677 13:97282705-97282727 TCATTTGGCTTCAGCTGTTCTGG + Intronic
1112547488 13:100385745-100385767 TGCTGACTATTCAGCTATTCAGG - Intronic
1113881101 13:113626995-113627017 TGATTTAAATTCAGCTGTTCGGG + Intronic
1114332997 14:21657184-21657206 AGATTAGTTTTGGGCTGTTCTGG + Intergenic
1114489845 14:23093321-23093343 TGATTAGAATTCAACTGTCCTGG + Intronic
1114568579 14:23649876-23649898 TGATGAGTTTACAGCTCTTCAGG + Intergenic
1115080388 14:29443938-29443960 TGATTAGTATTCCATTGTCCTGG + Intergenic
1115410176 14:33065430-33065452 TGTTTAGTATTGAGATGTTTAGG + Intronic
1115977824 14:39016605-39016627 TGATAAGGATTCAGCTCTTAAGG + Intergenic
1120099056 14:80423395-80423417 TGTTTAATATTCATCTGTGCTGG - Intergenic
1120989475 14:90362586-90362608 AGATTAGTCTTCATCTGTTTGGG + Intergenic
1127339402 15:58025476-58025498 TGCTTGTTATTGAGCTGTTCAGG - Intronic
1132309178 15:100844379-100844401 GGATTTGGATCCAGCTGTTCGGG - Intergenic
1133855924 16:9549185-9549207 TGATGATAATTCTGCTGTTCTGG - Intergenic
1134353136 16:13456700-13456722 TCATTAGTCTTCAGCTTTTCTGG - Intergenic
1139132224 16:64160330-64160352 TGATTATGATTCAGCTGTCCTGG - Intergenic
1139162560 16:64528678-64528700 TGATTGAAACTCAGCTGTTCTGG - Intergenic
1140064261 16:71596886-71596908 TTATTATTATTGATCTGTTCAGG - Intergenic
1156441747 18:37196964-37196986 TAATTATTATTGATCTGTTCAGG + Intronic
1159241901 18:65751698-65751720 TAATTAGTATTCTGCTGATCTGG + Intronic
1159250876 18:65874932-65874954 TGTGTAGTGTTCAGCTGGTCTGG - Intronic
925070460 2:962963-962985 TCATCAGTATTCACCTTTTCTGG - Intronic
925910043 2:8567866-8567888 TGGTTAGAATGCAGCTGCTCAGG - Intergenic
927002845 2:18816848-18816870 TGAGTACTATTCATCTTTTCTGG - Intergenic
927816799 2:26224364-26224386 AGATCAGTATTCAGCTGATGTGG - Intronic
928056090 2:28056245-28056267 TGAGTAGATTTCAGCTGCTCTGG + Intronic
929175619 2:38972399-38972421 TGATGAGTATCCAGATGTACTGG + Intronic
930489862 2:52055609-52055631 TGAATAATATCCAGCTTTTCTGG + Intergenic
932895852 2:75638764-75638786 TGATTAGTCTTAACCTCTTCTGG + Intergenic
933758946 2:85661453-85661475 TGATGAGAACTCAGCTGTCCAGG - Exonic
937614071 2:123899188-123899210 TGCTTGTTATTCATCTGTTCAGG + Intergenic
938750592 2:134325654-134325676 AGATTAGTATTCACATTTTCAGG + Intronic
939264153 2:139850134-139850156 TAATTAGTATTTAGCTTTTAAGG - Intergenic
941364077 2:164589158-164589180 AGATTAGTATTCAACTCTTATGG + Intronic
943502611 2:188711037-188711059 TGAATACTATTCAGCTGTTACGG + Intergenic
943612701 2:190052260-190052282 TGAAAAGTATGCAGCTTTTCAGG + Intronic
943911761 2:193577904-193577926 TTATTATTATTCGTCTGTTCAGG - Intergenic
944603294 2:201325633-201325655 TGCTTGTTATTCACCTGTTCAGG - Intronic
945822466 2:214681354-214681376 AGATGAGTACTCAGCTTTTCTGG - Intergenic
947007815 2:225532563-225532585 TTCTTAGTTTTCAGCTGTTCTGG - Intronic
947504676 2:230698816-230698838 TTATTAGTATGCAGATGTTTTGG - Intergenic
948527751 2:238582673-238582695 TGATAAGTTTTCAGCTCATCTGG + Intergenic
1171317570 20:24209031-24209053 TGTGTTGTATTCACCTGTTCAGG - Intergenic
1178630065 21:34251825-34251847 AGATTTGTATTCAGTTGGTCTGG + Intergenic
1179328425 21:40374259-40374281 TGTTTGTTATTCTGCTGTTCTGG + Intronic
1182145887 22:27996461-27996483 TCAATATTGTTCAGCTGTTCAGG + Intronic
949192529 3:1267280-1267302 TGATTCATTTTCAGCTATTCAGG - Intronic
949707212 3:6832411-6832433 TGATAAGTATACAGCTTATCTGG + Intronic
950465612 3:13151600-13151622 TGGGTAGAATTCAGATGTTCAGG - Intergenic
951455607 3:22888910-22888932 TGAGTTATATTCAGCTCTTCAGG - Intergenic
952559616 3:34576054-34576076 TGATTATCATTCTGCAGTTCAGG + Intergenic
954466919 3:50660717-50660739 GGAATAGCATTCAGCAGTTCAGG + Intergenic
956879982 3:73500500-73500522 TGATTAGCATTCAGCAGTCCTGG - Intronic
957122483 3:76113254-76113276 TGTTTAGAATTCAGCTGCTTTGG - Intronic
957381112 3:79431060-79431082 TGGTTATTATTCTGCTGTTGTGG + Intronic
957779980 3:84806466-84806488 TGATTAGTATTCATTGTTTCTGG - Intergenic
961021066 3:123507402-123507424 TGAATAGTATTCCACTGTACAGG - Intronic
964248326 3:154681310-154681332 TGTTTATTATTCAGCTGTAATGG - Intergenic
964447969 3:156780507-156780529 TGATTAGCAATCAGCTGATTTGG + Intergenic
965216589 3:165871839-165871861 TGGTTGCTATTCGGCTGTTCAGG + Intergenic
966125798 3:176575038-176575060 TGATTATTATTCAGCTTTTGTGG - Intergenic
966755548 3:183367997-183368019 TGATTAGGATTTAGATTTTCTGG - Intronic
967651667 3:191993618-191993640 TGCTTATTATTGATCTGTTCAGG - Intergenic
968255750 3:197269573-197269595 TGATTAGAATTCAGAACTTCAGG - Intronic
970455704 4:16221853-16221875 CAATTAGTAATCAGCTTTTCTGG + Intronic
971847104 4:31933043-31933065 TTATTAGTATACAGCTTCTCTGG - Intergenic
972369339 4:38407880-38407902 TGATTAGTATTCATGTGAACTGG + Intergenic
973926960 4:55748569-55748591 TCCATATTATTCAGCTGTTCAGG + Intergenic
974572478 4:63670965-63670987 TGATTCATATTCTGATGTTCTGG + Intergenic
975200064 4:71576602-71576624 TACTTATTATTCATCTGTTCAGG - Intergenic
976028944 4:80727508-80727530 TGATTTGAATTCAGCTAGTCTGG - Intronic
976941463 4:90706559-90706581 TAATTAGGATTCAGCTGTTAGGG + Intronic
977770798 4:100856302-100856324 TGAGTAGTATTCCGCTATTTGGG + Intronic
978961956 4:114690775-114690797 CCAGCAGTATTCAGCTGTTCTGG - Intergenic
980239502 4:130155300-130155322 TGACTATCACTCAGCTGTTCAGG - Intergenic
981417850 4:144514105-144514127 GGTTTAACATTCAGCTGTTCAGG - Intergenic
982963434 4:161870814-161870836 TGATTAGTATCCAGCTGTCTGGG - Intronic
982968210 4:161943340-161943362 TTATTAGTTTTAAGATGTTCTGG + Intronic
983128451 4:163983871-163983893 AGATTAGTATTCAGCTACTCTGG - Intronic
986267088 5:6200259-6200281 TTATTATTATTAAACTGTTCAGG - Intergenic
988118186 5:26924360-26924382 TCATTATTATTCATCTGTTTAGG - Intronic
990602574 5:57375239-57375261 TGATTAGTATATGGCTGTTTGGG + Intergenic
990841619 5:60086557-60086579 TGATGAGTTTTCTGCTGTTATGG - Intronic
996630178 5:125622074-125622096 TGCTTAATATTCAGTTCTTCAGG - Intergenic
996642067 5:125767485-125767507 TTACTATTATTCATCTGTTCAGG + Intergenic
996802757 5:127421703-127421725 TGATTATTATCCTGCTTTTCAGG - Intronic
999049608 5:148508187-148508209 TGATTAGTATTCAGCTGTTCTGG - Intronic
1000012764 5:157248098-157248120 TGATTTTTATTCAGGTGTTTTGG + Intronic
1003279228 6:4677444-4677466 AGATTAGAATTCACCTGTTAAGG + Intergenic
1003410050 6:5854194-5854216 TGAATCATATTCTGCTGTTCTGG + Intergenic
1004637216 6:17480506-17480528 TAATAAGTATTGAGCTGTTGGGG + Intronic
1011972179 6:93239503-93239525 TGCTTAGTATTCATCATTTCAGG + Intergenic
1016228020 6:141764762-141764784 AGATTAATAATCAGCTTTTCAGG - Intergenic
1018533460 6:164793556-164793578 TGTTTAGTGTTCTGCTGTCCTGG + Intergenic
1018654320 6:166019361-166019383 TGATTAGTGTCCAGTTGCTCTGG + Intergenic
1022069260 7:26895504-26895526 TGCTTATTCTTCAGATGTTCTGG - Intronic
1022244943 7:28550284-28550306 TGTTTAGTGTTTAGCTCTTCAGG - Intronic
1024878178 7:54051870-54051892 AAATGATTATTCAGCTGTTCTGG + Intergenic
1027349720 7:77298540-77298562 TGCTTGGTATTGATCTGTTCAGG + Intronic
1027939632 7:84658560-84658582 TGATTAGAATGCAGCTGCACAGG + Intergenic
1028841371 7:95433399-95433421 AGATTCTGATTCAGCTGTTCTGG - Intronic
1032769940 7:135041817-135041839 TTATTACTATTCAGTTATTCTGG - Intronic
1033205912 7:139422394-139422416 TGTTTAGTTCACAGCTGTTCAGG + Exonic
1035552636 8:542054-542076 TGAATAGTATTCCACTGTTTGGG - Intronic
1036974164 8:13391355-13391377 CGAGTAGTATCCAGCTGTTCAGG - Intronic
1041936247 8:63335124-63335146 GGACTATTATTCAGTTGTTCAGG + Intergenic
1043965188 8:86466088-86466110 AGATTAGGATTCGGGTGTTCAGG - Intronic
1045249943 8:100474821-100474843 TGATTAGGATGCAGATGTTTTGG - Intergenic
1045480743 8:102590063-102590085 TGATTAGTAGGCAGCTTTTCTGG - Intergenic
1049961228 9:740273-740295 TGATTGGAATTCTGCTTTTCAGG + Intronic
1050905952 9:11005996-11006018 TGAATAGTATTCCACTGTTTAGG + Intergenic
1052205932 9:25839969-25839991 AGATTAGTATGCAGGTTTTCTGG + Intergenic
1052576251 9:30295299-30295321 TGATTACTATTTAGCTTTTAAGG - Intergenic
1052776721 9:32739954-32739976 CGAGTAGGATTCAACTGTTCAGG + Intergenic
1057918092 9:99072855-99072877 TGACTGCTATTCAGCTGTACTGG - Intergenic
1059713935 9:116895706-116895728 TGATCAGTATTTAGCCCTTCTGG - Intronic
1060163191 9:121386011-121386033 TGATTAGAATTCAGTTGTAGTGG + Intergenic
1185948643 X:4405593-4405615 TGATAATTATGCAGCTGTTTGGG + Intergenic
1186685384 X:11919873-11919895 GGATTAGTATTAAACTATTCTGG + Intergenic
1186849559 X:13567399-13567421 TGATTAGTATCCAAATGTTAAGG + Intergenic
1188151721 X:26684613-26684635 TCCATCGTATTCAGCTGTTCTGG - Intergenic
1188287458 X:28344912-28344934 TGGTTAGTATTCAGATATTATGG + Intergenic
1194934628 X:99933202-99933224 TAATTAGTATTGAGTTGTTGGGG - Intergenic