ID: 999050871

View in Genome Browser
Species Human (GRCh38)
Location 5:148522784-148522806
Sequence CTGGCTAAACAAACCTAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 6, 3: 18, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999050867_999050871 9 Left 999050867 5:148522752-148522774 CCAATAGAAAACATCAGGAGTAA 0: 1
1: 0
2: 1
3: 30
4: 277
Right 999050871 5:148522784-148522806 CTGGCTAAACAAACCTAGCAGGG 0: 1
1: 0
2: 6
3: 18
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999050871 Original CRISPR CTGGCTAAACAAACCTAGCA GGG Intronic
900804093 1:4755998-4756020 TTGGCTAAACTCACTTAGCAGGG + Intronic
900846637 1:5108547-5108569 CTGGCTAAACTAACTTAGCAAGG + Intergenic
901178159 1:7319963-7319985 CTGGGTAAATAAATTTAGCAAGG - Intronic
904203250 1:28835557-28835579 CTGGCAAAACAAGCCCAGCTGGG - Intronic
909196424 1:72631638-72631660 CTGGGGAAACAAACCTGGCTGGG + Intergenic
910950654 1:92644154-92644176 TGGGATAACCAAACCTAGCATGG + Intronic
911474520 1:98359252-98359274 CTGGCTAAAATGACTTAGCAGGG - Intergenic
912448642 1:109756534-109756556 CTGGACAAAAAAACCTAACAGGG - Intronic
915585426 1:156841472-156841494 CTGGCAGAACAACCCTACCAGGG - Exonic
916584500 1:166138589-166138611 TGGGCTAAAAAAACCTAACAAGG + Intronic
916842712 1:168616144-168616166 GTTGCTAAACTAACTTAGCAGGG - Intergenic
918732103 1:188012037-188012059 CTTGCTAAACTGACTTAGCATGG + Intergenic
922232577 1:223699718-223699740 CTAGCTAAACTGACTTAGCAGGG - Intergenic
922719978 1:227895380-227895402 CTGGCTAAACCCACCTCACAGGG + Intergenic
922767587 1:228163919-228163941 CTGGCTAAACCCACCTCACAGGG - Intergenic
922818242 1:228466482-228466504 CTGGGTAAACGAACCTCACATGG - Intergenic
924669125 1:246105199-246105221 CTGGCTAAATTGACTTAGCAGGG + Intronic
1069367455 10:67709572-67709594 CTTGCTAAACTGACTTAGCAGGG - Intergenic
1070064033 10:73016106-73016128 CTGGCTAACCTGACTTAGCAGGG - Intronic
1078708325 11:13766272-13766294 CTTGCTAAACTGACTTAGCAGGG + Intergenic
1079867429 11:25754689-25754711 CTGGCAAAATAATCTTAGCAAGG + Intergenic
1080413509 11:32048549-32048571 GTGGCTAAACAAATCAAACATGG - Intronic
1080492179 11:32777548-32777570 CTGGATTAACAACCCTAACAGGG + Intronic
1088208717 11:107427748-107427770 TTGACTAAACAAACATGGCAGGG - Intronic
1089593823 11:119561992-119562014 CTGGCCAAACTAACCTAATAAGG + Intergenic
1093305943 12:17518695-17518717 CTGGCAAAGCAGACCTAGCAAGG + Intergenic
1093698573 12:22191498-22191520 ATGGCTAAAGAAATGTAGCAAGG - Intronic
1094177180 12:27552991-27553013 CTTGCTAAACTGACTTAGCAGGG + Intronic
1095636862 12:44445159-44445181 CTGGCTGAACAAACCCACCTTGG - Intergenic
1097387095 12:58962984-58963006 CCGACTAAACAAACTTAGCAGGG - Intergenic
1098807803 12:75042246-75042268 CTGGCTAAACAATGCAAGCCTGG + Exonic
1100763753 12:97839389-97839411 CTTGCTAAACTGACTTAGCAGGG + Intergenic
1102637485 12:114336804-114336826 CTGGCTAACCTGACTTAGCAGGG - Intergenic
1103858251 12:123989990-123990012 CTGGCAAACCAAAGCAAGCAAGG - Intronic
1106094011 13:26626387-26626409 CTTGCTAAACACATTTAGCAGGG + Intronic
1107963360 13:45578092-45578114 CTTGTTAAACCAACTTAGCAGGG - Intronic
1108481236 13:50874097-50874119 CTTGCTAAACCAACTGAGCAGGG + Intergenic
1109089040 13:58015837-58015859 CTGGCTAGACTGACTTAGCAGGG - Intergenic
1112278706 13:98044266-98044288 CTGGCTAAACTGACTTAGCAGGG + Intergenic
1114676784 14:24446521-24446543 CTTGCTAAACTGACTTAGCAAGG - Intergenic
1115457606 14:33622891-33622913 CTCACCAAACATACCTAGCATGG - Intronic
1117087273 14:52214581-52214603 CTTGCTAAACTGACTTAGCAAGG - Intergenic
1117485607 14:56193947-56193969 CTAGCTAAGCAATCCTAGAAAGG - Intronic
1117709553 14:58511248-58511270 CTAGCTAAAGAAATCTAACAAGG - Intronic
1119570148 14:75662683-75662705 CTTGCTAGACAAACCTGGCCTGG - Intronic
1121831132 14:97053383-97053405 CAGGCTGAACAAACCTAGTGTGG + Intergenic
1122423370 14:101591096-101591118 CTGGCAAAACAGACCTACCTGGG - Intergenic
1129141945 15:73606894-73606916 CTTGCTAAACTGACTTAGCAAGG - Intronic
1136936147 16:34466598-34466620 CTGGCTTTTCAAACCTAGTAAGG + Intergenic
1136963674 16:34881972-34881994 CTGGCTTTTCAAACCTAGTAAGG - Intergenic
1137017477 16:35392452-35392474 CTGGCCAACCAGACCCAGCAAGG - Intergenic
1138255695 16:55557411-55557433 CTGAGAAAACAAGCCTAGCATGG - Intronic
1140877142 16:79163172-79163194 CTGTGTATACAAACCTAGGAGGG + Intronic
1144220756 17:13097721-13097743 CTGGCTAAACTGACTTACCAGGG + Intergenic
1144588206 17:16501795-16501817 CTTGCTAAACTGACTTAGCACGG - Intergenic
1146001022 17:29130592-29130614 CTGGCTAATCAAACTGACCAAGG + Intronic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1151997943 17:77622789-77622811 ATGGCTAAACAAACATACTATGG - Intergenic
1152124270 17:78437095-78437117 CTGGCAAAACACAGCTAGCTAGG - Intronic
1155295541 18:24381266-24381288 CTGGGTAAACCAAACTAACAGGG + Intronic
1159507457 18:69355834-69355856 CTTGCTAAACTGACTTAGCAGGG - Intergenic
1161062957 19:2224176-2224198 CAGGGTAAGCAAGCCTAGCACGG - Intronic
1164400018 19:27895969-27895991 CTGGGTAAAAAACCCCAGCAAGG - Intergenic
1164776996 19:30860660-30860682 CTGACTAAAGAAACCTAAGAAGG + Intergenic
925548977 2:5049692-5049714 CTGGCTAAAAAGCCCTAACAAGG - Intergenic
926911287 2:17853672-17853694 GTGGCTAAAGAAACCTAGCATGG - Intergenic
928408073 2:31030376-31030398 TTTGCTAAACATACCTAGAATGG - Intronic
928634702 2:33232118-33232140 CTGGCTCAACCATCCTAGGAGGG + Intronic
930176268 2:48304459-48304481 CTGGCTAAACTAACCTAAGAAGG - Intergenic
930554821 2:52882681-52882703 CTGATTAAACCAGCCTAGCAGGG + Intergenic
931768126 2:65474831-65474853 CTGGCTAAACCAATTTAGCCGGG + Intergenic
932986798 2:76736182-76736204 CTTGCTAAACTGACTTAGCAGGG - Intergenic
933242315 2:79935854-79935876 CTGGGTAAATAAACCTAAAAAGG - Intronic
934698178 2:96415662-96415684 CTGGCTAAACCAACTTAGCAGGG - Intergenic
938119170 2:128621915-128621937 CTTGCTAACCTGACCTAGCAAGG - Intergenic
938160435 2:128980386-128980408 CTAGCTAAACGGACCTAGGAGGG + Intergenic
940427138 2:153542678-153542700 CTGGCTAAACAACCCTATCAAGG + Intergenic
941196215 2:162455317-162455339 CTGGCAAACCAAATCCAGCAGGG - Intronic
945356099 2:208841390-208841412 TTTGCTAAACTAACTTAGCAGGG + Intronic
945922028 2:215764491-215764513 CTGGCTAAGCATAGCTAACATGG - Intergenic
946436829 2:219662635-219662657 CTGGCTCAACAAAGAAAGCATGG - Intergenic
948751846 2:240137658-240137680 CTGGCTAAACCAACTTAGCAGGG - Intergenic
1169013457 20:2271544-2271566 CTCTCTAAACAAACCAAGTATGG + Intergenic
1169760803 20:9091529-9091551 CTGGATACTCAAACCTAGGAAGG - Intronic
1172926720 20:38543918-38543940 CTGGCGAGACAACACTAGCACGG - Intronic
1179455839 21:41499433-41499455 CTGGCTAAACTGACTGAGCAAGG - Intronic
1179794588 21:43775761-43775783 CTGGCTAAACTGACTTAGCCAGG - Intronic
1181841418 22:25665590-25665612 CTGGCTAAACAGATATAGAATGG + Intronic
950989429 3:17416918-17416940 CTGGCTAAACAAACCTGGAAGGG + Intronic
954685535 3:52368190-52368212 CTGGCTAAACTGACTTAGCAGGG + Intronic
955302054 3:57789540-57789562 CTGGCTAAACTGACTTAGCAAGG + Intronic
956100540 3:65763431-65763453 CTGGCTGAAAAAAACTAGGAAGG + Intronic
957219371 3:77362511-77362533 CTTGCTAAACTGACTTAGCAGGG + Intronic
957314972 3:78565123-78565145 CAGGCCAAAAAAACCTAGGAAGG - Intergenic
959051573 3:101529385-101529407 CTTGCTAAACTGACTTAGCAGGG - Intergenic
959856977 3:111170793-111170815 CTTGCTAAACTAACTTAGCAGGG + Intronic
960924935 3:122785369-122785391 CTTGCTAAACTGACTTAGCAAGG - Intronic
962581748 3:136804301-136804323 CTTGCTAAACCAACTTAGCAGGG - Intergenic
963774404 3:149423354-149423376 CTTGCTAAACTGACTTAGCAGGG + Intergenic
964016050 3:151948134-151948156 CTGGCTAAACAGTCTTAACAGGG + Intergenic
964275129 3:155001380-155001402 CTTGCTAAACAGACTCAGCAGGG - Intergenic
964275149 3:155001492-155001514 CTGGCTAAACTTGCCTAACAGGG - Intergenic
964288692 3:155151143-155151165 CTGTCTAAACATACACAGCAAGG - Intronic
965681858 3:171260025-171260047 CTAGCTAAACTGACTTAGCAGGG - Intronic
977993676 4:103476374-103476396 CTTGCTAAACATAGTTAGCAAGG + Intergenic
978903329 4:113979147-113979169 CTGGAGAAAAAAACCAAGCAAGG + Exonic
979129650 4:117026409-117026431 CTTGCTAAACTGACTTAGCAGGG + Intergenic
980435959 4:132774208-132774230 CTGGGTGAACAAACATAGCAAGG + Intergenic
983426388 4:167589060-167589082 CTGGCCAAACCAACCTAACAGGG + Intergenic
987265323 5:16247321-16247343 CTGGATTATCAATCCTAGCAAGG + Intergenic
987854104 5:23396593-23396615 CTTGCTAAACTGACTTAGCAGGG - Intergenic
989006968 5:36826102-36826124 CTGCATAACCAAACCTAGCTTGG - Intergenic
992288626 5:75262067-75262089 CTTGCTAAACTGACTTAGCAGGG - Intergenic
993182282 5:84569849-84569871 CTGGATAAACAAATGTGGCATGG - Intergenic
993953361 5:94202048-94202070 CTGGCTAAACTGATTTAGCAAGG + Intronic
997219144 5:132144818-132144840 GAAGCTAAACAAACCCAGCATGG + Intergenic
999050871 5:148522784-148522806 CTGGCTAAACAAACCTAGCAGGG + Intronic
999466679 5:151813306-151813328 CTTTCAAAACAAACATAGCAGGG - Intergenic
1000299238 5:159940416-159940438 CTGGCTAAACCGAACTAACAGGG - Intronic
1001117636 5:168952968-168952990 CTGGCTAAAGCCACCTAACAAGG + Intronic
1001402825 5:171456163-171456185 CTTGCTAAACTGACTTAGCAGGG - Intronic
1001726037 5:173901077-173901099 CTGACTAATCAAGCCTAGAATGG + Intronic
1006210173 6:32386766-32386788 CTGGCTAGACAGTCCTAGCCTGG + Intergenic
1006253367 6:32809289-32809311 CTGGCTTAATAAAGCTAGCTTGG + Intergenic
1006592221 6:35166762-35166784 CAGACAAAACAAACATAGCAAGG - Intergenic
1007044558 6:38759647-38759669 CTTGCTAAACTGACTTAGCAGGG - Intronic
1013237596 6:108211150-108211172 TTGTTTAAACAAACTTAGCAAGG - Intergenic
1017045714 6:150345464-150345486 AAGGCTAAAGAAACTTAGCATGG - Intergenic
1019864748 7:3697161-3697183 TAAGATAAACAAACCTAGCATGG - Intronic
1019876615 7:3817633-3817655 CTGGCCATGCAAACATAGCAGGG + Intronic
1021253558 7:18361205-18361227 TTGTCTGATCAAACCTAGCAAGG + Intronic
1021827743 7:24572418-24572440 CTGGCTAGAAAAACATAGCAAGG - Intergenic
1022159583 7:27695721-27695743 CTTGCTAAACTGACTTAGCAGGG + Intergenic
1022378830 7:29840980-29841002 CTTGCTAAACCGACGTAGCAGGG + Intronic
1022439400 7:30420649-30420671 TTGCCTAAACAAACCCAGCCTGG - Intergenic
1026288667 7:68986375-68986397 CTTGCTAAACTGACTTAGCAGGG - Intergenic
1029296103 7:99541846-99541868 CTGTCGAAACAACCCGAGCAAGG + Intergenic
1033231245 7:139599902-139599924 CTTGCTAAACTGACTTAGCAAGG - Intronic
1033991044 7:147287374-147287396 CTTGCTAAACTGACTTAGCAGGG + Intronic
1033993000 7:147311101-147311123 CTGGCTAAACTGACTTCGCAGGG + Intronic
1035241909 7:157537764-157537786 CTGGCTAAACCCACCTAACAGGG - Intergenic
1035927389 8:3743089-3743111 CTGGATAAACAAACCTTTAAAGG + Intronic
1039230933 8:35447168-35447190 TTGGCTAAACTCACTTAGCAAGG + Intronic
1039733925 8:40309599-40309621 CTGGCTAAACTGACTTAGCAGGG - Intergenic
1039734251 8:40313927-40313949 CTGGCTAAACTGACTTAGCAGGG - Intergenic
1041652721 8:60316983-60317005 CAGGCTAAACTGACTTAGCAGGG - Intergenic
1042568979 8:70141996-70142018 CTGACTATACAGACCTAGAATGG + Intronic
1044123090 8:88422670-88422692 CTTGCTAAACTAACTTTGCAGGG - Intergenic
1045569318 8:103353176-103353198 CTGCCTAAACAAACCTGACCAGG + Intergenic
1045642518 8:104267453-104267475 CTGACTACATAAACCTGGCATGG - Intergenic
1046629930 8:116613303-116613325 CGGGAAAAACAAACCTGGCAGGG + Intergenic
1046774845 8:118153033-118153055 CTGGCTAAAGAGAGCTGGCAAGG + Intergenic
1048537117 8:135307258-135307280 CTTGCTAAACACACCTGGGAGGG - Intergenic
1050317210 9:4414728-4414750 CTGGCTAAAACAATTTAGCAGGG - Intergenic
1055804276 9:80075602-80075624 TTTGCTAAACTAACCTAGCAGGG - Intergenic
1057377033 9:94534482-94534504 CTTGCTAAACTGACTTAGCAGGG - Intergenic
1059306917 9:113360957-113360979 CTGGCTACACTGACTTAGCAGGG - Intronic
1059324495 9:113496035-113496057 CTGGCAAGACAAACCAAGAAGGG - Intronic
1062314928 9:135962226-135962248 CTGGCTAAACCGACCTGACAGGG - Intergenic
1186550253 X:10497374-10497396 CTGGCTAAACCAACTCAGCAGGG - Intronic
1186758599 X:12699893-12699915 CTGAATGAAGAAACCTAGCAAGG + Intronic
1189693208 X:43638069-43638091 CTGGCTAAATGAACCTAACTTGG + Intergenic
1190110198 X:47584378-47584400 CTTGCTAAACTGACTTAGCAAGG + Intronic
1192614237 X:72601578-72601600 CTGGCTAAACTGACTTAGCAGGG + Intronic
1194062281 X:89218485-89218507 CTGGCTAAACTGGCTTAGCAGGG - Intergenic
1194301874 X:92197830-92197852 CTGGGTAATCAAACCCACCATGG - Intronic
1194743215 X:97600529-97600551 CTGCCAAAACAAGTCTAGCAGGG + Exonic
1194770826 X:97902814-97902836 CTTGCTAAACTGACTTAGCAGGG - Intergenic
1195652370 X:107298533-107298555 CTTGCTAAACAGACTTAGCAGGG + Intergenic
1195850116 X:109273697-109273719 GTAACTAAACAAACCCAGCAGGG - Intergenic
1197011340 X:121568094-121568116 CTGACAAAACAAACCCAGGAAGG - Intergenic
1198522043 X:137462872-137462894 CTGGTTACACATACCTTGCATGG + Intergenic
1199915913 X:152340598-152340620 CTGGTTAAAGAATCCTAGGATGG + Intronic
1201707960 Y:16957601-16957623 CTGCCTAAAGAAACCTACAAAGG + Intergenic