ID: 999052051

View in Genome Browser
Species Human (GRCh38)
Location 5:148533518-148533540
Sequence CCTTAATTGCAGAAGGAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 195}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999052051_999052056 22 Left 999052051 5:148533518-148533540 CCGTGCTCCTTCTGCAATTAAGG 0: 1
1: 0
2: 1
3: 13
4: 195
Right 999052056 5:148533563-148533585 TGCCCTCCCAACCACAGAAAAGG 0: 1
1: 0
2: 2
3: 21
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999052051 Original CRISPR CCTTAATTGCAGAAGGAGCA CGG (reversed) Intronic
900393163 1:2442643-2442665 CCTTGGGTGCAGAAGCAGCATGG + Intronic
901932811 1:12607528-12607550 CCATCATGGCAGAAGGAGAAGGG - Intronic
904377061 1:30088316-30088338 CCTGGCCTGCAGAAGGAGCAGGG - Intergenic
905649416 1:39646543-39646565 CCTTACTTAGAGAAGGAGCTTGG - Intergenic
907929026 1:58981807-58981829 CCATTATTCCAGAAGGAGAAGGG - Intergenic
908170955 1:61504235-61504257 CCTTAATTGCAGAAAGTTTAGGG - Intergenic
908239529 1:62177064-62177086 CCTGAATTCCAAAAGGAGAATGG - Intergenic
908280326 1:62527193-62527215 TCTTAAAGGCAGAAGGATCAGGG - Intronic
909385673 1:75053574-75053596 CCTCAATTGCTTAAGGAGCTGGG - Intergenic
911407619 1:97462545-97462567 CCTGAATTTCAAAAGGAGGAGGG - Intronic
913212850 1:116595755-116595777 CCTTAAATACAGAAGCAGTAAGG - Intronic
915713162 1:157920408-157920430 CCTTCAGAGCTGAAGGAGCAAGG - Intergenic
916011896 1:160713852-160713874 CTTTTCTTGCTGAAGGAGCAGGG - Intergenic
919992115 1:202715225-202715247 ACTTCATTGCAGAAGGAAGAAGG - Intergenic
921625186 1:217372091-217372113 GCTTTATTGCAGAAGGAACATGG - Intergenic
922181034 1:223233042-223233064 TCCTAATTGCATAAGGAGCCTGG - Intronic
924162021 1:241242665-241242687 CCATTCTTGCAGAAGGAGTAAGG + Intronic
1063028069 10:2202549-2202571 CCTGAATTCCAGAGGGAGCAGGG + Intergenic
1069536794 10:69259693-69259715 CCATAATGGCAGAAGGTGAAGGG + Intronic
1070279460 10:75038072-75038094 TCTTACCTGCAGATGGAGCAGGG + Exonic
1070395629 10:76009351-76009373 ACTTAATTCCAAAAGAAGCAGGG - Intronic
1072566977 10:96624910-96624932 CCTAAATAGCAGAGGGAGTAGGG - Intronic
1073541624 10:104319869-104319891 CCTGAATTCCAGAGGGAGGAGGG - Intronic
1076480787 10:130784021-130784043 CCTTTATTGCAGACGGGGAAAGG - Intergenic
1076505244 10:130968367-130968389 CCTTCAATTCAGAATGAGCAAGG - Intergenic
1076559918 10:131355435-131355457 TCCAAATGGCAGAAGGAGCATGG - Intergenic
1077747448 11:4923180-4923202 CCTCAACTGCAGAATGAGCAAGG - Intronic
1077864826 11:6213486-6213508 ACGTAATACCAGAAGGAGCAAGG - Intronic
1078353714 11:10617330-10617352 CCACAAATACAGAAGGAGCAAGG + Intronic
1078393559 11:10957234-10957256 TCTTTATTGCAGCATGAGCATGG + Intergenic
1079842191 11:25417385-25417407 CCTTCTTGGCAGAAGAAGCATGG + Intergenic
1079908670 11:26281796-26281818 CCATAGTTGCAGAAGGACAATGG - Intergenic
1080810827 11:35702423-35702445 CCTTAATCGCAGAAACAGGAGGG - Intronic
1081506202 11:43719582-43719604 CCTTTATTGCACAAGGAGTGAGG - Intronic
1083560757 11:63671346-63671368 CCTTCAAAGCAGAAGCAGCAGGG + Exonic
1088655301 11:111993484-111993506 TCTTTATTGCAGAAAGAGCTGGG + Intronic
1089130317 11:116207218-116207240 CCTCCACTGCAGAACGAGCATGG + Intergenic
1089453674 11:118613429-118613451 CCTTAGTGGGAGAAGCAGCAAGG - Exonic
1089662837 11:119996745-119996767 CTTGGATTGCAGAAGCAGCAAGG - Intergenic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1090911311 11:131122001-131122023 CCTTAATTCCAGAAACAGCAGGG + Intergenic
1091271171 11:134312926-134312948 CCTCAAATGCAGACGGAGCCTGG + Intronic
1092895618 12:13007466-13007488 CCTGAATTCCAAAAGGAGGAAGG - Intergenic
1094544056 12:31387551-31387573 CCCTAGTTGGGGAAGGAGCAAGG + Exonic
1095957138 12:47813390-47813412 CCAGAATGGCAGGAGGAGCAGGG - Intronic
1096370889 12:51068051-51068073 CCATGATTGCAGAAGGTTCAAGG - Intronic
1099272996 12:80536635-80536657 CCTTAAGAGCAGAAGGAGAAAGG + Intronic
1099902346 12:88727356-88727378 CCTTTATGGCAGAAGGGGAAGGG - Intergenic
1104324715 12:127785356-127785378 CCCTACTCCCAGAAGGAGCATGG + Intergenic
1106894831 13:34288798-34288820 CCTAAATGACAGGAGGAGCAAGG + Intergenic
1110018612 13:70440373-70440395 ACTTAATAGTAGAAGGAGAAAGG + Intergenic
1110718316 13:78732846-78732868 CCTGAATTCCAGAGGGAGAAGGG - Intergenic
1112579134 13:100663471-100663493 TTTTAAGTGCAGAAGGGGCAAGG + Intronic
1113012839 13:105790274-105790296 CTTCAATTGCAGAAGTACCATGG - Intergenic
1114826728 14:26089895-26089917 CCTGAATTCCAAAAGGAGAAGGG - Intergenic
1115954440 14:38762437-38762459 CCTTTCTTGCAGATGGTGCATGG - Intergenic
1116609972 14:47056166-47056188 CCTTAATTGGAGAAAGGACAAGG + Intronic
1116664398 14:47756628-47756650 CCTTAACTACAGAAGGAAAAGGG + Intergenic
1119094474 14:71816307-71816329 CCTTAATTCCTGAAGGATCTGGG - Intergenic
1120101041 14:80445892-80445914 CACTCATTGCAGAAGGAGAAGGG - Intergenic
1120120788 14:80678516-80678538 CTTTAATTCCAGAAGGAAAATGG + Intronic
1121384634 14:93509062-93509084 CAATAATGGCAGAAGGTGCAGGG + Intronic
1121425011 14:93844331-93844353 CCTGAATTCCAAAAGGAGGAGGG + Intergenic
1122383424 14:101327051-101327073 CCTTAAATGAAGCAGGAGCCAGG - Intergenic
1122683165 14:103482577-103482599 CCTAAAGTTCAGAAGGAGCTGGG - Intronic
1123736786 15:23192502-23192524 CCTCAGTTGGGGAAGGAGCAAGG + Intergenic
1124064240 15:26324974-26324996 CCTGAATTCCAAAGGGAGCAGGG - Intergenic
1124287485 15:28415480-28415502 CCTCAGTTGGGGAAGGAGCAAGG + Intergenic
1124288007 15:28421182-28421204 CCTCAGTTGGGGAAGGAGCAAGG + Intergenic
1132329856 15:101004735-101004757 CCTGAACTGCAGAAGGAGCAGGG - Intronic
1133527392 16:6618887-6618909 CCTTAGATGAGGAAGGAGCAGGG + Intronic
1136062522 16:27736517-27736539 CCTGAACAGAAGAAGGAGCAAGG + Intronic
1138315479 16:56066035-56066057 CCCTAAAAGCAGCAGGAGCATGG + Intergenic
1140111447 16:72008746-72008768 GCTTAATGACGGAAGGAGCATGG + Exonic
1142398210 16:89845064-89845086 CCCTACTTGCAGAAGGATGATGG - Intronic
1143119999 17:4600497-4600519 CCTTAAAGGCACAAGGATCAAGG + Intronic
1145072230 17:19820496-19820518 CCATCATTGCAGAAAGAACAAGG - Intronic
1149377037 17:56054619-56054641 ACTTAATTGCAGACTGAGCATGG + Intergenic
1151929818 17:77225291-77225313 CCTTATTAGCAGAATGAGGATGG - Intergenic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1155374406 18:25139915-25139937 CCTTACTTGGTGAAGGGGCAAGG - Intronic
1155413243 18:25569035-25569057 CCTTAAATGAAGTAGAAGCAGGG + Intergenic
1155553340 18:26990867-26990889 CCTGAAGAGCAGAAGGAGGAAGG - Intronic
1155766143 18:29635423-29635445 GCTAAACTGCAAAAGGAGCAGGG - Intergenic
1157876886 18:51282072-51282094 CCTGAATTCCAAAAGGAGGAGGG + Intergenic
1159204890 18:65236620-65236642 GCTAAACTGCAGAAAGAGCATGG + Intergenic
1160543740 18:79639303-79639325 CCTGAATTCCAGAGGGAGGAGGG - Intergenic
1164709204 19:30343447-30343469 CCTCAACTGGAGATGGAGCAGGG - Intronic
1165249476 19:34517725-34517747 AGTTAACTGCAGCAGGAGCATGG - Intergenic
1167794985 19:51703211-51703233 CCTGAACTGAAGACGGAGCAGGG - Intergenic
1168411596 19:56143605-56143627 CCCAAGTTGCAGCAGGAGCAAGG - Intronic
928415848 2:31091032-31091054 CCTTCACTGCTGAAGGAGGAAGG - Intronic
928822470 2:35378090-35378112 CAATAAATGCAGAAGGAGTAAGG - Intergenic
930990680 2:57650506-57650528 CCTCAATTCCAGAGGGACCATGG - Intergenic
931222877 2:60304167-60304189 TCTTAATTGCAGAATGAGCCGGG - Intergenic
932772401 2:74507831-74507853 CCTTAATTACGGATTGAGCAGGG - Exonic
934014390 2:87863471-87863493 CCTTAATTCCAGAAGGGCCTAGG - Intergenic
934044471 2:88161041-88161063 GCCTGAGTGCAGAAGGAGCAGGG - Intergenic
937491837 2:122377592-122377614 CCTTATTTGCAAAATGAGGAGGG + Intergenic
937783650 2:125869631-125869653 CCTTTGTTTCAGAAGGAGCATGG + Intergenic
938109828 2:128556467-128556489 TCGTAATGGCAGAAGAAGCAAGG - Intergenic
938154847 2:128926292-128926314 CCTAAAATCCAGGAGGAGCAAGG - Intergenic
939933052 2:148256756-148256778 CCTTAAATGCTGAAGGCTCAGGG + Intronic
945671352 2:212806131-212806153 TCTTAGTGGCAGAAGGGGCAAGG - Intergenic
946389768 2:219408488-219408510 CCCTCCTTGGAGAAGGAGCAAGG + Intergenic
948669397 2:239558388-239558410 GCTTAATTGACCAAGGAGCAGGG - Intergenic
948710640 2:239822894-239822916 CCTTAATAGCAGTGGGAGAATGG + Intergenic
1168851440 20:979750-979772 CCCCAAATGCAGAAGGAGCTGGG - Intronic
1171165207 20:22964178-22964200 CCTGAATTCCAAAAGGAGGAGGG + Intergenic
1171245185 20:23605045-23605067 CATTAAGTGCAGACAGAGCAAGG + Intronic
1174145970 20:48452825-48452847 GCTTCTTTTCAGAAGGAGCAGGG - Intergenic
1175086990 20:56468256-56468278 CCTTAATCGCAGAAACAGGAGGG + Intergenic
1182805377 22:33065452-33065474 CCTTACGTGCTGAAGGAGGAGGG + Intergenic
1183710199 22:39498841-39498863 CCTTAGCTGCAGGGGGAGCAGGG - Intergenic
950622493 3:14216917-14216939 ACTTCATTGCAGAAAGAGCACGG + Intergenic
950818817 3:15736036-15736058 CCTTAACTGCAGTAGAGGCAAGG + Intronic
951466871 3:23010481-23010503 CCTACATGGCTGAAGGAGCAAGG - Intergenic
953465985 3:43119948-43119970 CTGGAATTGGAGAAGGAGCATGG - Intergenic
954655363 3:52191137-52191159 CCTGATATGGAGAAGGAGCATGG - Intergenic
955871056 3:63438913-63438935 TCTTCATTGCAGTAGGAGAAAGG - Intronic
957034967 3:75285557-75285579 CTGTAAATGCAGAATGAGCAGGG + Intergenic
958163894 3:89854102-89854124 CCTTTTTTGGAGAAGGAGTAGGG + Intergenic
958553315 3:95643512-95643534 CCTTGATTTCAGAAGGTGTATGG - Intergenic
960088599 3:113616308-113616330 CATTAGTGGGAGAAGGAGCATGG + Intronic
961078855 3:124007143-124007165 CTGTAAATGCAGAATGAGCAGGG + Intergenic
961304623 3:125949298-125949320 CTGTAAATGCAGAATGAGCAGGG - Intergenic
962337651 3:134550803-134550825 CCTTAAATGGAGAATAAGCAGGG + Intronic
963305610 3:143649142-143649164 TCTTAATTTCAGAGGCAGCATGG - Intronic
963419838 3:145047878-145047900 CCTAAATTGCAGAAAGAGTTTGG - Intergenic
964164931 3:153691742-153691764 CTTTAAGTGGAGAAGAAGCAAGG - Intergenic
964505063 3:157390624-157390646 CTTTAATTCAAGAAGGAGAATGG + Intronic
966721965 3:183072382-183072404 CTCTAATTGCAGATGGAGGAGGG + Exonic
968022922 3:195410890-195410912 CCTCAATGGCAGAAGGTGGAAGG - Intronic
968360345 3:198142670-198142692 CATAAAGTGGAGAAGGAGCAGGG - Intergenic
969116529 4:4873784-4873806 CCTTCATTCCAGGAGGAACAGGG + Intergenic
969828181 4:9774857-9774879 CCTTATTTGCAGAAGGAATGAGG - Intronic
970076472 4:12227506-12227528 CCTTATTAGCAGCAGGAGAATGG - Intergenic
971036895 4:22703387-22703409 CCTTATTTGCAAAATGAGAACGG + Intergenic
971191833 4:24435868-24435890 ACTAAATTGCAGAAAAAGCAGGG - Intergenic
971676975 4:29644268-29644290 CCTTAATTTCTGAAAGAGCCTGG + Intergenic
973971461 4:56217708-56217730 CCTGAATTGCAAAGGGAGGAAGG + Intronic
974122304 4:57654244-57654266 CAATCATTGCAGAAGGAGAAAGG + Intergenic
974688725 4:65267488-65267510 CCTTAATTCCTGAAGGATCTAGG - Intergenic
978408648 4:108405687-108405709 CCTAAATTTCAGAAGATGCATGG - Intergenic
979737546 4:124105543-124105565 CTTTAATTCAAGAAGGAGAATGG - Intergenic
980265996 4:130516654-130516676 CCTGAATTGCTGCTGGAGCAAGG + Intergenic
980538038 4:134154707-134154729 ACTTAAATTCAGAATGAGCAAGG - Intergenic
982415013 4:155120769-155120791 CCTGAATTCCAAAAGGAGGAAGG - Intergenic
982679361 4:158410406-158410428 TCTTAATTGTAGGAGGAGCTGGG + Intronic
984463092 4:180059606-180059628 CCTTCCGTGCAGAAGGAGCAAGG - Intergenic
989304265 5:39933648-39933670 TCTTAATAGCAGAAAGACCAAGG - Intergenic
990020577 5:51122074-51122096 CCGTATTTGCAGGAGGAGCCTGG + Intergenic
993272005 5:85808756-85808778 CCTGAATTTCAAAAGGAGGAGGG + Intergenic
994649609 5:102510189-102510211 CCTTAATTCCACAAAGAACAAGG + Intergenic
994867384 5:105293650-105293672 CCTGAATTCCAAAAGGAGGAGGG - Intergenic
995369269 5:111400619-111400641 CCAGAAAAGCAGAAGGAGCAAGG - Intronic
996612958 5:125406000-125406022 CCTTTATAGCAGCAGGAGAACGG - Intergenic
999052051 5:148533518-148533540 CCTTAATTGCAGAAGGAGCACGG - Intronic
999128064 5:149261316-149261338 CCTTTACTGCAGCAGGATCATGG - Intergenic
999207067 5:149856692-149856714 CCTGATTTGCAGAAGCAGTATGG + Intergenic
999903021 5:156107351-156107373 CATAAATTGCAGAAGGTTCACGG + Intronic
999925289 5:156369277-156369299 CCTTAAGTGTACCAGGAGCAAGG + Intronic
1002363752 5:178694499-178694521 CTTTAATTGTAGAAAGACCATGG - Intergenic
1003707800 6:8554130-8554152 CCTTGATTACAGAAGGTGCTAGG + Intergenic
1005132913 6:22532314-22532336 CTTTAACTTCAGAAGGAACATGG + Intergenic
1010034361 6:71306344-71306366 ACTAGAATGCAGAAGGAGCAGGG - Exonic
1013168309 6:107614100-107614122 CCTTAAGTACAGTAGGAGTAAGG + Intronic
1014475794 6:121871311-121871333 CCTTATTTGCAGCATGAGAACGG - Intergenic
1014779401 6:125546312-125546334 CCAGAATTGCAGAATAAGCAAGG - Intergenic
1015680265 6:135799657-135799679 CATTAATGGCAGAAGGTGAAGGG - Intergenic
1017102113 6:150857991-150858013 CCCCAAATGCAGAAGGAGCCTGG - Intergenic
1019259657 7:73962-73984 CATAAAGTGGAGAAGGAGCAGGG + Intergenic
1021595758 7:22314928-22314950 CCTTGAGTGCATAAGGAGCAGGG - Intronic
1024034511 7:45495806-45495828 CCTGAATTCCAGAGGGAGGAGGG + Intergenic
1026406757 7:70073772-70073794 CCTTAGTTGTATAAGGAGGAAGG - Intronic
1027233507 7:76284950-76284972 CCTTGATTGCAGAGGGGACAGGG + Intronic
1032592268 7:133202707-133202729 CCATAGATGCAGAAGGAACAGGG + Intergenic
1034040577 7:147873295-147873317 CCTTATTAGCAGAATGAGAATGG - Intronic
1040603240 8:48904864-48904886 CCTTATTTGCAGAACCAGTAAGG + Intergenic
1040814089 8:51488597-51488619 CCTAAATTCCAGAATGAGGAAGG - Intronic
1042427432 8:68664340-68664362 CCTAAATGGCATAAGGAGTAAGG + Intronic
1043198783 8:77335985-77336007 CCTTATTTGGAGATGGAGCTAGG - Intergenic
1044141731 8:88663258-88663280 CATTAATTGAAAATGGAGCATGG + Intergenic
1044529872 8:93294797-93294819 CCTTATTTGCAGGAGCAGCATGG + Intergenic
1046522508 8:115343453-115343475 CCTTTTTTGCAGAAGGAAAATGG - Intergenic
1046571891 8:115976509-115976531 CTTTAATTGCAGGAGGAGGGTGG + Intergenic
1050063931 9:1738850-1738872 CCTAATTTGGAGAAGGAGGAGGG - Intergenic
1052171047 9:25396938-25396960 CCTGAATTCCAAAAGGAGAAGGG - Intergenic
1053449834 9:38184160-38184182 CCCTCATGGCAGAAGGAGAAGGG + Intergenic
1056784320 9:89579204-89579226 CCTTATTAGCAGAATGAGAATGG - Intergenic
1057204865 9:93165240-93165262 CCTTATTTGCAAAAGCAGAATGG + Intergenic
1057669547 9:97076401-97076423 CCTTCATTGGAGGAGGAGCTGGG + Intergenic
1058656528 9:107226980-107227002 ACTTATGTGCAGAAGGAGGATGG + Intergenic
1060934233 9:127506374-127506396 CCCTAACTGCGGAAGGAGCAGGG + Exonic
1062745044 9:138206500-138206522 CATAAAGTGGAGAAGGAGCAGGG - Intergenic
1186466864 X:9790147-9790169 CCTTGATTGCAGAGGGCACAGGG + Intronic
1187675338 X:21710900-21710922 TCTTCTTTGCAGAAGGAGCCAGG + Intronic
1188672435 X:32896131-32896153 CCTTTATTGCAAAAGCATCAGGG - Intronic
1190171003 X:48111627-48111649 CTGTAAATGGAGAAGGAGCAGGG + Intergenic
1191126787 X:56964380-56964402 CCTTAATTCCAGAAAAAACAAGG + Intergenic
1192230386 X:69260592-69260614 CCTCAGTAGCAGAAGGGGCAAGG + Intergenic
1194570614 X:95550392-95550414 CCTTAAATGAAGAAGGGGCCTGG - Intergenic
1194737350 X:97528465-97528487 CATTTATGGCAGAAGGAGAAGGG + Intronic
1196885632 X:120242919-120242941 CCTTATTTGCAGGAGCAGAATGG - Intergenic
1198790240 X:140337366-140337388 CCTTATTTGCTGAAGGTGAAGGG + Intergenic
1199057517 X:143315826-143315848 CATTACTTAGAGAAGGAGCAAGG + Intergenic
1199130084 X:144175002-144175024 CCTTAATTCCAGAAGGGCCTAGG + Intergenic
1201263937 Y:12187727-12187749 CCTGAATTCCAAAAGGAGAAGGG - Intergenic
1201622819 Y:15979497-15979519 CTTTAACTCCAGTAGGAGCAAGG + Intergenic
1201896741 Y:18999970-18999992 CCTGACTTGGAGAAGGAACATGG - Intergenic