ID: 999052852

View in Genome Browser
Species Human (GRCh38)
Location 5:148542687-148542709
Sequence TACAGCATGTTCAGAGAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 247}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999052852 Original CRISPR TACAGCATGTTCAGAGAAAG GGG Intronic
902242672 1:15099452-15099474 GACAGCAAATTCAGAGAAAAGGG + Intronic
902248586 1:15138324-15138346 TCCAGCATCTGCAGAGACAGCGG + Intergenic
905953879 1:41975895-41975917 CACAGCATGTTCAGAGATCAAGG + Intronic
908297267 1:62725241-62725263 TACAGCATTATCAGAGAAAATGG - Intergenic
908374414 1:63520414-63520436 TTCAGAATGTACACAGAAAGAGG + Intronic
909854983 1:80517505-80517527 TTCAGCATGGTCACAGAAACAGG - Intergenic
910653670 1:89598475-89598497 TACTGCATTTTCAGAGAATATGG - Intergenic
910704289 1:90110568-90110590 AACAGACTGTTCACAGAAAGTGG - Intergenic
912163582 1:107015374-107015396 TAAAGCATTTTTAGAGAAACAGG + Intergenic
912594866 1:110864585-110864607 TACAGCATCTTCAAAGACTGAGG + Intergenic
912653704 1:111465716-111465738 TACAGGCTGGTCAGAGAATGTGG + Intergenic
912746347 1:112248598-112248620 CACAGCATGTCCAGATACAGAGG + Intergenic
913149366 1:116025406-116025428 GACAGCATGTTCAGAATATGTGG - Intronic
913157149 1:116111062-116111084 AATTGCAAGTTCAGAGAAAGAGG + Intergenic
915590768 1:156868905-156868927 AACACCATGTTCCCAGAAAGGGG - Intronic
916556551 1:165898832-165898854 GGCAGCCTGTTCAGAGAAGGCGG - Intronic
916948240 1:169752109-169752131 GAAACCATGTTCTGAGAAAGGGG - Intronic
917552988 1:176054926-176054948 TACAGCATTTTCAGAGGTGGAGG - Intronic
918249256 1:182686850-182686872 TACAGGAGGAGCAGAGAAAGAGG + Intergenic
919042077 1:192401893-192401915 TACAGCATCTATAGATAAAGAGG - Intergenic
919080532 1:192860532-192860554 TGCAGGGAGTTCAGAGAAAGGGG - Intergenic
919170883 1:193952602-193952624 TGCTGCATGGTCTGAGAAAGAGG + Intergenic
922765298 1:228153219-228153241 TACAGCACTTTCACAGAAAAGGG + Intronic
1064937388 10:20693153-20693175 TACAGCATTTTCTAGGAAAGGGG - Intergenic
1066554492 10:36596414-36596436 TAGAACATGTTCAGTGCAAGTGG + Intergenic
1067389764 10:45852466-45852488 AACAGCAGGTTTAGAGGAAGAGG + Intronic
1067873501 10:49983579-49983601 AACAGCAGGTTTAGAGGAAGAGG - Intronic
1068218557 10:54013554-54013576 TGCACCATGTTCAGAGAGTGTGG - Intronic
1068929844 10:62578367-62578389 TACAGCATGTGGAAAGAGAGGGG - Intronic
1069788295 10:71003845-71003867 TACAGCCTCTTCCCAGAAAGAGG + Intergenic
1070677639 10:78423240-78423262 TACAGCATGTTGAGAGAAGCAGG - Intergenic
1073769506 10:106720055-106720077 TAGAGAGTGATCAGAGAAAGAGG - Intronic
1074968015 10:118510002-118510024 TACAGCAAGTTAAGTGAAAGGGG - Intergenic
1075166929 10:120077054-120077076 AACGGCATTTTCAGAGGAAGTGG + Intergenic
1076580088 10:131501691-131501713 TGCAGAATGTTCAGAAAATGAGG - Intergenic
1077964255 11:7110907-7110929 TACAACATTTTCAGGAAAAGAGG - Intergenic
1079276018 11:19038414-19038436 TACAGCCTCTTCCTAGAAAGAGG + Intergenic
1079665366 11:23098149-23098171 TAGTGCATGTTCAGTGAAAAGGG + Intergenic
1081186154 11:40045014-40045036 TTCAGAATGACCAGAGAAAGTGG - Intergenic
1081304453 11:41494574-41494596 TGAAGCAGGTGCAGAGAAAGAGG - Intergenic
1082857681 11:57823482-57823504 TTCATCATGTTAAGAGAAAAAGG + Intergenic
1084992073 11:72935787-72935809 TACTTCATGTTCTGTGAAAGAGG + Intronic
1086640473 11:89148795-89148817 CAAAGCATGTTCTAAGAAAGAGG - Intergenic
1087861024 11:103156668-103156690 TAAATCATATTCAGAGAAAGTGG + Exonic
1088970104 11:114766455-114766477 TAGAGCATTTCTAGAGAAAGAGG - Intergenic
1089020401 11:115208370-115208392 TTCAGAGTGTTCAAAGAAAGAGG - Intronic
1089665891 11:120018738-120018760 TACTCCATTTTCAGAGACAGAGG + Intergenic
1091152860 11:133344846-133344868 TACATTATTTTCAGGGAAAGAGG - Intronic
1091372051 11:135068964-135068986 GACAGAATGGTGAGAGAAAGAGG - Intergenic
1093993495 12:25616157-25616179 TAAAGCAGGGTAAGAGAAAGAGG + Intronic
1095854026 12:46841196-46841218 TAAAACCTGTTCAGAGAAAAAGG + Intergenic
1096587391 12:52631660-52631682 TGCAGCATGCTGAGATAAAGGGG + Intergenic
1097804453 12:63950246-63950268 GAAAGCATCTTCAGAGAGAGAGG + Intronic
1098335879 12:69403995-69404017 TACAGAATGAACAGAGGAAGAGG - Intergenic
1098407583 12:70142282-70142304 TACAGAGTGTTAAGTGAAAGTGG + Intergenic
1098882774 12:75933452-75933474 TTTAGGATATTCAGAGAAAGAGG - Intergenic
1099759134 12:86895073-86895095 TTCAGCATTCTCAAAGAAAGGGG + Intergenic
1100351654 12:93789317-93789339 CACAGCCTGTTCAGGAAAAGTGG - Intronic
1107030911 13:35852974-35852996 GACAGAATGTTCTCAGAAAGAGG + Intronic
1109130605 13:58579701-58579723 TACAGCATGTTCTGAGAAGCAGG - Intergenic
1109706138 13:66094940-66094962 CACAGAAGGTTCAGAAAAAGAGG + Intergenic
1110683167 13:78340396-78340418 TAATGCATGTTGAGAAAAAGTGG - Intergenic
1111544291 13:89710269-89710291 CACAGCATATTGGGAGAAAGAGG - Intergenic
1113727849 13:112618358-112618380 TATAGCATGTCCTGTGAAAGAGG - Intergenic
1114811794 14:25909303-25909325 TACAGTCTGTCCAGACAAAGAGG + Intergenic
1114933847 14:27508044-27508066 TATATAAAGTTCAGAGAAAGAGG - Intergenic
1115304057 14:31915717-31915739 TACAGGATGAGCAGAAAAAGCGG - Intergenic
1116337217 14:43672012-43672034 GAATGCAGGTTCAGAGAAAGGGG + Intergenic
1116856973 14:49961170-49961192 TACTGTATTTTCAGAGAAGGCGG + Intergenic
1117235953 14:53774790-53774812 TGCAGCATATTTAGAGAATGTGG + Intergenic
1118690115 14:68330179-68330201 TTCTGCATGTTCAGAGGATGTGG + Intronic
1118706737 14:68487017-68487039 GACTGCCTGTTCAGAGAAAGTGG + Intronic
1119298138 14:73549778-73549800 TTCAGCATGTGCAAAGAAGGTGG - Intronic
1119302427 14:73581962-73581984 TTCAGCATGTGCAAAGAAGGTGG - Intergenic
1120176761 14:81302703-81302725 TACAGCATGTCAAGAGACAGCGG + Intronic
1125306069 15:38316166-38316188 TACACCAGGTTAAGAGACAGCGG - Intronic
1125589644 15:40846271-40846293 AACAGCAGGTAGAGAGAAAGGGG - Intronic
1126170757 15:45693395-45693417 TTCTGCATTTTCAGAGAATGGGG + Intergenic
1127123064 15:55787619-55787641 TTCAGCATTTACAGAGAGAGAGG - Intergenic
1127227544 15:56948796-56948818 TACAGCAAGATGAGTGAAAGTGG - Intronic
1128396708 15:67233681-67233703 TACACCATTCTCACAGAAAGTGG + Intronic
1128538948 15:68511647-68511669 TACAGAATGAGCAGAGGAAGAGG + Intergenic
1128687982 15:69701050-69701072 TACAGGCTGTTCAGAGGGAGAGG - Intergenic
1130984152 15:88833840-88833862 TCCAGCTTGTTCAGAGAGTGAGG + Intronic
1131652028 15:94410473-94410495 TCCAGCACTTTCAGAGACAGAGG + Intronic
1132735762 16:1385153-1385175 TACAGCATGAACACAGAAGGAGG + Intronic
1133490793 16:6265908-6265930 TGCTGCATGTGAAGAGAAAGTGG - Intronic
1137342887 16:47627390-47627412 TACAGCAAGTACTTAGAAAGGGG + Intronic
1138332996 16:56230313-56230335 CACAGCTTGTCCAGAGGAAGCGG + Intronic
1138354957 16:56370280-56370302 TACATCATGTTAGGTGAAAGAGG + Intronic
1138394590 16:56694290-56694312 TACAGCATGTAAATGGAAAGAGG - Intronic
1139530804 16:67541855-67541877 CGCAGCATGTTCTGAGAAAGAGG - Exonic
1140588544 16:76323677-76323699 TGCAGCATGTTCTAAGGAAGGGG - Intronic
1141496037 16:84410259-84410281 TGCAGCATGTTCAGTGAAAATGG + Intronic
1141821401 16:86448647-86448669 AACGGCATGTTCAGAGTAAGTGG - Intergenic
1143241381 17:5445793-5445815 AGCAGCAGGTCCAGAGAAAGTGG + Intronic
1143555538 17:7657450-7657472 TACAGAATATTCAGAGCAGGAGG - Exonic
1144116149 17:12093114-12093136 GACAAAATGTTCAGAGAATGTGG + Intronic
1144297203 17:13887386-13887408 TAAAGCAAGGTCAGAGAATGAGG + Intergenic
1144310587 17:14010690-14010712 TACAGAATGATGAGAGACAGGGG - Intergenic
1145275514 17:21427028-21427050 CACAGCTGGTTCAGAGCAAGGGG - Intergenic
1145711813 17:26984878-26984900 CACAGCTGGTTCAGAGCAAGGGG - Intergenic
1148218608 17:45847424-45847446 AACAGCATATGCAGAGAGAGCGG - Intergenic
1148572352 17:48680289-48680311 AAAAGAATGTTCAGAGAAACTGG - Intergenic
1149438793 17:56657279-56657301 GACAGCATGTTTATGGAAAGTGG + Intergenic
1150109786 17:62488602-62488624 TTCAGAAATTTCAGAGAAAGAGG - Intronic
1153055870 18:945756-945778 TAGAGCATTCTCTGAGAAAGGGG - Intergenic
1153916051 18:9745652-9745674 TACACCATATTAATAGAAAGAGG + Intronic
1153932496 18:9890683-9890705 TACTGCATTTTCATAGAAATGGG + Intergenic
1156962764 18:43052836-43052858 CAAAGCAAGTGCAGAGAAAGTGG + Intronic
1157149420 18:45201235-45201257 TACAGCATGCTCAGGGGAAAGGG - Intergenic
1158336989 18:56423140-56423162 TAAAGCATCCTTAGAGAAAGTGG + Intergenic
1158759613 18:60369077-60369099 TAGAGCAGATGCAGAGAAAGTGG - Intergenic
1158962771 18:62600495-62600517 TACAGCATGTTCTGAGGCAGAGG + Intergenic
1165301621 19:34973390-34973412 GACAGCATTTTGACAGAAAGGGG - Intergenic
925248619 2:2409334-2409356 TACAGCAACAGCAGAGAAAGAGG - Intergenic
926795961 2:16618964-16618986 CACAGCATGAACAGTGAAAGAGG + Intronic
927346455 2:22049043-22049065 AACAGGATGTTTAGTGAAAGAGG - Intergenic
928915836 2:36469267-36469289 TGAAGTAAGTTCAGAGAAAGGGG + Intronic
931707773 2:64961778-64961800 TACAGGATCTTTAGACAAAGGGG - Intergenic
932325073 2:70853845-70853867 TAAAGCAAGTTCTGAGAAGGAGG - Intergenic
932452505 2:71822282-71822304 GACATCATGTTCAGGGAAATAGG - Intergenic
933740009 2:85525846-85525868 GACAGCAACATCAGAGAAAGTGG - Intergenic
935498666 2:103811397-103811419 GAAAGCATGTTTAGAGGAAGAGG - Intergenic
935550595 2:104449370-104449392 TACAGTATTTTCATAGAAAATGG + Intergenic
935555759 2:104508206-104508228 CACACTGTGTTCAGAGAAAGGGG - Intergenic
935586330 2:104803118-104803140 TACAGCTTGTCCAGAGGAGGGGG + Intergenic
937535518 2:122882077-122882099 TCCAGGATGTCCAGAGAAAATGG + Intergenic
940027078 2:149219640-149219662 TACTGGAGGTTCAGAGAGAGAGG + Intergenic
940617653 2:156070234-156070256 TACAGCATTATCAGAGAAAATGG + Intergenic
940814641 2:158284676-158284698 TGCAGCATGTTCATTGGAAGAGG + Intronic
940997004 2:160160232-160160254 TACAGAATGCTCAGATAAATTGG + Intronic
941135409 2:161711443-161711465 TACCTCAGGTTCTGAGAAAGCGG + Intronic
941863348 2:170308166-170308188 CACAGCATGTTCTGAGACAATGG - Intronic
942201956 2:173580166-173580188 TACCAGAAGTTCAGAGAAAGGGG + Intergenic
942432456 2:175927100-175927122 TACAGGACGTTGAGAGCAAGAGG + Exonic
943508108 2:188787311-188787333 CATAACATGTTCAGAAAAAGTGG + Intronic
943803633 2:192093598-192093620 TTCAGCAACTTCAAAGAAAGAGG - Intronic
944496150 2:200308045-200308067 TAGAACCTGTGCAGAGAAAGTGG + Intronic
944633275 2:201649503-201649525 TACAGCATGTGCACAAAAAATGG + Intronic
944715685 2:202374955-202374977 TACATCAAATTCAGATAAAGAGG + Intergenic
945423373 2:209666983-209667005 TACAGTATGTAAATAGAAAGTGG + Intronic
946135848 2:217646370-217646392 TACAGGATGTGCAGGAAAAGGGG - Intronic
1169685853 20:8270534-8270556 TACAGCATCTTCAGTTAATGAGG + Intronic
1170004840 20:11655463-11655485 TACTGAGTGTTCAGAGACAGAGG + Intergenic
1170699938 20:18694919-18694941 TACAGTATGTGAAGAAAAAGTGG + Intronic
1172944554 20:38677080-38677102 TACAGGATGTCCAGTGACAGGGG - Intergenic
1173825677 20:46046256-46046278 AACAGCATGGGCAGAGAAAGGGG - Intronic
1175382748 20:58575073-58575095 CACAGCATGAGCTGAGAAAGGGG + Intergenic
1176031234 20:63013595-63013617 TACAGCATTTGCAGAAATAGAGG - Intergenic
1176790851 21:13317354-13317376 TAAAGCACATTCAGAGAAATAGG - Intergenic
1177182741 21:17760528-17760550 ACCAGCACGTTCAGAAAAAGGGG + Intergenic
1177802875 21:25845519-25845541 TACAGCATCTACAGAGCAGGTGG - Intergenic
1177990939 21:28036014-28036036 TAAAGCACATTCAGAGAAATAGG + Intergenic
1178178012 21:30127336-30127358 GACTGCATTTTCAGAGAATGTGG - Intergenic
1178328919 21:31669683-31669705 AACAGTATGTTCACAGTAAGTGG + Intergenic
1179297907 21:40079660-40079682 GAAATCATATTCAGAGAAAGAGG - Intronic
1181404247 22:22670955-22670977 TGCAGCAGGCTCAGAGAAAAGGG + Intergenic
1182802361 22:33041883-33041905 TACAGCATGATCTGGGAGAGAGG - Intronic
1184329026 22:43814139-43814161 TAGAGCATGTTCCAAGAAGGAGG - Intergenic
1184898032 22:47423667-47423689 TACAGCACGTTCAGTGACTGTGG + Intergenic
949365865 3:3279966-3279988 TGGAGCATTTTCAGAGAAGGGGG + Intergenic
949446785 3:4143644-4143666 TTGAGAATGTACAGAGAAAGGGG + Intronic
953395476 3:42566131-42566153 TTCAGCATGTCCAGAGAAAGGGG + Intronic
954427851 3:50452969-50452991 TGCATCATCTTCAGACAAAGAGG - Intronic
955163597 3:56489028-56489050 AACAGCATGTGCTGAGTAAGAGG + Intergenic
956254482 3:67269366-67269388 TAGATGATGCTCAGAGAAAGAGG + Intergenic
956782920 3:72618587-72618609 TACATGATGTGCAGAGAACGGGG - Intergenic
957854478 3:85856401-85856423 TACAGCAGGTTTAGAGAAACTGG - Intronic
958091086 3:88876983-88877005 TACAGTATAGTCAGAGTAAGTGG - Intergenic
958429905 3:94026313-94026335 TTCTGTATGTTTAGAGAAAGAGG + Intronic
960611981 3:119562965-119562987 GACAGCATTTTAAGAGGAAGAGG - Intergenic
960869752 3:122236743-122236765 TAGAGCATGTTAACAGAAATTGG - Intronic
962025184 3:131540424-131540446 TAAAGCCTGTCCAAAGAAAGTGG + Intronic
962035591 3:131648120-131648142 CACAGCATTTTCAGAGGCAGAGG + Intronic
964532544 3:157683974-157683996 TACAACATGTTGATATAAAGGGG + Intergenic
965191786 3:165539955-165539977 TGCAGCATGTGCACAGAAAGGGG - Intergenic
968282395 3:197486941-197486963 TGCAACATCTTCAGAGAAAGTGG + Intergenic
968320069 3:197758741-197758763 TACTGAATGTACAGAGATAGAGG + Intronic
969072303 4:4549299-4549321 TGCTGCATGGTCAGAGTAAGGGG - Intergenic
974979298 4:68934619-68934641 CCCAGCATTTTCAGAGACAGAGG + Intronic
979972257 4:127149949-127149971 TACAGCATGTTCAGATCAGAGGG + Intergenic
980267994 4:130545007-130545029 TACAGTATTTTCAAAGTAAGTGG - Intergenic
981206970 4:142053595-142053617 TAAAGTATTTTCTGAGAAAGTGG - Intronic
981685175 4:147446395-147446417 TACAGCATCTTCATGCAAAGTGG - Intergenic
984565203 4:181321501-181321523 TACAGGTTGTTCAGAGGAAATGG - Intergenic
986346040 5:6836368-6836390 ATGAGGATGTTCAGAGAAAGTGG - Intergenic
986802064 5:11271634-11271656 TACTTCATATTCAGATAAAGAGG + Intronic
987490607 5:18576303-18576325 CACAGCATGTTAAAAAAAAGTGG - Intergenic
988836523 5:35037917-35037939 TACAGCAAGTTCAGACAACTTGG - Intronic
991525355 5:67550676-67550698 TACTGCATCTTCAGCTAAAGAGG + Intergenic
992141153 5:73798532-73798554 TACAGCATCTGCAGAGAATGGGG - Intronic
993901526 5:93587422-93587444 TATAGCATTTTAAGAGAATGTGG + Intronic
994178752 5:96740906-96740928 TTCTGTGTGTTCAGAGAAAGGGG + Intronic
994820322 5:104642225-104642247 TAGAGCTGGTTCAGAGAAAATGG - Intergenic
995287751 5:110411061-110411083 TGCAGCATTTTCAAAGGAAGTGG - Intronic
996647381 5:125832883-125832905 TACATAAAGTTCAGAGAAAAAGG - Intergenic
996721336 5:126633261-126633283 TACTGCATATTCAGATAGAGAGG + Intronic
997038461 5:130222211-130222233 TGCAGAAAGTCCAGAGAAAGAGG + Intergenic
997581010 5:135017038-135017060 TACAGCCTGGGCAGAGAGAGAGG + Intergenic
998243678 5:140475347-140475369 TTCAGCATGTGCAGAGGAATAGG + Intronic
998937506 5:147245868-147245890 TCCAGCATCTTCAGTGACAGAGG + Intronic
999052852 5:148542687-148542709 TACAGCATGTTCAGAGAAAGGGG + Intronic
1002204857 5:177555295-177555317 TACAGTATATTCACAAAAAGAGG - Intergenic
1005478885 6:26235981-26236003 AACAGGTTGTACAGAGAAAGAGG - Intergenic
1006093616 6:31642589-31642611 GACAGCCTGTTCAGAGGAAGAGG - Intronic
1008200380 6:48580552-48580574 TACATCTTCTTCAGAGAAACAGG + Intergenic
1008933471 6:56964361-56964383 TACATCCTGTTCACAGAAAGAGG - Intronic
1010392672 6:75355366-75355388 TATAACCTGATCAGAGAAAGAGG - Intronic
1010541904 6:77101952-77101974 AAGAGCAGGTTCAGAAAAAGAGG + Intergenic
1010735609 6:79440675-79440697 GAGAGCATGTGCAGAAAAAGAGG - Intergenic
1012763250 6:103330591-103330613 TACAGAAAGTTCAGAGAAACAGG - Intergenic
1012816535 6:104029252-104029274 TACATTATGTATAGAGAAAGTGG - Intergenic
1012985406 6:105870117-105870139 TAAAACATGTTAAGAGAAAAGGG - Intergenic
1014270415 6:119330051-119330073 TACAGGATGTGCAGAGTAAGTGG - Intronic
1015994321 6:138982895-138982917 CACAGCCACTTCAGAGAAAGAGG - Intronic
1016270567 6:142283739-142283761 TACAGCAAGTTGAAAGAAAAAGG - Intergenic
1016950526 6:149575170-149575192 TGCAGAATGTACAGAGAAATAGG - Intronic
1017267601 6:152467838-152467860 TACTCCATGTTCAGAAAAAAAGG - Intronic
1017867949 6:158461076-158461098 TCCATCATCTTCAGAGAAATTGG + Intronic
1021896929 7:25245692-25245714 TGCTGCAGGTTTAGAGAAAGTGG - Intergenic
1021984695 7:26087209-26087231 AACAGCAGCTTCACAGAAAGAGG - Intergenic
1022760963 7:33350613-33350635 GACAGCATGAACAGAGAAAACGG - Intronic
1023243579 7:38177276-38177298 TGCAGCATTTTCAGAGAATGAGG + Intergenic
1023303612 7:38799933-38799955 TGGAGTATGTGCAGAGAAAGAGG + Intronic
1024547989 7:50538407-50538429 ACCAGCCTGTTCAGAGAGAGGGG - Intronic
1026150391 7:67783435-67783457 TGCAGTGTGATCAGAGAAAGAGG - Intergenic
1027608810 7:80333698-80333720 GACAGCATCTTCAGACAATGTGG - Intergenic
1028444547 7:90905543-90905565 TACAGCATTATCACATAAAGAGG - Intronic
1028457052 7:91049917-91049939 TTCAGGAAGTTCTGAGAAAGGGG + Intronic
1029049267 7:97667051-97667073 TTCAGCATTTTCAGAGCAGGAGG - Intergenic
1029067806 7:97869659-97869681 TGCAGCTAGTTCAGATAAAGAGG - Intronic
1031255993 7:119449820-119449842 TACAGCAACTTCAGAGAATAAGG - Intergenic
1031504514 7:122564986-122565008 TACAGCATGTTCTCACAAATGGG + Intronic
1031725739 7:125235803-125235825 TACAGAGTGTTCAGAGAGAAGGG + Intergenic
1032038791 7:128540908-128540930 TTCAGAAATTTCAGAGAAAGAGG - Intergenic
1033917725 7:146348022-146348044 TACAGCTAGTTCAGAGAACTGGG + Intronic
1035305030 7:157926651-157926673 TACAGAGTGTTTAGAGGAAGGGG - Intronic
1036593687 8:10192855-10192877 AACAGCATGTTCATGGAAAATGG + Intronic
1037321730 8:17650081-17650103 TAGAGCAATTTCAAAGAAAGAGG + Intronic
1039175203 8:34796223-34796245 TACAGTATTTTGAGAGAAAGAGG + Intergenic
1039964291 8:42272264-42272286 CCCAGCAGGATCAGAGAAAGTGG - Intronic
1040035039 8:42861711-42861733 TAAAGCATGTTCAAAGTTAGAGG - Intronic
1042445538 8:68880979-68881001 TATAGCATGTTTAGAGTACGTGG - Intergenic
1043160404 8:76839873-76839895 TACAGGGTTTCCAGAGAAAGTGG + Intronic
1044308839 8:90669025-90669047 TACAGCATCTGCAGATAAATAGG - Intronic
1046069168 8:109229855-109229877 TTCAGTATCTTCAGAGACAGAGG - Intergenic
1046207697 8:111023056-111023078 TAAACAATGTTCACAGAAAGTGG - Intergenic
1050467631 9:5946644-5946666 TACACCAAGTTCGGTGAAAGAGG - Intronic
1056901414 9:90603463-90603485 AACAGCATTTGCAGAGACAGTGG - Intergenic
1057129910 9:92647611-92647633 TATACCATATTCATAGAAAGAGG + Intronic
1057958060 9:99427344-99427366 TACAGCTTGGTCAGAGAACTTGG + Intergenic
1058062071 9:100508392-100508414 AAAAGCATCCTCAGAGAAAGTGG - Intronic
1058130558 9:101247858-101247880 CTCAGCATGTTCAGAGACTGAGG - Intronic
1058307536 9:103462123-103462145 TACAATATGTTGAGAGAGAGAGG - Intergenic
1059081438 9:111254324-111254346 TACAACAGCTTCAGGGAAAGAGG + Intergenic
1060498114 9:124132802-124132824 AACAGCATGTGCAGAGACAAGGG + Intergenic
1061066020 9:128277877-128277899 TACCGCATGGTCAAAGACAGTGG - Intronic
1186830094 X:13381528-13381550 TGCAGCCTTTACAGAGAAAGAGG - Intergenic
1187045180 X:15640882-15640904 TACAAAATGTTCTGTGAAAGAGG + Intronic
1189107161 X:38248915-38248937 AACAGCATGGTCAGAGAGAGAGG - Intronic
1189230873 X:39451380-39451402 CCCGGCATGTTCAGAGCAAGGGG + Intergenic
1189456600 X:41195974-41195996 TCCAGCCTGTTCCAAGAAAGAGG + Intronic
1189693327 X:43638986-43639008 TACAGAGTGTTAAGTGAAAGTGG + Intergenic
1189956379 X:46278694-46278716 ACCATCATTTTCAGAGAAAGTGG - Intergenic
1190813579 X:53908389-53908411 TCCAGCATGTTGAGAGACCGAGG + Intergenic
1191864908 X:65696125-65696147 TACAGCAAGGGCAGAGATAGAGG - Intronic
1195426069 X:104731964-104731986 TGCAGTGTGGTCAGAGAAAGAGG - Intronic
1195483161 X:105371696-105371718 GACAGATTGTTCAGAGAATGAGG + Intronic
1195501657 X:105608656-105608678 GACAGCCTGTTGAGAGAAATAGG + Intronic
1195705554 X:107735624-107735646 TAACGCATGTTCAGTGAGAGAGG - Intronic
1196783421 X:119402203-119402225 TCCAGAATGTTCAGGGAATGGGG + Intronic
1200396241 X:155990108-155990130 TACAGAGTGTTCAGTGAAAGTGG + Intergenic
1201053948 Y:9969540-9969562 ACCAGCATATTCAGAGACAGAGG - Intergenic