ID: 999054301

View in Genome Browser
Species Human (GRCh38)
Location 5:148557255-148557277
Sequence CTGGGGAGATGGAGAGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1269
Summary {0: 1, 1: 2, 2: 12, 3: 123, 4: 1131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999054293_999054301 16 Left 999054293 5:148557216-148557238 CCAGGTAAAAGAAGATGGTAGTT 0: 1
1: 1
2: 1
3: 35
4: 278
Right 999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG 0: 1
1: 2
2: 12
3: 123
4: 1131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999054301 Original CRISPR CTGGGGAGATGGAGAGAAGT GGG Intronic
900264039 1:1748309-1748331 CTGGGGAGAGGAAGAGAGGAAGG - Intergenic
900597842 1:3490590-3490612 CTGGGGAAAAGGAGAAAAGAGGG + Intronic
900839866 1:5039821-5039843 AGGGGGTGAAGGAGAGAAGTGGG - Intergenic
901065537 1:6492456-6492478 TTGGGGAGATGGAGAAAGGCCGG - Intronic
902111667 1:14084144-14084166 GTGGTCAGATGGAGAGAAGCGGG + Intergenic
902376718 1:16033308-16033330 CTGGGGAGATGGGGAGGTGGGGG + Intronic
902595593 1:17507601-17507623 ATCGGGAGATTGAGAGAAGATGG - Intergenic
902652720 1:17846999-17847021 CGGGAGAGGTGGTGAGAAGTGGG - Intergenic
902811296 1:18889455-18889477 CTGGGGAGAGGGACAAGAGTGGG + Intronic
903020028 1:20387210-20387232 CTTGGGAGACGGGGAGAAGGTGG + Intergenic
903297206 1:22351324-22351346 CTGGGAAGATGCAGAGAAAAAGG + Intergenic
903488550 1:23709763-23709785 CTGGGGTGTTGGTGATAAGTTGG + Intergenic
903561118 1:24228626-24228648 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
903670316 1:25031431-25031453 CTGGAGAGATGGAAAGATGGAGG + Intergenic
903721496 1:25408877-25408899 GTGGGGAGATGGTGAGAAGGAGG + Intronic
904012160 1:27395916-27395938 CTGGGGAGCTGGACAGAGGGTGG + Intergenic
904026213 1:27505132-27505154 CTGGGGAGTTGGAGAGAACTAGG + Intergenic
904037722 1:27567787-27567809 CTGTGAAGAGGGAGAGATGTTGG - Intronic
904116272 1:28164147-28164169 ATCGGGAGATGGACAGAAGGAGG + Intronic
904202486 1:28830097-28830119 CTGAGGAGAGGGAGAGAGATGGG + Intronic
904267365 1:29325576-29325598 CTGGGGAGAGGAAGAGAGGGAGG - Intronic
904354671 1:29931141-29931163 GTGGGGTGAGGGAGAGAAGATGG - Intergenic
904865357 1:33574666-33574688 CTGTTCAGAGGGAGAGAAGTTGG + Intronic
905060180 1:35133409-35133431 CTGGCGTGAGGGACAGAAGTTGG + Intergenic
905337680 1:37256724-37256746 GAGGAGAGATGGAGAGAAGGAGG - Intergenic
905405265 1:37728240-37728262 GTGGGAAGATGGAGGGAACTGGG + Intronic
905664653 1:39755699-39755721 CTGGGGAGGTGGAGGCCAGTGGG + Intronic
905776382 1:40669985-40670007 CAAGAGGGATGGAGAGAAGTGGG - Intergenic
905921015 1:41718697-41718719 CAGGAGAGATGGAGAGAGGAGGG - Intronic
905962287 1:42053431-42053453 GTGGGGAGAGGGAGAGCATTAGG - Intergenic
906113364 1:43339006-43339028 ATGGGGATATGGAGAGAAAAAGG + Intronic
906224146 1:44107047-44107069 GTGGGGAGGAGGAGAGAGGTGGG + Intergenic
906725352 1:48040316-48040338 CTGGGGATGGGGAGAGGAGTGGG + Intergenic
906942016 1:50263834-50263856 GTGGGGAGAGGGAGACAGGTGGG - Intergenic
907289876 1:53406968-53406990 CTGGAAGGATGGAGAGGAGTGGG + Intergenic
907528640 1:55070549-55070571 CTGCTGAGTTGGAGAGAAGAGGG + Intronic
907649376 1:56280060-56280082 CTGGGGAGAGGGAAAGAGATGGG + Intergenic
907672745 1:56491267-56491289 GGGGGGAAATGAAGAGAAGTTGG - Intergenic
907839509 1:58142760-58142782 CAGGAAAGATGGAGAGAGGTAGG - Intronic
908241742 1:62194499-62194521 CTGTGGAGTTGGAGAGACGCCGG + Intergenic
908838852 1:68257684-68257706 CAGTGGAGATGAAGAGAAGTTGG - Intergenic
908958391 1:69664441-69664463 CTGGCGAGATGTGGAGAAATGGG - Intronic
909405020 1:75279178-75279200 AGGGAGAGATGAAGAGAAGTTGG - Intronic
909824156 1:80105051-80105073 CTGAAGAGAGGGAGAGAGGTGGG + Intergenic
909845663 1:80390725-80390747 AAGGGGAGATAGAGAGAAGTTGG + Intergenic
909969683 1:81966682-81966704 CTGGGGATGGGGAGAGAACTGGG + Intronic
910159804 1:84260612-84260634 CTGGGGACAAGTAGAGGAGTGGG - Intergenic
910167563 1:84343712-84343734 TTGGGGAGAAGGAGAGCATTAGG + Intronic
910653772 1:89599431-89599453 GTGGAGAGCTGGACAGAAGTGGG - Intergenic
910758088 1:90712112-90712134 GTGGGGAGATGGAGAGCAGAGGG + Exonic
911093573 1:94037423-94037445 AAGGGGAAGTGGAGAGAAGTAGG - Intronic
911591413 1:99752437-99752459 CTGAGGAGAAGGAGAGAGATTGG + Intronic
911606453 1:99910967-99910989 ATGGGGAGATGAAGGGAAGAAGG - Intronic
911723517 1:101217274-101217296 CTGAGGAGATGGAGTGTAGAGGG + Intergenic
911968529 1:104399213-104399235 CTGAGGATAGGGAGAGAAGCAGG + Intergenic
912204476 1:107494800-107494822 AAGGGGAGATGGAGTGAAGAGGG - Intergenic
912269020 1:108190746-108190768 CTGGGGAGGTGGAGACGTGTGGG + Intronic
912380937 1:109247972-109247994 CTGGCAGGATGGATAGAAGTAGG - Intergenic
912552519 1:110493359-110493381 CAGAGGAGTTGGAGAGGAGTTGG - Intergenic
912582565 1:110734005-110734027 ATGGGGAGGTGGAGAGGAGAAGG + Intergenic
912663772 1:111560840-111560862 TTGGGAGGATGGAGAGAAATTGG - Intronic
912811746 1:112800346-112800368 CTGGGGAGAAGCAGTGAAGATGG - Intergenic
912949933 1:114113681-114113703 CACTGGAGATGGAGAGAGGTGGG - Intronic
913081094 1:115387905-115387927 ATGGGGAGATGGAACCAAGTTGG - Intergenic
913435764 1:118845877-118845899 TTGGGGAAATGGAGAGATGGTGG - Intergenic
913539209 1:119802922-119802944 CTGGTGAAATGGAGAGAAGAGGG - Intronic
914399380 1:147302830-147302852 TTGGGGAGTTGGGGAGATGTTGG + Intergenic
914895587 1:151668995-151669017 GGGGGGAGATGGAAATAAGTAGG - Intronic
915032938 1:152899749-152899771 CTGGGGAAATGGGGAGATGTTGG - Intergenic
915106900 1:153540442-153540464 CTGGGGAGTTGTTGAAAAGTAGG + Intronic
915439154 1:155933794-155933816 CTGGCGGGAGGAAGAGAAGTGGG + Exonic
915569889 1:156738765-156738787 CTGGGCAGATGGATAGAAACGGG + Intronic
915694783 1:157728854-157728876 CTGGAGAGATGTGGAGAAATAGG + Intergenic
916191587 1:162184159-162184181 CTGAGGAGAGGGAGAGAGATGGG + Intronic
916194447 1:162210398-162210420 ATGGGGAGATAGACAGAAGGTGG - Intronic
916371931 1:164108001-164108023 CTGACAAGAAGGAGAGAAGTAGG - Intergenic
916516097 1:165517991-165518013 CCTGGGAGAAGGAGAGAGGTGGG + Intergenic
916682140 1:167114439-167114461 CTGGTGAGATGGGGTGGAGTGGG + Intronic
916800204 1:168208718-168208740 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
916825077 1:168435244-168435266 CTGGGGGGATGGAGAGCAACAGG - Intergenic
916891686 1:169117804-169117826 CTGGGGAGATGAAGGGAACAGGG + Intronic
917063260 1:171063982-171064004 GAGGAGAGATGGAGAGAAGGGGG + Intronic
917273053 1:173299491-173299513 CGTGGGAGAAGGAAAGAAGTAGG - Intergenic
917841579 1:178984364-178984386 GTGGGGAGATAAAGAGATGTTGG + Intergenic
917963822 1:180166156-180166178 CTGGGGGGATGGCGAGGAGCAGG + Intronic
917965581 1:180176477-180176499 GGGGGGAGGTGGAGAGAAGGTGG + Intronic
918103146 1:181393978-181394000 CTGGGGATAGGAAGAAAAGTAGG + Intergenic
918106779 1:181422262-181422284 CTGGGGATATGGAGTGAACGAGG - Intronic
918127346 1:181596108-181596130 CCGGGGAGATTGAGAGAAAGAGG + Intronic
918152056 1:181806086-181806108 CCTGGGAGATGGAGAGAAAGAGG + Intronic
918319940 1:183354802-183354824 CTGTGGTGATTGAGAGAAGTAGG - Intronic
918352326 1:183670134-183670156 GTGGGGAGATGGAGAGAGATAGG - Intronic
918669535 1:187198115-187198137 CTAGGCAGAAGGAGAGTAGTGGG - Intergenic
919051178 1:192513349-192513371 CTGTGTGGATGTAGAGAAGTAGG + Intergenic
919083852 1:192897045-192897067 AAGGGGAGATGGGGAGAGGTTGG + Intergenic
919318969 1:196009641-196009663 TGGGGGAAATGGAGAGAGGTTGG + Intergenic
919436051 1:197562634-197562656 CTGAGGAGAGGGAGAGAGATGGG - Intronic
919595745 1:199559991-199560013 GTGGGGGGATGGAGAGAGGTTGG + Intergenic
919598887 1:199599001-199599023 CAGGGGAGACGAAGAGAAATTGG + Intergenic
920622937 1:207566272-207566294 AAGGGGAGAAGGAGAGAAGAAGG - Intronic
921226425 1:213024595-213024617 CTTGGGAGATGGAGAGAAAAGGG - Intergenic
921384549 1:214555338-214555360 TTGGAGTAATGGAGAGAAGTGGG + Intergenic
921402625 1:214743043-214743065 CTGAGGAGAAGGAGAGAGATGGG + Intergenic
922101655 1:222482147-222482169 ATGGAGAGAGGGAGAGAATTAGG - Intergenic
922118997 1:222644041-222644063 CTGGGGAAAAGGAGAAAAGCAGG - Intronic
922262735 1:223957263-223957285 ATGGAGAGAGGGAGAGAATTAGG - Intergenic
922659155 1:227414082-227414104 CTGAGGAGAGGGAGAGAAATGGG + Intergenic
922705833 1:227789552-227789574 CCCGGCAGATGCAGAGAAGTGGG + Intergenic
922907754 1:229187711-229187733 CTGTAGGGATGAAGAGAAGTAGG - Intergenic
923071445 1:230568403-230568425 GTGGTGAGATGGGGTGAAGTGGG + Intergenic
923071587 1:230570111-230570133 GTGAGGATATGGAGAGAAATTGG - Intergenic
923079838 1:230642599-230642621 CCGGCGGGATGGAGAAAAGTAGG + Exonic
923294116 1:232576482-232576504 CTGAGGAGAGAGAGAGAAATGGG - Intergenic
923374642 1:233348630-233348652 CAAGGAAGATGGAGAGAAATCGG - Intronic
923666508 1:236002986-236003008 CTGGGGAGAGTGAGAGAGGGAGG - Intronic
923724590 1:236495276-236495298 ATGGGGAGAAGGAGGGAACTGGG + Intergenic
923850620 1:237790335-237790357 CTGTGGAGATGGCAAGAACTGGG - Intronic
924044221 1:240011307-240011329 CTGGTCAGATGGAGGAAAGTTGG - Intergenic
924090493 1:240496275-240496297 CTGGTGAGATGCAGGGGAGTGGG - Intronic
924144488 1:241060017-241060039 CTGTGGAGTGGGAGAGAAATGGG - Intronic
924168257 1:241308139-241308161 CTAGGGAGATAGAGAGAATGTGG + Intronic
924292270 1:242548565-242548587 GTGAGGAGATGGAGAGATGTGGG + Intergenic
924895875 1:248337538-248337560 CTGGTGTGAGGGACAGAAGTTGG + Intergenic
1062900602 10:1142418-1142440 CTGGGGATCTGCACAGAAGTTGG - Intergenic
1063220921 10:3967056-3967078 CTGGGGCGAAGGAGAGAGGGTGG - Intergenic
1063337278 10:5228183-5228205 CTGGAGAGATGTGGAGAAATAGG + Intergenic
1063511228 10:6646974-6646996 AGGGGGAGAGGGAGAGAAGGAGG - Intergenic
1063623314 10:7667512-7667534 CTGGGGAGGTGGGGGGAAATGGG - Intergenic
1063689052 10:8266267-8266289 CGGAGGGGATGGAGAGAAGAGGG + Intergenic
1064325135 10:14343433-14343455 GAGGGGAGATGGAGAGGAGCTGG - Intronic
1064444644 10:15382764-15382786 CTGGGTAGATGGAGTGAAGGAGG - Intergenic
1064822572 10:19354502-19354524 ATGGGGAGATAAAGAGAGGTTGG - Intronic
1064841047 10:19592384-19592406 CTGGTGAGTTGGAGATAAGATGG - Intronic
1065687304 10:28299354-28299376 CTGGGGAGAGGAAGAGAGTTGGG + Intronic
1065747677 10:28857176-28857198 GTGTGGTGATGGAGAGAAGTGGG - Intronic
1065762552 10:28995774-28995796 CTGTGGAAAGGTAGAGAAGTGGG - Intergenic
1066103494 10:32137745-32137767 CTGGGGAGAAGGGGAGAGGTCGG + Intergenic
1066290359 10:34008744-34008766 CTAGGGTGATGGAGAGGAATGGG + Intergenic
1066402526 10:35090081-35090103 CTGGGGCGGAGGAGAGGAGTTGG - Intronic
1066404695 10:35107465-35107487 CTGGGGAGAACTAGAGAAGTAGG + Intergenic
1066654603 10:37686503-37686525 CTGGGGAGATAGAGTGAGGGAGG + Intergenic
1066731758 10:38442808-38442830 ATGGAGAGAGGGAGAGAATTAGG + Intergenic
1067523985 10:47027475-47027497 CTGGGGAGAGGGAGAGAGCCAGG + Intergenic
1067563751 10:47322147-47322169 CTGGGGAGATGGGGAGAGTGTGG - Intergenic
1067732870 10:48825093-48825115 GTGGGGAGAGGGAGAGCATTAGG - Intronic
1067827226 10:49585594-49585616 GTGGGGAGATGGAGAGAAGTTGG + Intergenic
1068519887 10:58066467-58066489 CAGGTGGGATGAAGAGAAGTGGG - Intergenic
1070372609 10:75797950-75797972 TTGGGGGGATGTAGAGAAATTGG - Intronic
1070420796 10:76235179-76235201 CTGGGGAGAGAGAGAGAGATGGG + Intronic
1070438460 10:76416767-76416789 CTGGGGAGATGAAGTGGAATAGG - Intronic
1070541805 10:77420817-77420839 AAGCTGAGATGGAGAGAAGTGGG - Intronic
1070642413 10:78179318-78179340 CTGGGGAGAAGGAGGGGAGAAGG + Intergenic
1070723203 10:78770878-78770900 CTGGTGAGATGAAGAAAACTGGG + Intergenic
1070877167 10:79825715-79825737 CTGGGGAGTTGGGGAGACGATGG + Intergenic
1071162035 10:82758632-82758654 CTGGTGAGATGGTGAGGGGTAGG - Intronic
1071195683 10:83156378-83156400 CTGGGGAGATGGAATGGTGTTGG - Intergenic
1071381545 10:85068157-85068179 TTGAGGAGAGGGAGAGAGGTGGG - Intergenic
1071392924 10:85193600-85193622 TTGGGGAGGTTGAGAGAAGGGGG + Intergenic
1071851653 10:89577742-89577764 CTGAGGAGAGGGAGAGAGATAGG + Intergenic
1071913760 10:90266748-90266770 CTGGGGGGAGGGAGAGTATTAGG + Intergenic
1072726964 10:97820324-97820346 CTGGGGGGAGGGAGAGAATGAGG - Intergenic
1073328844 10:102657900-102657922 CTGGGAAGATGGTGAGGAGAAGG - Exonic
1073598990 10:104828361-104828383 CTGAGGAGAAGGAGAGAGATGGG + Intronic
1073658084 10:105439426-105439448 AGGGGGAAATGGAGAGATGTTGG - Intergenic
1073772292 10:106748479-106748501 CTGAGGAGAGGGAGAGAGATGGG - Intronic
1074296710 10:112195946-112195968 GTGGGGTGAGGGAGAGAAGATGG - Intronic
1074446488 10:113525259-113525281 ATGGGGAGGTGGGGACAAGTTGG - Intergenic
1074544702 10:114393579-114393601 CTGGGGACAGGGAGGGAAGTTGG + Intronic
1074607289 10:114985848-114985870 CTGAAGAGAGGGAGAGAGGTGGG + Intergenic
1074695860 10:116049798-116049820 CGGGGGAGATGGAGGGATGGGGG + Intergenic
1074740102 10:116478293-116478315 CTGGGGAGAAGGAGGAAAGCAGG + Intergenic
1075229014 10:120656329-120656351 ATGGGGAAGTGGAGACAAGTGGG - Intergenic
1075509976 10:123064230-123064252 CTGGGGTGCTGGGGAGAAGTTGG - Intergenic
1075878487 10:125828105-125828127 CAATGGAGAGGGAGAGAAGTGGG + Intronic
1076071167 10:127490963-127490985 CTGGGGAGGGGGAGGGAAGAAGG - Intergenic
1076079391 10:127565116-127565138 CTGGGGACAGGGAGGAAAGTCGG - Intergenic
1076205922 10:128602760-128602782 CTGAGGAGAGGGAGAGAATTGGG - Intergenic
1076768469 10:132650573-132650595 CTGTGTAAATGGAGAGAGGTCGG + Intronic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077347306 11:2068835-2068857 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
1077480899 11:2814087-2814109 ATGGAGAGATGGAGGGAAGGAGG + Intronic
1078152969 11:8774802-8774824 CTGGGGAGACTGAGATGAGTGGG + Intronic
1078239262 11:9515255-9515277 CTGGATACCTGGAGAGAAGTTGG + Intronic
1078416772 11:11172458-11172480 CAGTGGAGAAGGAGAGAAGTGGG + Intergenic
1078625428 11:12951528-12951550 ATGAGGAGATGGCGAGAAGGAGG + Intergenic
1078822260 11:14894007-14894029 CGTGGGAGATGGAGAGAAATTGG - Intergenic
1078999258 11:16737716-16737738 CTGGAGAGAGGGCGAGAAATGGG + Intronic
1079131409 11:17748930-17748952 GTGTGGGGCTGGAGAGAAGTTGG + Intronic
1079303680 11:19303420-19303442 CTGAGGAGACGGAGAGAGATGGG + Intergenic
1079548056 11:21659154-21659176 GTGGGGAAATGGAGAGATGTTGG + Intergenic
1080049580 11:27845807-27845829 CTGTGGAGATTGAGAGAAAAAGG - Intergenic
1080315295 11:30940375-30940397 CTGGGGAGAGGTAAAGAAGAGGG - Intronic
1080360499 11:31507667-31507689 CAGGGGGGATGGGGAGAATTTGG + Intronic
1080438109 11:32264975-32264997 CTGGCAAGATGAAAAGAAGTAGG - Intergenic
1080787981 11:35493440-35493462 CTGGATAGATGGAGAGAGGGAGG - Intronic
1080935832 11:36862470-36862492 CAGAAGAGATGGAGAAAAGTGGG - Intergenic
1081207330 11:40291521-40291543 GGGTGGAGTTGGAGAGAAGTAGG + Intronic
1081244904 11:40753151-40753173 AGGGGGAAATGGAGAGAGGTTGG + Intronic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1082988557 11:59187827-59187849 CTGGGGAGAAGGACAGAAAGGGG + Intronic
1083357888 11:62080821-62080843 CTGGGGAGCAGGATAGAAGAGGG + Intergenic
1084032704 11:66490467-66490489 GAGGGGAGCTGGAGTGAAGTTGG - Intronic
1084101598 11:66953234-66953256 CTGCGGAGATGCAGAGAAAGCGG - Intronic
1084157367 11:67321409-67321431 CTGTGGAGCGGGAGTGAAGTGGG - Intronic
1084461614 11:69299459-69299481 CAGGGGAGATGCAGAGGAGGGGG + Intronic
1084488876 11:69467328-69467350 CTGGGGACCTGGGGAGGAGTGGG + Intergenic
1084557927 11:69885841-69885863 GTGGGGAGATGGAGAGTGATCGG + Intergenic
1084972911 11:72781366-72781388 GTGGGGAGCTGGAGAGAGGTAGG + Intronic
1085014962 11:73167909-73167931 TAGGAGAGAGGGAGAGAAGTGGG + Intergenic
1085143619 11:74171861-74171883 CAGGGAAGGTGGAGGGAAGTGGG + Intronic
1085407617 11:76272719-76272741 CAGGTGTGATGGAGAGAGGTGGG - Intergenic
1086107007 11:83157347-83157369 CCGGGGAGAGGAAGAGGAGTCGG + Exonic
1086138063 11:83462612-83462634 GAGGGGAGATGAAGAGAAGCTGG + Intronic
1086209187 11:84297721-84297743 CTGGGGGCATGGAAGGAAGTCGG - Intronic
1086318608 11:85620299-85620321 CTGAGGAGAGGGAGAGAGATGGG - Intronic
1086406544 11:86503823-86503845 CTGGGGTGAGGGAGAGATTTAGG + Intronic
1086418268 11:86611242-86611264 GTGGGGAAATGGGGAGATGTTGG + Intronic
1086457154 11:86970466-86970488 CTGGGGAGATGGAAGGATGCTGG - Intergenic
1087214578 11:95481801-95481823 GTGGGGAGAGGGAGACAAGAGGG - Intergenic
1087481460 11:98706445-98706467 CTGGGGACACGGCGAGAAGGTGG + Intergenic
1088069191 11:105760374-105760396 CTGGGGCCAAGGAGAAAAGTTGG - Intronic
1088254741 11:107892638-107892660 CTGGCAAGATGTAGAGAAATTGG + Intronic
1088465440 11:110131535-110131557 TTGGGGAGATGGATTGATGTAGG + Intronic
1088821265 11:113459644-113459666 AGGGGGAGATGGAGAGAGGTTGG + Intronic
1088972701 11:114787605-114787627 CTGGGGAGTTGGAGAGAGGAGGG + Intergenic
1089104127 11:115987908-115987930 CTGGGTAGACAGAGAGGAGTAGG - Intergenic
1089303506 11:117512816-117512838 CCAGGGAGAGGGAGGGAAGTGGG - Intronic
1089507683 11:118974996-118975018 CTGGAGTTCTGGAGAGAAGTGGG + Intronic
1089547620 11:119241842-119241864 GTGTAGAGATGGAAAGAAGTGGG + Intronic
1089918245 11:122180737-122180759 CTGGAGAGAGGGAGAGAAACAGG - Intergenic
1090147786 11:124345098-124345120 CTGAGGAGAGGGAGAAAAATGGG - Intergenic
1090153056 11:124405296-124405318 CTTGGGGGAGGGAGAGAAGAGGG - Intergenic
1090177564 11:124664606-124664628 ATTGGGAGGTGGAGAGAAGGTGG - Intronic
1090844867 11:130522224-130522246 CTGGGGAGTGGGAGGGCAGTGGG + Intergenic
1090939663 11:131375922-131375944 GTGGGCAGAAGGAGAGAAGGAGG - Intronic
1091113595 11:132993983-132994005 CTGCGGAGGTGGAGAGATGCGGG - Intronic
1091121312 11:133060219-133060241 CTGAGGGGATGGGGAGAAGGAGG - Intronic
1091636828 12:2203490-2203512 CACGGGAGATGGCGAGAAGCTGG - Intronic
1092229871 12:6770369-6770391 CTGTGGAGAGGGAGAGAATGGGG - Intronic
1092313928 12:7389522-7389544 ATGGGGGGCTGGAGAGAAGGTGG + Intronic
1092334310 12:7615240-7615262 TTGGGGAAATGGAGAGATATTGG + Intergenic
1092518234 12:9238357-9238379 TAGTAGAGATGGAGAGAAGTGGG + Intergenic
1093676888 12:21952085-21952107 CAGGGGAGGCGGGGAGAAGTTGG + Intergenic
1093711279 12:22333026-22333048 CTGGGGAGGTGGAGAGGAAGGGG + Intronic
1094280111 12:28727559-28727581 CTGAGGAGAGGGAGAGAGATAGG + Intergenic
1094280686 12:28734271-28734293 CTGAGGAGAGGGAGAGAGATGGG - Intergenic
1094545533 12:31401240-31401262 CAGCAGAGATGGAAAGAAGTAGG + Intronic
1095351896 12:41223390-41223412 CTGGGTAGGGGGAGAGAAGGAGG - Intronic
1095562197 12:43578822-43578844 CTGGGAGGAAGAAGAGAAGTTGG + Intergenic
1095994589 12:48069873-48069895 ATGGGGAGCTGCAAAGAAGTAGG + Intronic
1096083620 12:48850196-48850218 CGATGGAGATGGAAAGAAGTAGG + Intronic
1096203670 12:49704802-49704824 CTGGTGAGATTGTGAGAATTAGG - Intronic
1096242747 12:49968023-49968045 CTGGGGAGAGGAAGAGAGGGAGG - Intronic
1096250393 12:50028258-50028280 CAGGGGTGAGGGAGAGAAGCAGG + Intronic
1096263774 12:50108437-50108459 TAGGGGTGATGGACAGAAGTGGG - Intronic
1096440326 12:51637204-51637226 CTGAGGAGAGGGAGAGAGATGGG - Intronic
1096564150 12:52462288-52462310 TTGGGGAGAAGGGTAGAAGTGGG + Intergenic
1096717175 12:53498700-53498722 CAGAGGAGATGGAGAGAAAGAGG + Intronic
1096800204 12:54105637-54105659 CTGTGGGGATGCAGAGTAGTAGG - Intergenic
1096861564 12:54532430-54532452 GTAGGGGGATGGAGAGAAGTGGG + Intronic
1097021173 12:56021664-56021686 CTGAGGAGATGGAGAGGATGGGG + Intronic
1097193391 12:57231008-57231030 CTGGGGAGATGGGCAGGGGTTGG + Intronic
1097509940 12:60526947-60526969 TTGGGGAGATGGGGAAATGTTGG - Intergenic
1097583489 12:61486903-61486925 GTGGGGGGAGGGAGAGGAGTGGG + Intergenic
1097967344 12:65595348-65595370 GTGGGGGGATGGGGAGAAGTAGG - Intergenic
1098201289 12:68058654-68058676 CTGGGGAGAGGGAGAGCATCAGG - Intergenic
1098386264 12:69922041-69922063 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1098948160 12:76610569-76610591 ATGGGTAGTTGGAGAGAAATTGG - Intergenic
1099048079 12:77748730-77748752 TGGGGGAGATGGGGAGATGTTGG + Intergenic
1099183569 12:79494186-79494208 CTGGAGAGATGTGGAGAAATAGG - Intergenic
1099458463 12:82893942-82893964 CAGAGGAGATGGAGAGAAAAAGG + Intronic
1099506728 12:83486794-83486816 TTAGGGAGATGAAGAGAGGTTGG - Intergenic
1099550535 12:84038270-84038292 CTGGGGAAAGGGCAAGAAGTAGG + Intergenic
1100927299 12:99563456-99563478 CTGAGGAGAGGAAGAGAAATAGG + Intronic
1100927771 12:99569313-99569335 CTGGGGAACTGGACAGAAATTGG + Intronic
1101037030 12:100716623-100716645 CTGAGGAGAGGGAAAGGAGTGGG - Intergenic
1101082417 12:101202071-101202093 TTGGGGAGATGGGGAGATGGAGG - Intronic
1101327790 12:103731874-103731896 CTGGGGAGAGGGAAAGAAATTGG + Intronic
1101766580 12:107706031-107706053 CTGGAGAGATGTGGAGAAATAGG - Intronic
1102172585 12:110853381-110853403 TGGGGGAGATGGAGAGGAGTGGG - Intronic
1102631901 12:114288418-114288440 TTGGGGAGAGGGAGAGAGGAGGG + Intergenic
1102736504 12:115165608-115165630 CAGGGGAGATAGAGAGAGGTTGG - Intergenic
1102856949 12:116302453-116302475 GTGGGGAGGTGGAGAGGGGTGGG + Intergenic
1103049109 12:117763852-117763874 CAGCAAAGATGGAGAGAAGTCGG + Intronic
1103082741 12:118038287-118038309 CTCTGCAGCTGGAGAGAAGTCGG - Exonic
1103325243 12:120116311-120116333 CTCTGGAGTTGGAGAGACGTGGG - Intronic
1103636353 12:122309786-122309808 CTGAGGAGCTGGGGAGAAGCAGG - Exonic
1103939845 12:124495693-124495715 CGGGGGCCATGGAGTGAAGTTGG - Intronic
1103965924 12:124639273-124639295 CTGGGGAGATGCAGAGATTTTGG - Intergenic
1103995313 12:124825900-124825922 CTGGGGAGGTGGGGAGATGCAGG + Intronic
1104057306 12:125240251-125240273 CTGGGGTGAGGGAGTGAACTGGG + Intronic
1104284135 12:127407819-127407841 ATGGGGAGTTGGGGAGATGTTGG - Intergenic
1104468784 12:129011669-129011691 CTGGGGAAACGGGGAGATGTGGG - Intergenic
1104615793 12:130267476-130267498 GTGGGGAGATGAAGAGAGGTTGG - Intergenic
1104676752 12:130716324-130716346 AGGGGGAGAGGGAGAGAAGGAGG + Intergenic
1105443230 13:20432297-20432319 CTTAGGAGAGAGAGAGAAGTGGG + Intronic
1105494942 13:20922136-20922158 ATGGAGAGATGGAGATAATTGGG + Intergenic
1105675959 13:22671875-22671897 TTGGGGAGATGGTGAAGAGTTGG + Intergenic
1105724722 13:23151311-23151333 ATGGGGAGAAGGGGAGAAGGTGG - Intergenic
1105883045 13:24620270-24620292 GTAGGGAGATGAAGAGAGGTCGG - Intergenic
1105889946 13:24675543-24675565 TTGGGGGAATGGAGAGATGTAGG + Intergenic
1105895295 13:24712132-24712154 CTGGGGAGATGACCAGAGGTGGG - Intronic
1105911622 13:24873678-24873700 GTGGGGGGATGAAGAGAGGTTGG - Intronic
1106000216 13:25715493-25715515 CTGGGGAACTGGAGAGACATTGG - Intronic
1106160413 13:27196325-27196347 CTGGGGAGTGGGAGAGGAGCAGG - Intergenic
1106845483 13:33733864-33733886 CTTAGCAGATGGAGAAAAGTAGG + Intergenic
1106984787 13:35333673-35333695 TTGAGGAGTTGGAGAGAGGTAGG - Intronic
1107021020 13:35751698-35751720 CGGGGGAAAGGGTGAGAAGTGGG + Intergenic
1107137430 13:36959207-36959229 GTGGGGAGATGGGGAGATGATGG + Intronic
1107404553 13:40100270-40100292 CTGAGGAGATTGAGGGATGTGGG - Intergenic
1107605970 13:42057339-42057361 ATAGTGAGATGGAGAAAAGTAGG - Intronic
1107897042 13:44975534-44975556 TTGTGGGGATGGAGAGAACTAGG - Intronic
1108118483 13:47157669-47157691 AGGGGGAGATGAAGAGAGGTTGG - Intergenic
1108305124 13:49123853-49123875 CTGGAGAGATGTGGAGAAATAGG + Intronic
1108708349 13:53010279-53010301 CTGGGGAGATGGACATGGGTTGG + Intergenic
1108979293 13:56490362-56490384 TTGAGGAGAGGGAGAGAATTGGG - Intergenic
1109216194 13:59592180-59592202 ATGGGGAGATGGAACCAAGTTGG + Intergenic
1109273872 13:60283099-60283121 CTAGAGAGATGGAGAGAGGGAGG - Intergenic
1109515478 13:63438348-63438370 CTGAGGAGAAGGAGAGAGATAGG + Intergenic
1109967700 13:69723184-69723206 AGGGGTAGATGGAGAGAGGTTGG + Intronic
1110129435 13:71988926-71988948 GTGGGGAGAGGGAGAGCATTAGG + Intergenic
1110270580 13:73585099-73585121 CAGTGGGGATGGTGAGAAGTGGG + Intergenic
1110553737 13:76835234-76835256 GTGGGGAAATGGGGAGATGTAGG + Intergenic
1110554673 13:76844993-76845015 ATGGGGAGATGGGGAGATGATGG + Intergenic
1110611354 13:77491580-77491602 CTGGGCAGATGTGGAGAAGGTGG + Intergenic
1111131882 13:83987339-83987361 TTGGGGAGACAGAGAAAAGTTGG + Intergenic
1111202526 13:84959281-84959303 GTGGGGGAATGGAGAGATGTTGG - Intergenic
1111444269 13:88325086-88325108 CTGGGTAGATAAAGATAAGTGGG - Intergenic
1111628739 13:90823003-90823025 CTATGGAGATGGAGAGTAGAAGG - Intergenic
1111846071 13:93510292-93510314 GAGGGAAGATGAAGAGAAGTGGG - Intronic
1111908942 13:94288417-94288439 CTGGGGACATGGAGGGAGGTGGG - Intronic
1112002596 13:95225099-95225121 TGGGGGAGAGGGAGAGAAGAAGG - Intronic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1112521151 13:100096422-100096444 CTGAGGAGAGGGAGAGACATAGG - Intronic
1112653036 13:101418979-101419001 CTGGGGACATGGAGGCAAATGGG - Intergenic
1112672670 13:101659090-101659112 CTGGAGAGCTGGAGTGCAGTGGG + Intronic
1112728806 13:102335986-102336008 CTGGGGAGAGGGAAAGAGATGGG - Intronic
1113144797 13:107196688-107196710 TGGGGGAGATGGGGAGATGTAGG + Intronic
1113240980 13:108336632-108336654 CGGGGGTGTTGGAGAGAGGTAGG - Intergenic
1113425100 13:110201224-110201246 GTGGGGAGAGAGAGAGAAGGAGG + Intronic
1113438787 13:110312447-110312469 CTGGGGAGAGGGAAAGAAAATGG + Intronic
1114624388 14:24119356-24119378 CTGGGGAAATGGAGAGCAAGGGG - Intronic
1114637501 14:24195978-24196000 CCGGGGAGATGGAGCGCAGGCGG + Intronic
1115141746 14:30179614-30179636 GAGGAGAGATGGAGAGAACTAGG + Intronic
1115292398 14:31786996-31787018 CAGTGGAGAAAGAGAGAAGTGGG + Intronic
1115399412 14:32939792-32939814 CTGGGGAGGGGGAGGGAAGGCGG + Intronic
1115469306 14:33752013-33752035 TTGGGGAGAAGGAGAGAAAGGGG - Intronic
1115886425 14:37976679-37976701 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1115921555 14:38379791-38379813 TTGGGGAAAGGGAGAGAAGGAGG + Intergenic
1116640669 14:47458506-47458528 AGGGGGAAATGGAGAGATGTTGG + Intronic
1116679157 14:47943513-47943535 CTGGGGAGATGTGGACTAGTTGG + Intergenic
1117201685 14:53396228-53396250 CAGAGGAGAGGGAGAGAAATGGG - Intergenic
1117261365 14:54037401-54037423 GTGGAGAGAGGGAGAGAAGCAGG - Intergenic
1117399469 14:55345541-55345563 ATGGGGAGACGGGGAGAAGAAGG - Intronic
1117612229 14:57496247-57496269 CAGAGGAGATGGAGAGAAGCAGG + Intergenic
1118227956 14:63920714-63920736 CCGTGGAGATGGAGAGAAATAGG + Intronic
1118428796 14:65693527-65693549 GTGGGGAGAGGGAGAGAGGGAGG + Intronic
1118895519 14:69942561-69942583 CTGGAGATAAGGAGAGAAGCAGG - Intronic
1119008547 14:70958542-70958564 CTGGCGAGAAGAAGAGAAGCAGG - Intronic
1119185230 14:72636525-72636547 CTTGGCAGGTGGAGAGAAGGAGG + Intronic
1119457774 14:74770946-74770968 TAGTTGAGATGGAGAGAAGTGGG + Intronic
1119773614 14:77235969-77235991 CTGGGGAGATGGTGATGGGTGGG + Intronic
1119816478 14:77573197-77573219 CGGGGGAGATGAAGAAAAGCTGG + Intronic
1119885001 14:78132837-78132859 CAGGGGAGATGCAGAGATATTGG + Intergenic
1120295925 14:82640755-82640777 GAGGGGAGATGGGGAAAAGTAGG + Intergenic
1120327780 14:83051823-83051845 CTGGGGAGATGTAGGTCAGTGGG + Intergenic
1121353886 14:93196822-93196844 CTGGGAAGAGGGAGGGGAGTAGG - Intronic
1121522845 14:94598258-94598280 CTGTGGAGATGGAGAGTGGGTGG + Intronic
1121554381 14:94825214-94825236 CTGTGGAAATGGAGTGCAGTGGG + Intergenic
1121571480 14:94949782-94949804 TTGGGGAGGAGGAGGGAAGTGGG + Intergenic
1121717954 14:96089647-96089669 CTGGGCAGAGAGAGAGCAGTGGG - Exonic
1121727551 14:96164087-96164109 CGAGGGAGATGGAGAGAGGTTGG + Intergenic
1121827191 14:97019919-97019941 ATGGGGAGATGGGGAGAAATTGG - Intergenic
1121937963 14:98037776-98037798 CTGCCGAGATGGAGGGCAGTGGG - Intergenic
1121991133 14:98558692-98558714 CTAGAGAAATGGAGAGAACTTGG - Intergenic
1122149104 14:99715008-99715030 GTGGGGGGATGAAGAGAAGTTGG + Intronic
1122159909 14:99775421-99775443 CTGGGGAAATGTGGAGCAGTGGG + Intronic
1122403765 14:101484238-101484260 CAGGAGGGAGGGAGAGAAGTTGG + Intergenic
1122662577 14:103307649-103307671 CTGAGGAGTTGGAGAGAGATGGG + Intergenic
1122878309 14:104678850-104678872 ATGGGGAGGGGGACAGAAGTGGG - Intergenic
1122881831 14:104693760-104693782 ATGGGGAGATGGAGGCCAGTGGG - Intronic
1123502466 15:20902457-20902479 CTTGGGAGAGGGAGAGCACTGGG + Intergenic
1123559716 15:21476124-21476146 CTTGGGAGAGGGAGAGCACTGGG + Intergenic
1123595950 15:21913423-21913445 CTTGGGAGAGGGAGAGCACTGGG + Intergenic
1124177502 15:27440045-27440067 GTGGGAATCTGGAGAGAAGTGGG - Intronic
1124255398 15:28137670-28137692 CTGAGGAGAGGGAGAGAGATGGG - Intronic
1124568912 15:30841952-30841974 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
1125241927 15:37585953-37585975 GTTTGGAGATGGAGAGTAGTGGG - Intergenic
1125279078 15:38025440-38025462 CTTGAAAGATGGAGAGAAGAAGG - Intergenic
1125329142 15:38565015-38565037 CAGGGGAGTTGGAGAGGAGCGGG + Intronic
1125466696 15:39960358-39960380 CAGGGGAGATAGAGAGGAGAAGG + Intronic
1126132275 15:45353289-45353311 TTGCGGAGATGGGGAGAAGAGGG + Intergenic
1126365440 15:47889507-47889529 CTGTGGAGATAGAGAGTAGAAGG + Intergenic
1126557335 15:50004031-50004053 CTGGGGAGATGGGCGGAGGTGGG - Intronic
1126947243 15:53835348-53835370 CTAGGAAGATGGAGAGAGGAAGG + Intergenic
1127065806 15:55236980-55237002 CGGGGGAAACGGAGAGAGGTTGG - Intronic
1127166510 15:56249436-56249458 CTGGGGAGAGAGAGAGAGGGAGG + Intronic
1127613189 15:60657241-60657263 ATGGGGAGAGGGAGAGGAGGAGG - Intronic
1127677648 15:61258088-61258110 TTGGGGAGAGGGATGGAAGTGGG + Intergenic
1128334062 15:66774793-66774815 CTGGGGAGAGGGAGACAGCTGGG - Intronic
1128637315 15:69311486-69311508 CAGGGGAGATGGAAACAACTTGG - Intronic
1128990773 15:72258210-72258232 CTGGGAGGATGGAGGGTAGTTGG - Intronic
1129321593 15:74778004-74778026 CTGGGGAGATGGTGCGAGATGGG - Intergenic
1129587662 15:76885224-76885246 CGAGTGAGATGGAGAGAGGTTGG - Intronic
1129601377 15:77000562-77000584 GTGGGGAAATGGAGAAAAATAGG + Intronic
1129613768 15:77082102-77082124 CTGGGGACAGGGAGAGACGGGGG + Intronic
1129656561 15:77528704-77528726 CTGGGGAGACTGTGAGAAGGAGG + Intergenic
1129669242 15:77598001-77598023 CTAGGGAGATGGAAAGGAGCTGG + Intergenic
1129686387 15:77688445-77688467 ATGGGGAGAGGGAGGGAAGAGGG + Intronic
1129859876 15:78852582-78852604 TTGGAGAGACGGAGAGAAATTGG - Intronic
1130071365 15:80649129-80649151 CTGGAGCGATGCAGAGAAGATGG + Intergenic
1130129831 15:81130837-81130859 CTGAGGAGAGGGAGAGAGATGGG + Intronic
1130826137 15:87548111-87548133 CTGAGGAGATGGGGAGAAGATGG + Intergenic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1130960558 15:88656061-88656083 CTGTGGAGTCAGAGAGAAGTAGG + Exonic
1131158747 15:90090840-90090862 CTGGGGCTTTGGAGAGAGGTTGG + Intronic
1131927325 15:97400006-97400028 CTGAGGAAATGGAAAGATGTTGG - Intergenic
1132299524 15:100767432-100767454 GAGGGGAGATGGAGAGAGGGAGG - Intergenic
1202968058 15_KI270727v1_random:203286-203308 CTTGGGAGAGGGAGAGCACTGGG + Intergenic
1132663665 16:1072392-1072414 CTGGGGTTGTGGAGATAAGTGGG - Intergenic
1132752693 16:1466088-1466110 CTGGGGACATGAAGGGAAGAAGG + Intronic
1133019665 16:2961767-2961789 GTAGGGAGAAGGTGAGAAGTTGG - Intergenic
1133085215 16:3356853-3356875 CTGGGGAAAGGAAGAGAAGTTGG + Exonic
1133537070 16:6712708-6712730 GAGGGGAGGTGGGGAGAAGTGGG - Intronic
1133757552 16:8773692-8773714 ATGGGGAGGTGGAGATAAATAGG - Intronic
1134249044 16:12561684-12561706 CTGGGGAGTTGGGGAAAAGGGGG - Intronic
1134356352 16:13485769-13485791 GTGGAGAGATGAAGAAAAGTTGG - Intergenic
1135168743 16:20164604-20164626 ATGGGGAGGAGGAGAGAAGAGGG - Intergenic
1135191501 16:20358238-20358260 CAGTGGAGATGAAGGGAAGTGGG + Intergenic
1135248293 16:20876963-20876985 GAGGGGAGATGAAAAGAAGTGGG + Intronic
1135499118 16:22978391-22978413 ATGGAGAGATGGAGAGATGGAGG + Intergenic
1135711988 16:24725523-24725545 CTGGGGAGGGGGAGAGGAGGGGG - Intergenic
1135760740 16:25136207-25136229 ACAGGGAGATGGAGAAAAGTAGG - Intronic
1135815724 16:25631161-25631183 TTGGGGAAATAGAGAGATGTTGG + Intergenic
1136239068 16:28933127-28933149 CTGGGGAGATGCCGGGAAGCGGG + Intronic
1136366833 16:29812862-29812884 CTAGGGAGAGGAAGAAAAGTTGG - Intronic
1136452347 16:30360448-30360470 CTGTGGAGGTGGAGAGGAGCAGG - Intronic
1136532729 16:30880580-30880602 CTGGGGAGTTGGAGATGAGAAGG + Intronic
1137363336 16:47840158-47840180 CTGGGGAGGAGGGGAGAGGTCGG - Intergenic
1137801030 16:51262171-51262193 CGGGGGAGAAGGAGGGAAGGAGG - Intergenic
1138041190 16:53669641-53669663 CTGGGGAGAAGTAGAAAATTTGG + Intronic
1138319644 16:56101248-56101270 GTGGGGAGAGGGAGAGAATCAGG - Intergenic
1138434338 16:56988907-56988929 AGGGGGAGATGGAAAGAGGTAGG - Intergenic
1138589401 16:57991527-57991549 CTGGGAAGATGGAGCACAGTGGG + Intergenic
1139051092 16:63125324-63125346 CTGGAGAGATGTGGAGAAATAGG + Intergenic
1139120215 16:64007274-64007296 GTGTGGAGAGAGAGAGAAGTGGG - Intergenic
1139514151 16:67443542-67443564 CCTGGGAGGTGTAGAGAAGTAGG - Intronic
1139670138 16:68487277-68487299 CTGGGGACATGGAGAGTGGGTGG - Intergenic
1140240151 16:73192885-73192907 GTGGGGAGCTGGACACAAGTGGG + Intergenic
1140439126 16:74973323-74973345 CTGGGGTGATGGAGAGAGACCGG - Intronic
1140809014 16:78559087-78559109 CTTGGGAGAGGGACAGTAGTGGG + Intronic
1140897527 16:79338013-79338035 CTTGGGAGATGGAAATAAATAGG + Intergenic
1141023654 16:80522429-80522451 TTGGGAAGAGGGAGAGAAGCAGG + Intergenic
1141650947 16:85392880-85392902 CTGGGTGGATGGAGAGACCTCGG - Intergenic
1141886484 16:86895787-86895809 CTGGGAAGAGGGAGAGAAGAGGG + Intergenic
1141909009 16:87045793-87045815 CTGGGGAGATGGGTAGGAGATGG - Intergenic
1141999928 16:87658536-87658558 TTGGGGAGAGAGAGAGAAGGGGG - Intronic
1142250012 16:88987037-88987059 CTGGGGAGAGGGAGGGACGGAGG - Intergenic
1142314255 16:89333519-89333541 CTGGGGAGAGGGAGGGACGGAGG - Intronic
1142323376 16:89399497-89399519 CTGGGGAGAGGGAGGGACGGAGG + Intronic
1142470542 17:161101-161123 CTGGGGAGATGGGGAGAGATGGG - Intronic
1142929591 17:3271371-3271393 CTGGTGTGATGGTGAGATGTGGG - Intergenic
1143168455 17:4911353-4911375 AGGGGGAGATGGAGAGAAAGAGG + Intergenic
1143411318 17:6711158-6711180 CTGGGAAGCTGGTGAGAAGCTGG - Intronic
1145277729 17:21444528-21444550 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
1145886217 17:28384241-28384263 CAGGGCAGATGGAGAGACTTTGG + Intronic
1146695246 17:34903926-34903948 GTGGGGTGAAGGAGAGAAGATGG + Intergenic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1147250110 17:39148096-39148118 CTGGGGAGAGCTAGAGAAGATGG + Intronic
1147610346 17:41798342-41798364 CTGGGGACAGGGAGAGGAGAGGG - Intergenic
1147687249 17:42293880-42293902 CTGGGGAGAAGGAACCAAGTGGG + Intronic
1147711359 17:42468513-42468535 GTGGGGGGATGAAGAGAGGTTGG - Intronic
1147979036 17:44263428-44263450 ATGGGGTCAGGGAGAGAAGTAGG - Intronic
1148353643 17:46959138-46959160 CTGATGAGATGGTGGGAAGTAGG + Intronic
1148585971 17:48780645-48780667 CTGGGCGGAGGGAGAGAAGGGGG - Intronic
1148712090 17:49689365-49689387 CAGTGGAGATGGAAGGAAGTAGG - Intergenic
1149097976 17:52867950-52867972 CTGGGGAGGTGGAGGGGATTGGG - Intronic
1149242040 17:54662485-54662507 CTGGAGAAATGGACAGAAGTAGG - Intergenic
1149306084 17:55347726-55347748 CTGGGGGGCTGGAGAGGAGTGGG - Intergenic
1149317321 17:55450836-55450858 CAAAGGAGATGGAAAGAAGTGGG - Intergenic
1149675415 17:58456420-58456442 GTGGGGATATTGGGAGAAGTTGG + Intronic
1150213454 17:63454116-63454138 GTGCAGAGAAGGAGAGAAGTGGG - Intergenic
1150645712 17:66976389-66976411 ATGGAGGGATGGAAAGAAGTTGG - Intronic
1150825811 17:68473852-68473874 CTGGAAAGATGGAGAGAAACTGG + Intergenic
1150935928 17:69635694-69635716 CTGTGGAGATGGACAGAAAAGGG + Intergenic
1151186870 17:72371209-72371231 CTGGAGAGAAGGGGAGAAGGGGG - Intergenic
1151239107 17:72744025-72744047 ATGGGGAGGTGGAGAGAGGCAGG - Intronic
1151558125 17:74857168-74857190 CTGGGGAGTTTGAGGGAAGTAGG - Intronic
1151636865 17:75355403-75355425 TTGGGGAGGAGGAGAGAACTGGG - Intronic
1151978766 17:77497236-77497258 CTGGGCAGGGGGAGAGAGGTGGG + Intronic
1152494870 17:80663951-80663973 CGGGGAAGATGCAGAGCAGTGGG - Intronic
1152816278 17:82410018-82410040 CAGGAGAGATGGGGAGCAGTGGG - Intronic
1152863009 17:82706638-82706660 CTGGGGAGATGGAGAAGACCTGG - Intergenic
1152911387 17:83006962-83006984 CTGGCGAGAGGCAGAGAAGCTGG - Intronic
1153133183 18:1881397-1881419 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
1153292801 18:3518220-3518242 CTGAGGAGAGGGAGAGAGATGGG + Intronic
1153427041 18:4976120-4976142 GGAGGGAGATGAAGAGAAGTAGG + Intergenic
1153871729 18:9327342-9327364 CTGAGGAGAGGGAGAGAGATGGG - Intergenic
1155124754 18:22861793-22861815 TGAGGGAGATGAAGAGAAGTGGG + Intronic
1155143929 18:23068155-23068177 CTGGAGAGATTTATAGAAGTTGG - Intergenic
1155325305 18:24658504-24658526 TGGGGGAGATGGAGAGGAGGAGG + Intergenic
1155528467 18:26741870-26741892 GTGGAGAGATGGAAAGAAGCCGG + Intergenic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1155582329 18:27323844-27323866 CTGGGGAGATGCAGAGAAGCTGG - Intergenic
1155627100 18:27846905-27846927 CAGTGGTGATGGACAGAAGTGGG - Intergenic
1155662045 18:28260811-28260833 GGGTGGAGATGAAGAGAAGTTGG + Intergenic
1155733526 18:29192281-29192303 ATTGAGAGATGGAGGGAAGTTGG - Intergenic
1156117822 18:33807996-33808018 CTGGGGAGAGGGAGCTAATTAGG - Intergenic
1156419349 18:36933910-36933932 CTGGGGAGATGGAGAACTTTGGG + Intronic
1156442922 18:37209725-37209747 CTGGGTTGATTGAGAGGAGTGGG + Intronic
1156452697 18:37275423-37275445 GAGGGGCGAGGGAGAGAAGTAGG + Intronic
1156498490 18:37541655-37541677 CTGGGGTAATGGGGAGAATTAGG - Intronic
1156568294 18:38221522-38221544 ATGGGGAAAAGGAGAGAAGGGGG + Intergenic
1156849145 18:41705423-41705445 TCTGGGAGATGCAGAGAAGTTGG + Intergenic
1157024992 18:43831842-43831864 CAGTGGAGAGGGAGAGAAGGGGG - Intergenic
1157398064 18:47360209-47360231 ATGGGGGGATGAAGAGAGGTTGG - Intergenic
1157477559 18:48033155-48033177 CAGGGCAGATGGAGAGAATCTGG + Intronic
1157588770 18:48822472-48822494 GTGGGGAGATGAAGAGTGGTTGG - Intronic
1157630759 18:49093008-49093030 CTGAGAAGAAGGAGAGAAATAGG + Intronic
1157880641 18:51318094-51318116 GTGGGTAGGTGGAGAGAAGTAGG - Intergenic
1158777876 18:60608047-60608069 CTGTGGAAATGGATAGAACTAGG - Intergenic
1159395029 18:67845948-67845970 CTGGAGAGATGGAGGCAAGATGG + Intergenic
1159514497 18:69440119-69440141 CTGAGAAGAGGGAGAGAAGTGGG + Intronic
1159626383 18:70700149-70700171 AAGGGGAGATGGAGAGAAGCTGG - Intergenic
1159888292 18:73931322-73931344 CTGGAGAGCTGGAGAGAAAATGG - Intergenic
1159920244 18:74221265-74221287 CAGGTGAGAAGGAGAGAAGGAGG + Intergenic
1160465818 18:79074783-79074805 CTGGGGAGGAGCAGAGAAATGGG + Intronic
1160591020 18:79944802-79944824 CATGGGAGCTGGAGAGAGGTGGG - Intronic
1160816724 19:1039449-1039471 CTGGGGAGAGTGAGAGGCGTGGG - Intergenic
1161274323 19:3407067-3407089 ATGGGGAGATGGGGAGAACTTGG + Intronic
1161443060 19:4303442-4303464 CTGGGGAGATGGAGATTACAGGG + Intergenic
1161848440 19:6725730-6725752 CTGGGAAAATGGAGAGCAGTGGG + Intronic
1161880188 19:6944416-6944438 AGGGAGAAATGGAGAGAAGTAGG + Intergenic
1161903351 19:7136372-7136394 CTGGGCAAATGGGGACAAGTTGG - Intronic
1161950825 19:7466982-7467004 CTGGGGAGATGGAGACCCGCGGG - Intronic
1161966254 19:7550824-7550846 CTGGGGAGAGGGAGAGGACAGGG - Intronic
1161994386 19:7703596-7703618 CTGTGGGGATGGGGAGAAGCAGG - Intergenic
1162140169 19:8580717-8580739 CTGGGGGGATGGAGAGGGGCTGG - Exonic
1162174340 19:8820141-8820163 CTGGGAAGATGCAGAGAAGCTGG + Intronic
1162391854 19:10394859-10394881 CCAGGGAGGAGGAGAGAAGTGGG - Intronic
1162807218 19:13144294-13144316 CTGGGTAGCTGGAGAGTAGAGGG - Exonic
1162915180 19:13870914-13870936 CAGGGGAGCTGGGGATAAGTGGG - Intronic
1163115170 19:15184862-15184884 CAGAGGAGATGGAGAGGAGGAGG + Intronic
1163183814 19:15622431-15622453 CTGGAGAGATGATGAGAACTAGG + Intronic
1164234910 19:23323413-23323435 ATGGGGAGAAGGAGGAAAGTAGG - Intronic
1164404546 19:27932356-27932378 CTTGGTAGATGAAGAGAAGAAGG - Intergenic
1164781631 19:30897584-30897606 CTGGGGAGATGGCCAGAGGAGGG - Intergenic
1164895930 19:31877691-31877713 CTGAGGACATGGAAAGGAGTAGG + Intergenic
1164971780 19:32539069-32539091 CTAGGGAGATGCAGAGGAGCTGG + Intergenic
1165876040 19:39007578-39007600 CTGGGGAGATGCAGAGTTGGGGG - Intronic
1165920981 19:39297817-39297839 CTGGGGAGAAGGAGACAGGAGGG - Intronic
1166060302 19:40321596-40321618 CTTGGGAGAGGTAGAAAAGTGGG + Exonic
1166283293 19:41809198-41809220 CTGGAGGGAGGGAGAGAAGGAGG + Intronic
1166678715 19:44754683-44754705 CCTGGGAGATGCAGAGAAGGGGG + Intronic
1166705352 19:44905393-44905415 CTAGGGGGCTGGACAGAAGTGGG - Intergenic
1166838558 19:45682342-45682364 GTGGGGAGAGACAGAGAAGTGGG + Exonic
1166914120 19:46182959-46182981 TGGGAGAGATGGGGAGAAGTGGG - Intergenic
1167163173 19:47780673-47780695 CAGGGGAGAGAGGGAGAAGTGGG - Intronic
1167331216 19:48857459-48857481 GGGGGGAGCTGGAGATAAGTGGG + Exonic
1167369889 19:49074146-49074168 CTGGGGGTGTGGAGAGAGGTAGG + Intergenic
1167435164 19:49474859-49474881 ATGGGGAGATGGACAGAGGAGGG + Intronic
1167435208 19:49475038-49475060 AGGGGGAGATGGACAGAGGTGGG + Intronic
1167612305 19:50513417-50513439 CTGGGGAGAGGGAAAGGAGAGGG + Intronic
1168099486 19:54133743-54133765 GAGGGGAGGTGGAGAGAAGGAGG - Intergenic
1168276883 19:55283893-55283915 CTGGAGGGATGGAGAGGAGGTGG - Intronic
1168497894 19:56869516-56869538 CTGGGGAAATGAAAGGAAGTGGG - Intergenic
1168692632 19:58386188-58386210 CTGGGGGAAGGGACAGAAGTTGG + Intergenic
1202646246 1_KI270706v1_random:144661-144683 GTAGAGAGAGGGAGAGAAGTAGG - Intergenic
925055730 2:855639-855661 TTAGGGAGATGGAGAGTGGTTGG - Intergenic
925077449 2:1029103-1029125 TTGGGGAGATAAAGATAAGTAGG - Intronic
925095862 2:1201400-1201422 GGGGGGAGGTGAAGAGAAGTTGG + Intronic
926188887 2:10712499-10712521 GTGGGGAAATTGAAAGAAGTTGG + Intergenic
926314264 2:11697800-11697822 CTGGTGAGATGGGGAGGAGGGGG - Intronic
926314711 2:11700839-11700861 CTGGGGAGGTGGAGGGATGTGGG - Intronic
926400402 2:12490698-12490720 CAGAGGAGGAGGAGAGAAGTGGG - Intergenic
926663680 2:15496319-15496341 CTGGGGAGATGGAGTGTTGCAGG + Intronic
926707848 2:15849314-15849336 AGGGGGAGGTGGAGAGAAGATGG + Intergenic
926721947 2:15967422-15967444 GTGGGTAGATGGAGAGAGTTGGG - Intergenic
927334272 2:21903954-21903976 CTGGAGAGATGTGGAGAAATAGG - Intergenic
927920940 2:26971189-26971211 CTGGGGAGATCCAGAGAGGCCGG - Intronic
928099251 2:28425799-28425821 CTTGGGAGATGAACAGGAGTTGG - Intergenic
928354099 2:30593040-30593062 CGGGAGGGATGTAGAGAAGTTGG - Intronic
928355757 2:30613244-30613266 CTGGGGAGAAGGGGTGAAGGGGG + Intronic
928467258 2:31533567-31533589 CTGGGAAGTAGGTGAGAAGTGGG + Intronic
928657234 2:33464900-33464922 CTGAGGAGAGGAAGAGAGGTGGG - Intronic
928687346 2:33762178-33762200 CTGGGGAGAGGGAGAGGGGGAGG + Intergenic
928814007 2:35267545-35267567 CAGGGGAAAGGGAGAGAAGTTGG - Intergenic
928922453 2:36539659-36539681 CCGTGGAGGTGGGGAGAAGTGGG + Intronic
929245525 2:39697943-39697965 CTGGAGAGAGGGTGTGAAGTGGG - Intronic
929749967 2:44700554-44700576 CTGGGGAGAGGGAGAGAGATGGG + Intronic
929767131 2:44854360-44854382 CTGGAGAGAAAGAGAGATGTGGG + Intergenic
929811215 2:45190688-45190710 ATGGGGAGATGGAGAGCAACAGG - Intergenic
929856201 2:45640394-45640416 ATGGGCAGAAGGAGAGAAGCTGG + Intergenic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
930715357 2:54588717-54588739 CTGTAGAGATGGAGAGTAGCAGG + Intronic
930765969 2:55085412-55085434 CTGGAGACCTGGAGAGGAGTGGG + Intronic
931279609 2:60777780-60777802 CTGAGGAGAGGGAGAGAGATGGG + Intronic
931464845 2:62477015-62477037 CTGGGGAGAGAGAGGGAAGGAGG + Intergenic
931520585 2:63092273-63092295 ATGGGGAGATGGAACCAAGTTGG - Intergenic
931810646 2:65851422-65851444 TAGTGAAGATGGAGAGAAGTGGG + Intergenic
932207142 2:69893214-69893236 CTGGGGAGAGGGAGAGCATTGGG + Intergenic
932369785 2:71177503-71177525 CTGGGGAGAAGGAGAAATGCAGG - Intergenic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
932693341 2:73932247-73932269 GTGGGGTGATGAAGAGTAGTGGG - Intronic
932720531 2:74135879-74135901 CTGGGGAGATGGACAGGTATAGG - Intronic
932833007 2:75008687-75008709 CTGAAGAGATGGAGAGAAACAGG - Intergenic
933321153 2:80777267-80777289 CTGAGGAGGTGGAGAGAAGCTGG + Intergenic
933721860 2:85402037-85402059 CTGGGGATGAGGAGAGCAGTGGG + Intronic
933811182 2:86033661-86033683 CTGGGGAGTTGGGGAGGAGTCGG - Exonic
933813448 2:86047787-86047809 CTGGGGAGATGCTGAGAAGGGGG + Intronic
933846688 2:86332543-86332565 CTGGGGAGAATGAGGGAAGGGGG - Intronic
934087901 2:88525509-88525531 CAGGGAAGATGGGGAGGAGTGGG + Intronic
934501763 2:94866854-94866876 GTGGGGAGAGGGAGAGAGGGAGG - Intergenic
934971953 2:98770934-98770956 CCGGGAAGATGGACGGAAGTGGG - Intergenic
935131652 2:100265288-100265310 CTGGGGAGAAGGAGAAGGGTGGG - Intergenic
935182114 2:100700747-100700769 CTGGGGTGATGGAGGGACATCGG - Intergenic
935549017 2:104431934-104431956 CTGGGTGAATGGAGAGAAGCGGG + Intergenic
935686231 2:105686182-105686204 GCGGGGAGATGAAGAGAGGTTGG + Intergenic
935720459 2:105974682-105974704 CCGGGGAGAGGGAGAAAAGATGG - Intergenic
935888523 2:107649786-107649808 CTGGGAGGAGGGAGAGAATTAGG + Intergenic
936019441 2:108983737-108983759 CTTTGGAGTTGGAGAGAAGGTGG - Intronic
936020118 2:108988429-108988451 GCGGGGAGAGGGAGAGAAGGAGG - Intronic
936139420 2:109926468-109926490 CTTGAGAGATGAACAGAAGTTGG + Intergenic
936205276 2:110445018-110445040 CTTGAGAGATGAACAGAAGTTGG - Intronic
936260267 2:110953818-110953840 CAGGAGAGAGAGAGAGAAGTCGG + Intronic
936574419 2:113641530-113641552 CAGGTGTGATGGAGAGAACTGGG + Intronic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
936911902 2:117602240-117602262 TGGGGGAGATGGAGAGAAGCAGG - Intergenic
937048841 2:118871609-118871631 CAGAGGAGCTGGAAAGAAGTAGG - Intergenic
937615161 2:123913435-123913457 CTGGGCTGATAGAGAGAACTTGG - Intergenic
938018171 2:127885327-127885349 CTGGGGAGTTGGGGAGACGATGG + Intronic
938265313 2:129923835-129923857 CTGGGGAGATTGAGGCAGGTAGG - Intergenic
938759893 2:134414745-134414767 GTGGGGATATGGGGAGATGTTGG - Intronic
939945319 2:148402518-148402540 CATGGAAGATGGGGAGAAGTAGG - Intronic
940388865 2:153107599-153107621 CTGGAGAGGAGTAGAGAAGTAGG + Intergenic
940701738 2:157053215-157053237 CTGAAGAGCTGGAGAGAAGAGGG + Intergenic
940916868 2:159265767-159265789 CTGGCTAGATCAAGAGAAGTAGG + Intronic
941126280 2:161587776-161587798 CTGGGGAAATGGGGAGATGGTGG - Intronic
941327903 2:164140820-164140842 AGGGAAAGATGGAGAGAAGTTGG - Intergenic
942296132 2:174519010-174519032 TTAGTGAGCTGGAGAGAAGTGGG - Intergenic
942534124 2:176945547-176945569 CTGAGGAGAGTGAGAGAAGGGGG - Intergenic
942677232 2:178440658-178440680 CTGGGAAAATGGAGAGAGATGGG - Intronic
942763144 2:179424043-179424065 CTTGAGAAATGGAGAGAATTAGG - Intergenic
943175657 2:184470086-184470108 AGGGAGAGATGAAGAGAAGTTGG + Intergenic
943731543 2:191307955-191307977 TTGGGGAGATGGAGGGATCTAGG - Intronic
943748385 2:191486106-191486128 CAAGGGAAATGGAGAGGAGTGGG - Intergenic
943805245 2:192116329-192116351 CTGAGGAAATGGGGAGATGTTGG + Intronic
944091324 2:195915082-195915104 CTGGGGAGAGAGAGAAAAATAGG + Intronic
944386574 2:199171502-199171524 CGGGGGAAAGGGTGAGAAGTGGG + Intergenic
944529572 2:200653999-200654021 CTGAGGAGAGGGAGAGAAATGGG - Intronic
944702700 2:202260062-202260084 GTTGGGAGATGGACAGAAATAGG - Intergenic
945519966 2:210814211-210814233 CAGGAGCAATGGAGAGAAGTAGG + Intergenic
945712767 2:213320532-213320554 AAGGGGAGATGAAGAGAAATTGG - Intronic
945779135 2:214146220-214146242 ATGTGGAGATGGAGAGATGTGGG - Intronic
945945715 2:215993920-215993942 CTGGAGAGATGTGGAGAAATAGG + Intronic
946091649 2:217230448-217230470 CCTGGGAGAGGGAGAGAGGTGGG + Intergenic
946419075 2:219554746-219554768 CGGGGGAGATGGAGAGAGGGAGG + Intronic
946901246 2:224374016-224374038 CTGAGGAGAGGGAGAGAGATGGG - Intergenic
946950699 2:224871398-224871420 CAAGGGAGAAGGAGAGAAATGGG - Intronic
947101029 2:226621503-226621525 ATGGGGAGGTGGAGAGAAACAGG - Intergenic
947636568 2:231683401-231683423 CTGGGGAGGAGGGGAGGAGTAGG + Intergenic
948238992 2:236412980-236413002 CCGTGGAGATGGGGAGATGTGGG + Intronic
948274731 2:236699670-236699692 CTGGAGAGATGGTGAGAAGATGG + Intergenic
948835343 2:240623685-240623707 AGGGGCAGATGGAGAGAGGTAGG + Intronic
948842173 2:240657169-240657191 CTGGGGAGCTGGGGAGGAGGGGG + Intergenic
948879133 2:240847259-240847281 CAGCGGAGAGGGAGAGAAGGAGG - Intergenic
1169275174 20:4228877-4228899 CTGGAGACGTGGAGAGAAGAAGG - Intronic
1169344721 20:4821284-4821306 ATGTGGAGATGGAGAGAGGTGGG + Intronic
1169653886 20:7900656-7900678 CTGAGGAGAGGGAGAGAGATGGG - Intronic
1169754605 20:9030596-9030618 GTGGTGAGGTGGTGAGAAGTGGG - Intergenic
1169836702 20:9888278-9888300 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
1169864835 20:10188687-10188709 CTGGGGATATGGAAACAAATTGG - Intergenic
1170517628 20:17148455-17148477 CTGGGGAGAGAGAGATAAGCTGG - Intergenic
1170630246 20:18058822-18058844 GAGGGGAGAGGGAGAGAAGGAGG + Intronic
1170687689 20:18584345-18584367 CAGGAGGGATGGAGAGAAGAGGG + Intronic
1170793817 20:19529482-19529504 TTGTGGAGATGGAGAGGAGATGG - Intronic
1170801938 20:19597702-19597724 GAGGGGAGATGAAGAGAGGTTGG - Intronic
1171077179 20:22139732-22139754 TTGCAGAGATGTAGAGAAGTTGG - Intergenic
1171182001 20:23097925-23097947 GTGGGCAGATGGAAAGCAGTGGG - Intergenic
1171941145 20:31331014-31331036 AGGGGGAGAAGGAGAGAAGAAGG + Intergenic
1172261287 20:33568043-33568065 TTGGACAGATGGAGAGAAGACGG + Intronic
1172330707 20:34074463-34074485 CTGGACAGAGGGAGAGAAGCAGG - Intronic
1172583415 20:36065654-36065676 CTGGACAGCTGGAGAGAAGGTGG - Intergenic
1172619569 20:36309999-36310021 TTGGGTAGATGGAGAATAGTGGG + Intronic
1172789598 20:37493702-37493724 CAGTGCAGATGGAGAGAAGGCGG - Intronic
1173230945 20:41197073-41197095 CAGGGCTGATGGAGAGAAGAAGG + Intronic
1173316257 20:41947028-41947050 CTGGGGGGATGAGGAGAGGTTGG - Intergenic
1173527657 20:43745296-43745318 CTGGGAGGAGAGAGAGAAGTAGG - Intergenic
1173614550 20:44394324-44394346 ATGGGGAGATGGAGATCAGAGGG - Intronic
1173648060 20:44646022-44646044 CTGGGGAGGTGGAGAGGAGCAGG - Intronic
1173672075 20:44805814-44805836 CTGGGGGTGTGGAGAGAAATCGG + Intronic
1173768228 20:45633199-45633221 CTGAGGAGAGGGAGAGAGATGGG - Intergenic
1173867046 20:46318980-46319002 GTGGGGAGGTGGGGAAAAGTGGG - Intergenic
1173910497 20:46665874-46665896 CTGGGAAGATGTAGAGAAACTGG - Intronic
1173910723 20:46668047-46668069 CTGAGGAGAGGGAGAGAGATTGG - Intronic
1173930867 20:46817227-46817249 CTGGGGAGGGGGAAAGGAGTAGG + Intergenic
1173942078 20:46919956-46919978 CTGAGCAGAGGGAGAGAGGTAGG + Intronic
1174037450 20:47677023-47677045 CTGGGCAGAGGGAGGGAGGTGGG + Intronic
1174039268 20:47687447-47687469 CTGGGGAAATGGCGGGAAGATGG + Intronic
1174173261 20:48629874-48629896 CTGGGCAGGTGAAGAGAATTAGG - Intronic
1174289983 20:49501348-49501370 ATGGGGAAATAGGGAGAAGTAGG - Intergenic
1174332272 20:49829849-49829871 CATGGGAGATGGAAAGAAGGGGG + Intronic
1174508709 20:51034758-51034780 GCTGGCAGATGGAGAGAAGTGGG - Intergenic
1174744917 20:53052130-53052152 CTGGGGAGTAGGAGAGAATGGGG - Intronic
1174986027 20:55452820-55452842 CTGAGGAGACAGAGAGAACTGGG + Intergenic
1175321944 20:58094445-58094467 CTGGGGATGTGGAGATGAGTGGG + Intergenic
1175487417 20:59355801-59355823 GGGGGGAGAGGGAGAGAAGAGGG - Intergenic
1175509269 20:59511550-59511572 CTGGGTAGATGGCCAGCAGTGGG + Intergenic
1175683451 20:61008671-61008693 CTGGGAGGGTGGAGAGAAGATGG - Intergenic
1175853262 20:62104927-62104949 CAGGGGAGGTGGAGAAAAGGAGG + Intergenic
1175857306 20:62129015-62129037 GGGAGGAGATGGAGAGAGGTGGG + Intronic
1176425789 21:6547541-6547563 CTCGGGGGATGGAGAGGAGAAGG - Intergenic
1176605628 21:8828100-8828122 GTAGAGAGAGGGAGAGAAGTAGG + Intergenic
1176946046 21:14982995-14983017 CTGAGGAGAGGGAGAGAGATGGG - Intronic
1177149516 21:17440897-17440919 CTGGGGTGCTGGAGAGAAGTAGG - Intronic
1177536213 21:22431557-22431579 CTGGGGAGAGAGAGAGATGAGGG - Intergenic
1177605055 21:23367250-23367272 ATGGGGAGCTGGAGAGGAGATGG + Intergenic
1177722930 21:24930180-24930202 AAGTGGAGATGGAGAGAAGGGGG - Intergenic
1177733852 21:25063820-25063842 ATGGGGTCATGGGGAGAAGTTGG - Intergenic
1177916651 21:27096913-27096935 AGGGGGAGATGGTGAGATGTTGG - Intergenic
1178040932 21:28640276-28640298 CTGGGGAGATGGAGACACAATGG + Intergenic
1178100537 21:29264054-29264076 CTGAAGAGAGGGAGAGAGGTGGG + Intronic
1178384599 21:32138875-32138897 CTGCTGAGATGGGGAGAAGTGGG + Intergenic
1178507611 21:33175581-33175603 CGGGGGAAATGGGGAGATGTTGG + Intergenic
1178960006 21:37056852-37056874 CTGGGGTGATGGGAAGCAGTTGG + Intergenic
1179033049 21:37736661-37736683 ATGGGGAGATGGAGAGAGGGAGG + Intronic
1179115043 21:38483132-38483154 ATGGGGAAATGGGGAGATGTAGG + Intronic
1179212736 21:39339308-39339330 TTGGGGAGATGGACAGATGCAGG - Intergenic
1179339966 21:40497473-40497495 GTGGGGAGTTGGGGAGATGTTGG + Intronic
1179469788 21:41602836-41602858 CTAGGGAGATGCAGGGAATTGGG + Intergenic
1179524022 21:41964079-41964101 CTGGGGAGATTTAGAGAGGAAGG - Intergenic
1179545979 21:42112456-42112478 CTGGGGAGATACAGAGCAGCTGG - Intronic
1179701280 21:43155858-43155880 CTCGGGGGATGGAGAGGAGAAGG - Intergenic
1180085999 21:45508171-45508193 CTGGGGAGATGGATGGATGGTGG + Intronic
1180347925 22:11719704-11719726 GTAGAGAGAGGGAGAGAAGTAGG + Intergenic
1180355703 22:11837806-11837828 GTAGAGAGAGGGAGAGAAGTAGG + Intergenic
1180382550 22:12154519-12154541 GTAGAGAGAGGGAGAGAAGTAGG - Intergenic
1180629219 22:17215808-17215830 CATGGGGGATGAAGAGAAGTTGG + Intronic
1181337464 22:22150057-22150079 AGAGGGAGAGGGAGAGAAGTTGG - Intergenic
1181740305 22:24916208-24916230 CTGGGGAGATGGAGGGGATGGGG - Intronic
1181922978 22:26334906-26334928 AAGGGGAGATGGAGAGATGCTGG - Intronic
1182464458 22:30505758-30505780 CTGGAGAGGAGGAGAGAACTGGG - Intergenic
1182534262 22:30988496-30988518 CTTTGGAGTTGGAGAGAAGATGG + Intergenic
1182983171 22:34691755-34691777 AAAGGGAAATGGAGAGAAGTAGG - Intergenic
1183046095 22:35221447-35221469 CTGGGAAGATGGAGCGAAGAAGG + Intergenic
1183672257 22:39280020-39280042 CCTGGGAGCTGGAGAGAATTGGG + Intergenic
1183829241 22:40409227-40409249 CTGGGGACATGGCCAGGAGTGGG - Intronic
1184505835 22:44901584-44901606 CTTGCAAGATGGTGAGAAGTTGG + Intronic
1184766768 22:46576467-46576489 CTGGGGAGATGCAGGGGTGTGGG + Intronic
1184994964 22:48198968-48198990 CTGGGCAGAGGGAGTGATGTAGG + Intergenic
949159298 3:860726-860748 CTGGAGACATGGAGAGGAGCGGG - Intergenic
949535014 3:4988848-4988870 CTGGAGGGAGGGAGAGAAGGAGG + Intergenic
949535668 3:4994682-4994704 TTGGGGAGATGGAAGGAAGCTGG - Intergenic
949926839 3:9048347-9048369 CTGGGGAGCTGGAGATGAGCTGG - Intronic
949935091 3:9110264-9110286 CTGTGGAGATGAAGAGGAGCAGG + Intronic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
950674783 3:14548160-14548182 CTGGGCAGAGGGTGGGAAGTGGG + Intergenic
951021357 3:17784222-17784244 TTGGGGATATGGGGAGATGTTGG - Intronic
951422344 3:22502225-22502247 GTGGGGAGATGGAAAGAAACAGG + Intergenic
951476455 3:23111625-23111647 CTGAAGAGATGGAAAGAACTTGG + Intergenic
951606165 3:24437389-24437411 GGGGGAAGATGAAGAGAAGTTGG + Intronic
952201187 3:31129577-31129599 CTGAGGAGAGGGAGAGAAACAGG + Intergenic
952214045 3:31258298-31258320 TTGGAGAAATGGAGAGATGTTGG - Intergenic
952227431 3:31392724-31392746 GTGCTGAGGTGGAGAGAAGTAGG - Intergenic
952439762 3:33314308-33314330 CAGGGGAAATGGGGAGATGTTGG - Intronic
952755136 3:36859116-36859138 GTGGGGAGCTGGAGAGGAGGCGG - Intronic
952845125 3:37681815-37681837 GTGAGGAGATGGAGGGAAATGGG - Intronic
953174443 3:40537022-40537044 CTGAGGAGAGGGAGAGAGATGGG - Exonic
953460527 3:43078422-43078444 AGGGGGAGAGGGAGAGAAGCTGG - Intergenic
953620893 3:44531889-44531911 CTGTGGAGATGGAAAGAAATGGG - Intergenic
953718178 3:45333535-45333557 CTGTGCAGATGGAAGGAAGTGGG + Intergenic
953882857 3:46700621-46700643 CTGAGGAGATGTAGAGACCTGGG - Intergenic
953978035 3:47397053-47397075 CTGAGGAGAGGGAGAGAGGCAGG + Intronic
954224526 3:49173464-49173486 CTGGGGTGGGGGAGAGGAGTAGG + Intronic
954576910 3:51681368-51681390 CTGGAGTGATGGAGAGAGATGGG + Intronic
954910186 3:54099060-54099082 ATGGGGGGATGGGGAGAAGCCGG - Intergenic
955078067 3:55632459-55632481 CAGGTGAGATGGAGACAAGGAGG + Intronic
955211156 3:56942505-56942527 CTGAGGAGAGGGAGAGAGATGGG - Intronic
955290344 3:57686770-57686792 CTGAGGAGAGGGAGAGAGATGGG - Intronic
955377762 3:58412248-58412270 ATGGGGAGATGCTGAGAACTTGG + Intronic
955416614 3:58697870-58697892 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
956141278 3:66149104-66149126 CTGTGGACATGGGGATAAGTGGG + Intronic
956373825 3:68592664-68592686 GTGGGGGGAGGGAGAGAATTAGG - Intergenic
956388978 3:68751409-68751431 CAGTGGGGATGGAGAAAAGTGGG + Intronic
956491592 3:69778053-69778075 CTGTGGAGATGGAGAGGAGGTGG + Intronic
956725694 3:72154905-72154927 GTGGGGGCATGGAGAGAAGCAGG - Intergenic
956873255 3:73438838-73438860 CTGGGCAGACTAAGAGAAGTTGG - Intronic
957507622 3:81144062-81144084 ACTGGGAGATTGAGAGAAGTTGG + Intergenic
957699901 3:83695377-83695399 GTGGGGTGTTGGGGAGAAGTAGG + Intergenic
957769036 3:84663935-84663957 CAGGGGAGAAGGAGAGAGGAAGG + Intergenic
957856032 3:85879995-85880017 CAGGGGCGATGGAGAGTAGAGGG - Intronic
957941370 3:87008921-87008943 GAGGGGTGATGAAGAGAAGTTGG - Intergenic
957955744 3:87184908-87184930 CTGAGGAGAAGAAGAGAAATAGG + Intergenic
958112150 3:89162524-89162546 TTGAGGAGAAGGAGAGAGGTTGG - Intronic
958162790 3:89837719-89837741 CTGGGGAGAGGGATAGCATTAGG + Intergenic
959089216 3:101884622-101884644 GACGCGAGATGGAGAGAAGTAGG + Intergenic
959760307 3:109955262-109955284 GAGAGGAGATGGAGAGAAGTTGG - Intergenic
960141919 3:114159343-114159365 AGGGAGAGATGGAGAGAAGGTGG - Intronic
960258867 3:115542033-115542055 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
960454778 3:117857284-117857306 AGTTGGAGATGGAGAGAAGTAGG - Intergenic
960478046 3:118154770-118154792 GTGGGGAAATTGGGAGAAGTTGG + Intergenic
960807553 3:121598674-121598696 TGGTGGAGATGGAAAGAAGTGGG + Intronic
960930915 3:122848945-122848967 GTGGGAGGATGAAGAGAAGTTGG - Intronic
961120972 3:124369727-124369749 CGGGGGAGTTGGGGAGATGTTGG - Intronic
961221516 3:125204584-125204606 TTGGGGGGATGAAGAGAGGTTGG + Intronic
961536267 3:127572906-127572928 CTGGGGAGGTGAAGAGAAACAGG - Intergenic
962299846 3:134229651-134229673 CTGGGGGAAGGGAGAGATGTTGG + Intronic
962436260 3:135369883-135369905 CAAGGGAGAGAGAGAGAAGTTGG - Intergenic
962743315 3:138379156-138379178 GTGGGGGGATGAAGAGAAGTTGG - Intronic
962809895 3:138950757-138950779 CTGGTGAGTGTGAGAGAAGTAGG - Exonic
962925028 3:139985028-139985050 CAGTGGAGATGGAGAGAAATGGG - Intronic
962931350 3:140040506-140040528 CTTGGGAGGTGGAGAGAAGAAGG + Intronic
962976781 3:140452618-140452640 CTGGGGAGCTGGACAGTAGCTGG + Intronic
962982933 3:140507092-140507114 CTGGGCAGAGGGAGGGAAGAGGG + Intronic
963024434 3:140904759-140904781 CAGTGGAGATGGTGAGAACTGGG + Intergenic
963191613 3:142479686-142479708 ATGGGGAAATGGAAACAAGTTGG - Intronic
963275568 3:143326447-143326469 ATGGTGAGAGGGAGAGAAGAGGG - Intronic
963638431 3:147828653-147828675 CAGTGGAGATGGAGACAAGTAGG + Intergenic
963888198 3:150603838-150603860 CTGCGGAGATGGGGATGAGTAGG + Intronic
964007635 3:151851255-151851277 ATGGAGAAATGGACAGAAGTAGG - Intergenic
964159750 3:153632774-153632796 AAGGTGAGAGGGAGAGAAGTAGG - Intergenic
964642412 3:158923825-158923847 CTGGGGAGAGGGAGAACATTAGG + Intergenic
965447367 3:168791692-168791714 ATGGGGAGATGAAGAGAAGTTGG + Intergenic
966028629 3:175317561-175317583 ATTGGGATATGGAGAGAAGTAGG - Intronic
966029963 3:175333687-175333709 CCGGGGGGATGAAGAGAGGTTGG + Intronic
966444569 3:179987309-179987331 ATGGGGAGAGGGAGAGAGGGAGG - Intronic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
966644727 3:182231669-182231691 CTAGGGAGAGGGAGAGAGATGGG + Intergenic
967201558 3:187076547-187076569 CTGGGGATTTGGAGAGAGATGGG + Exonic
967417535 3:189235393-189235415 AAGGGAAGATGGAGAGAGGTGGG + Intronic
967536038 3:190604486-190604508 CTAGGAAGCTGGGGAGAAGTCGG + Intronic
968979079 4:3837045-3837067 CTGGGGAGATGGAGCTTGGTAGG - Intergenic
969392360 4:6900413-6900435 ATGTGGGGTTGGAGAGAAGTGGG + Intergenic
969426668 4:7128439-7128461 TTTGGGAGATGGAGACACGTGGG - Intergenic
969586910 4:8099210-8099232 CTGGGGAGAAGCAGAGACTTGGG + Intronic
970109649 4:12623393-12623415 GTGGGGAGAAGGAGAGCATTAGG + Intergenic
970479452 4:16458561-16458583 ATGGGGAGCTGGAGAGGAGATGG + Intergenic
970546237 4:17133275-17133297 CTGAGGACATGGCAAGAAGTCGG - Intergenic
970696739 4:18686623-18686645 AGGGGGAGAAGGAGAGAAGGAGG + Intergenic
971052424 4:22876260-22876282 CAGTGGAGATGAAGAGAGGTGGG - Intergenic
971326477 4:25648447-25648469 CTGGGGAGATGGTGAAGGGTGGG + Intergenic
971441266 4:26689768-26689790 CTGAGGAAAGGGAGAGAAATGGG - Intronic
971471458 4:27031357-27031379 TTCAGGAGAGGGAGAGAAGTGGG - Intergenic
972375396 4:38465034-38465056 CTAGAGAGTTGGAGAGAGGTTGG + Intergenic
972789506 4:42357421-42357443 ATGGGGAGAGAGAGAGAAGAAGG + Intergenic
972988128 4:44790811-44790833 CAGGGGAGATGAAGAGGGGTTGG - Intergenic
973372482 4:49262889-49262911 GTAGAGAGAGGGAGAGAAGTAGG - Intergenic
973388521 4:49532252-49532274 GTAGAGAGAGGGAGAGAAGTAGG + Intergenic
973610989 4:52635867-52635889 GTGGTGAGGTGGGGAGAAGTGGG + Intronic
974281588 4:59801930-59801952 GTTGGGGGATGGAGAGAAGCAGG + Intergenic
975647271 4:76557464-76557486 CAGGGGAAATGGGGAGATGTTGG + Intronic
976047526 4:80968855-80968877 GTGGGGGGAAGGAGAGAAGAGGG - Intergenic
976330216 4:83823041-83823063 GTGGGGAGCTGGAGAGATGCAGG - Intergenic
976482382 4:85559742-85559764 CAGGGAAGATGAAAAGAAGTTGG - Intronic
976727915 4:88233151-88233173 TTGGGGAGGTGGGGGGAAGTGGG - Intergenic
976853105 4:89571752-89571774 CGGGGAAGAGGAAGAGAAGTTGG - Intergenic
977715117 4:100173529-100173551 TTGAGGAGAGGGAGAGAGGTGGG + Intergenic
978050536 4:104194082-104194104 CTGGGGGGAAGGAGAGCATTAGG - Intergenic
978561679 4:110040775-110040797 GAGGGGAGAGAGAGAGAAGTGGG - Intergenic
978957652 4:114634059-114634081 CTGCAGAGATGGTGAGAAGTGGG + Intronic
979258144 4:118625435-118625457 ATGGAGAGAGGGAGAGAATTGGG + Intergenic
979330203 4:119415133-119415155 ATGGAGAGAGGGAGAGAATTAGG - Intergenic
979669388 4:123346314-123346336 CTGGGGGGGTGGAGAGGGGTTGG + Intergenic
979880966 4:125960341-125960363 TGGGGGAAATGGAGAGATGTTGG - Intergenic
979919309 4:126478520-126478542 ATGGGGAGCTGGAAAGAAGATGG - Intergenic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
980270566 4:130578839-130578861 CTGAGGAGCTGGGGAGAAGCAGG - Intergenic
980322998 4:131303250-131303272 CTGGGTAGCTGGAGTGATGTAGG - Intergenic
981493012 4:145361191-145361213 CTGAGGAGAGGGAGAGAGATAGG - Intergenic
981638911 4:146912812-146912834 CTGGAAGGATAGAGAGAAGTAGG + Intronic
981658288 4:147137181-147137203 CAGTGGGGATGGAGAGAACTAGG - Intergenic
981778086 4:148393586-148393608 CTGAGGAGCTGGAGCTAAGTAGG - Intronic
981917539 4:150051424-150051446 CAGTGGAGGTAGAGAGAAGTGGG - Intergenic
981955296 4:150465050-150465072 CTGGGGTGAGGGAGAGAATGAGG - Intronic
982087591 4:151852042-151852064 CTGAGGAGATGCACAGAAGCTGG + Intergenic
982152765 4:152480385-152480407 CTGAGGAGAGGGAGAGAGATAGG - Intronic
982275046 4:153629794-153629816 GTGGGGAGATGGGGAGAAGCTGG - Intronic
982815949 4:159885001-159885023 CTGGGAAGATGCAGAGATGAAGG + Intergenic
982956763 4:161779110-161779132 CTGGGGAGAGGGATAGAGTTTGG + Intronic
983315593 4:166129073-166129095 GTGGGGAGAGGGAGAGAATCAGG - Intergenic
983987405 4:174076269-174076291 CTGAGGAGAGGGAGAGAGATAGG + Intergenic
984500201 4:180549154-180549176 AAGGGGAGATAGAAAGAAGTTGG - Intergenic
984637137 4:182123518-182123540 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
984758570 4:183345023-183345045 GTGGAGAGGTGGAGAGAAGTGGG + Intergenic
984783582 4:183548087-183548109 GGGAGGAGATGGAGAGATGTTGG - Intergenic
985317453 4:188673015-188673037 CTGGGGAGAGGGGCAGAGGTGGG + Intergenic
985707084 5:1407629-1407651 CACGGGAGATGGGGAGAAGCCGG - Intronic
985732809 5:1559341-1559363 TTGGGAAGAGGGAGAGAGGTGGG + Intergenic
985778177 5:1856299-1856321 GGGGAGAGATGGAGAAAAGTAGG + Intergenic
986216652 5:5725732-5725754 GTGGGGAGGAGGAGAGAAATGGG + Intergenic
986533931 5:8766845-8766867 GAGGGGAGATGGAGGGAAGAGGG + Intergenic
986572541 5:9180474-9180496 CTGGTGAGAAGGACAGAATTTGG + Intronic
986612137 5:9579707-9579729 CAGGGGAAAGGGTGAGAAGTGGG + Intergenic
986639349 5:9857155-9857177 AGGAGGAGATGAAGAGAAGTTGG + Intergenic
986763132 5:10898035-10898057 CTGGGGTGTTGGAGAGAGGCAGG + Intergenic
987058637 5:14220344-14220366 CTGAGGAGAGGGAGAGAGGCGGG - Intronic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987200391 5:15571393-15571415 CTGGGAAAATGAAGAGATGTAGG + Intronic
987652829 5:20766265-20766287 AAGAGGAGATGAAGAGAAGTTGG + Intergenic
987760373 5:22154373-22154395 TAGGGGAAATGGAGAGATGTTGG - Intronic
988156097 5:27450820-27450842 AGGAGGAAATGGAGAGAAGTAGG + Intergenic
988555391 5:32232045-32232067 CTTAGGAGATAGAGAGAAGGGGG - Intronic
988715839 5:33827192-33827214 CTGGGCAGAGGGACACAAGTCGG + Intronic
988742729 5:34095219-34095241 AAGAGGAGATGAAGAGAAGTTGG - Intronic
988793401 5:34630125-34630147 CTGGGGAGGTGGGGAGAGGAGGG - Intergenic
989125539 5:38049108-38049130 CAGGGGAGTGGGAGAGGAGTGGG + Intergenic
990058563 5:51617756-51617778 TAGAGGAGATGGAGAGAGGTTGG - Intergenic
990059546 5:51630400-51630422 CTGTGGAGATGTGGAGAAATAGG + Intergenic
990099016 5:52158234-52158256 ATGGGGAGATGGAACCAAGTTGG + Intergenic
990481580 5:56216316-56216338 CTGAGGAGAGGGAGAGAGATGGG - Intronic
990614939 5:57498247-57498269 ATGGGTGGATGGAGAGAAATAGG - Intergenic
990871763 5:60439718-60439740 CAGTGGAGATGGAGAGAGGTGGG - Intronic
991418424 5:66415740-66415762 CTGGGGAGAGGAAGAGAATGAGG + Intergenic
991487968 5:67157621-67157643 CAGGAGAGATGGAGAGGACTGGG + Intronic
991612541 5:68464238-68464260 ATGGGTGGATGGAGAGATGTTGG + Intergenic
991627329 5:68617084-68617106 ATGGGGAGATGAAGAACAGTTGG + Intergenic
991895122 5:71387788-71387810 TTGGGGAAATGGAGAGATGTTGG - Intergenic
991936238 5:71803628-71803650 CCAAGGAGAAGGAGAGAAGTAGG + Intergenic
991992093 5:72349920-72349942 CTGGAGGGAGGAAGAGAAGTTGG + Intronic
992467036 5:77016162-77016184 CTGGGGTGATGGTGGGAAGGTGG + Intergenic
993124376 5:83814630-83814652 GTAGGGAGATGAAAAGAAGTTGG + Intergenic
993275980 5:85859305-85859327 CTGAGGAGAGGGAGAAAAATGGG + Intergenic
993495096 5:88599974-88599996 CAGGGAAGGTGGAGAGGAGTGGG + Intergenic
993538562 5:89119276-89119298 CTGGGAAGATGAAGAGGAATTGG + Intergenic
993709402 5:91209254-91209276 CTGAGGAGAGGGAGAGAGATAGG + Intergenic
993787316 5:92159265-92159287 CTGAGGAGATGGAGAGTGGTGGG - Intergenic
993805719 5:92406656-92406678 CTAAGGAGATGGAGAGAAATGGG - Intergenic
994038109 5:95225799-95225821 GAAGGGAGATGGAGAGAAGAGGG - Intronic
994883163 5:105524499-105524521 GTTGGGAGCTGGAGAGATGTTGG - Intergenic
994909945 5:105890701-105890723 TTGGTGAGATGTAGAGAAATTGG + Intergenic
994994036 5:107036853-107036875 CTGGGGGGATGAAGAGAGGTGGG + Intergenic
995134741 5:108668954-108668976 CTGGGGAGATGGAGAAAATATGG - Intergenic
995186326 5:109275494-109275516 CTGGGGACAGGGAGAGAGTTCGG + Intergenic
995298287 5:110545576-110545598 ATGTGGAGAAGGAGAGAAATAGG + Intronic
995542317 5:113197176-113197198 CTGGGTCGATGGGGAGATGTTGG + Intronic
996139508 5:119888708-119888730 CTGTGGAGTTGGAGAGTAGTGGG + Intergenic
996143484 5:119944325-119944347 CTTGGAAGTTGGGGAGAAGTGGG + Intergenic
996285328 5:121784287-121784309 CAGTGGAGATGGAGAGACGTGGG + Intergenic
996368787 5:122731257-122731279 AAGGGGAGATGAAGAGAGGTTGG - Intergenic
996496845 5:124168140-124168162 CTGGGGAGAGGGAGAGCATCAGG - Intergenic
996569459 5:124916667-124916689 CTGGCGAGATGTGGAGAAATAGG + Intergenic
997523615 5:134538822-134538844 TTGGAGAGATGGAGAGATGGAGG + Intronic
997566649 5:134892814-134892836 CTGAGGAGAGGGAGAGAGATGGG + Intronic
997678995 5:135736069-135736091 CTGGGGAGGAGGGGAGAGGTCGG + Intergenic
997695080 5:135854986-135855008 CTGAGGAGAGGGAGAGAGATAGG + Intronic
998405271 5:141870683-141870705 CAGGGGAGATGGGCAGAAGAAGG - Intronic
998641230 5:144013611-144013633 CTGAGGAGATGAAGGGGAGTAGG + Intergenic
998887995 5:146714823-146714845 CAGGGGAGAGGGAGAGAATAAGG - Intronic
998985587 5:147752710-147752732 ATGGGGAGATGGAGAGATCTAGG + Intronic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
999500430 5:152141569-152141591 CTGGGCAGATGGAGAACTGTGGG + Intergenic
999670708 5:153956987-153957009 TTGGTCAGAGGGAGAGAAGTCGG - Intergenic
1000129270 5:158279743-158279765 CTGAGGAGATGGAGAGAGATGGG - Intergenic
1001064353 5:168524124-168524146 GAGGGAAGATGAAGAGAAGTGGG + Intergenic
1001734622 5:173988660-173988682 CAGGGGAGATGGAGGGAAGTGGG - Intronic
1002026078 5:176397132-176397154 CGGAGGAGATGGAGATAAGGAGG - Intronic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002205248 5:177558325-177558347 CTGGGGAGAGAGGAAGAAGTAGG - Intergenic
1002533895 5:179865611-179865633 CAGGGCAGCTGGAGAGAAGCTGG + Intronic
1002606404 5:180385367-180385389 CGGTGGAGATGGGGAGAAGATGG + Intergenic
1002805173 6:567009-567031 CAGTGGAGTTGGAGAGCAGTTGG - Intronic
1003281503 6:4696126-4696148 GAGGGGAGATGGGGAGATGTTGG + Intergenic
1003651356 6:7963406-7963428 GTGGGGAAATGGGGAGATGTTGG + Intronic
1003847249 6:10185914-10185936 ATGGGGAGATGGGCAGGAGTAGG - Intronic
1005633863 6:27734711-27734733 CTGGGGAAGTGAAGAGAAATGGG - Intergenic
1006191023 6:32209361-32209383 AGGGGGAGATGAAGAGAGGTTGG + Intronic
1006497134 6:34431870-34431892 CTGTGGTGATGGAGAGTAATGGG + Intergenic
1006576539 6:35050678-35050700 CTGTGCAGATGGGGAGAAGCCGG - Intronic
1006748607 6:36362679-36362701 CTGGGGAGATGGAGAAAAGGTGG + Intronic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1006920750 6:37625655-37625677 GAGGGAAGAGGGAGAGAAGTTGG - Intergenic
1007080352 6:39096971-39096993 GTTGGAAGATGGAGAAAAGTAGG + Intergenic
1007550303 6:42724207-42724229 TTGGGGAGATGGAGAATAATGGG - Intergenic
1007742289 6:44020267-44020289 CTGGGGTGATGGGGAGGAGCAGG + Intergenic
1007755585 6:44097266-44097288 CTGGGGTGTTGGAGGGAACTTGG - Intergenic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1007995756 6:46306115-46306137 CAGGGGATATGGTGAGGAGTAGG + Intronic
1008653924 6:53591749-53591771 GTGGGGGAATGAAGAGAAGTTGG - Intronic
1008798476 6:55337138-55337160 GAGGAGAAATGGAGAGAAGTTGG - Intronic
1008812539 6:55521702-55521724 CTAAGGAGACGGAGAGAGGTGGG - Intronic
1008924064 6:56873723-56873745 GAGGGGAGATGAAGAGAGGTTGG + Intronic
1009749944 6:67869947-67869969 CTGATGAGAAGGAGAGAAATTGG + Intergenic
1009858689 6:69296400-69296422 TTTGGGAGATAGGGAGAAGTGGG - Intronic
1010246604 6:73665368-73665390 AAGGGGGGATGAAGAGAAGTTGG + Intergenic
1010405501 6:75500998-75501020 GTGGGGAGAGGAAGAGAAGTGGG + Intergenic
1010475155 6:76277521-76277543 AGGGGGAGATGAAGAGAGGTTGG - Intergenic
1010490396 6:76469233-76469255 CTTGAGGGATGAAGAGAAGTAGG - Intergenic
1010867407 6:80996069-80996091 CTGGTGAGATGTAGAGAAAAGGG - Intergenic
1010881861 6:81185825-81185847 CTTGGGAAATGGAGAGAATTTGG + Intergenic
1010945398 6:81968706-81968728 ATGGGAAGATGGTTAGAAGTTGG - Intergenic
1011249921 6:85360295-85360317 CTGAGGAGCTGGAGAGAAGTTGG + Intergenic
1011576582 6:88807097-88807119 ATGGGGAGAGGGAGAGCATTAGG + Intronic
1013082052 6:106821625-106821647 CTGGGGAGGCGGGGAGAAGGGGG - Intergenic
1013173533 6:107658438-107658460 CTGGGGAGAAGCAGAGATGGTGG - Exonic
1013919160 6:115380280-115380302 CTGAAGAGAGGGAGAGTAGTGGG - Intergenic
1014072738 6:117201970-117201992 ATGAGGAGATGCAGATAAGTTGG - Intergenic
1014078050 6:117259589-117259611 GTGGGGAGATTGAGAGATGTTGG - Intergenic
1014436594 6:121427492-121427514 ATGGGGAGATAAAGAGAAGTTGG + Intergenic
1014724550 6:124959522-124959544 AGGGGCAGATGAAGAGAAGTTGG + Intergenic
1015369181 6:132431423-132431445 GAGGGGAGATGAAGAGAGGTTGG - Intergenic
1015598076 6:134885144-134885166 GAGGGGAGATGGAGAGAGGGGGG + Intergenic
1015648290 6:135421043-135421065 CTGAAGAGAGGGAGAGAAATGGG + Intronic
1015857832 6:137644569-137644591 GGGGGGAGATGAAGAGAAATGGG - Intergenic
1016136004 6:140543988-140544010 CTGGAGAAAGAGAGAGAAGTGGG - Intergenic
1016279725 6:142401729-142401751 GTGGAGAAATGGAGAGAATTTGG + Intronic
1016434322 6:144020097-144020119 GTGGAGAGAGGGAGAGAAGGAGG - Intronic
1016604726 6:145907295-145907317 CGGTAGAAATGGAGAGAAGTGGG - Intronic
1016616939 6:146061058-146061080 CTGTGGAGAGGGAGAGAGATGGG + Intronic
1017043464 6:150325920-150325942 CAGGGGAGGTGGTGAGAAGTGGG + Intergenic
1017337221 6:153275668-153275690 TTGGGGAGAGGGAGAGGATTGGG - Intergenic
1017612846 6:156209473-156209495 GAGGGGAGATGAAGAGAAGCTGG - Intergenic
1017734674 6:157350484-157350506 CTGAGGAGAGGGAGAGATATAGG - Intergenic
1018712560 6:166507142-166507164 CTGGGAAGAGGGAGGGAAGAGGG - Intronic
1018988826 6:168658097-168658119 ATGGGGAGATGGAGAGCAGGTGG + Intronic
1019327600 7:445986-446008 ATGGAGAGATGGAGAAAAGAAGG + Intergenic
1019755532 7:2766116-2766138 CTGGGCAGATGGGGGGAAATGGG - Intronic
1019900989 7:4020498-4020520 CTGGGGAGGTGAAGGGAAGACGG + Intronic
1020431822 7:8123258-8123280 CTGGGGAAATGGAGAGGAAGGGG - Intronic
1020654394 7:10912171-10912193 CAGTGGAGGTGGAGAGAAGAGGG - Intergenic
1020986332 7:15139494-15139516 GTGGGAGGAGGGAGAGAAGTAGG - Intergenic
1021333099 7:19363589-19363611 CTGGGGAAATGTAGATAAATTGG - Intergenic
1021376569 7:19915143-19915165 CTGAGGAGCAGGAGAGAAATGGG + Intergenic
1021381221 7:19969040-19969062 TGGGGGAGATGGGGAGAGGTTGG - Intergenic
1021602064 7:22374054-22374076 GTGAGGAGATGGTGAGAAGGTGG - Intergenic
1021627645 7:22610081-22610103 TAGTGGAGATGGAGAGAAGTTGG - Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1022248822 7:28586636-28586658 GTGGTGTGATAGAGAGAAGTGGG + Intronic
1022394064 7:29969986-29970008 CAGTGGAGGTGGAGAGGAGTGGG - Intronic
1022404824 7:30078892-30078914 CTGGGGGGATGGACAGGAGGTGG + Exonic
1022437343 7:30401878-30401900 GTGGGGAGAAGAAGAGAAGAGGG - Intronic
1022548893 7:31217651-31217673 CTGAGGAGAGGGAGAGATGAGGG + Intergenic
1022552471 7:31254282-31254304 TAGGGGAAATGGAGAGATGTTGG - Intergenic
1022594545 7:31699954-31699976 CAGGGGAGAGGGAGAGAGATAGG - Intronic
1022729604 7:33010082-33010104 CAGGGAAGATGGAGAGGAATAGG - Intergenic
1022729620 7:33010221-33010243 CTGTGGAACTGGAGAGAAGTGGG - Intergenic
1022922727 7:35032883-35032905 CTGTGGAGATGGAGAGAAATTGG - Intronic
1023569520 7:41557490-41557512 CTGGGGAGATGGGGAGGGGGAGG + Intergenic
1023765362 7:43505332-43505354 CAGTGGAGATGAAGTGAAGTGGG - Intronic
1023773250 7:43579289-43579311 CTGAGGAGAGGAAGAGAAATGGG + Intergenic
1023961188 7:44927721-44927743 CTGGGGAGATTGAGACAGGCTGG + Intergenic
1023992753 7:45139212-45139234 CTGGGGAGACAGAGAGAGGGCGG - Intergenic
1024454638 7:49589896-49589918 CAGTGGAGATGTAGAGAAATTGG + Intergenic
1024657514 7:51464206-51464228 GGATGGAGATGGAGAGAAGTGGG + Intergenic
1025978131 7:66385759-66385781 CAGGAGAGAGGGAGAGAATTAGG - Intronic
1026253557 7:68691322-68691344 CTAGGTACATGGACAGAAGTTGG + Intergenic
1026339615 7:69424149-69424171 CTGGGGTGCTGGGGAGAAATGGG + Intergenic
1027271291 7:76520548-76520570 CAGGGATGATGGAGAGAAATGGG - Intergenic
1027321055 7:77010483-77010505 CAGGGATGATGGAGAGAAATGGG - Intergenic
1027732429 7:81891800-81891822 GGGGAGAGATGGAGAGATGTTGG + Intergenic
1027916230 7:84325895-84325917 GTGGGGAAATGGGGAGATGTTGG - Intronic
1027932839 7:84561475-84561497 CTGGGGAGATAGAGTGACATGGG + Intergenic
1028101785 7:86829605-86829627 CTGAGGTGATGGAGAGAGATAGG + Intronic
1028320313 7:89451289-89451311 CTGGGGAGATGAAGGGAGGGAGG - Intergenic
1028775648 7:94673240-94673262 CTGGGGAGGAGGAAAGGAGTAGG - Intergenic
1029551891 7:101240907-101240929 CTGGGGAGGGGCAGAGAAGAGGG + Intronic
1029580233 7:101432353-101432375 CTGAGGACATGAAGAGGAGTGGG + Intronic
1029712884 7:102309126-102309148 CTGGGGACCTGGAAGGAAGTTGG + Intronic
1030113059 7:106042714-106042736 GTGGGGAGATAGAGAGAGGCTGG + Intergenic
1030350260 7:108476985-108477007 TAGGGGAAATGGAGAGATGTTGG + Intronic
1031815286 7:126426156-126426178 CTGAGGAAAGGGAGAGAAATGGG + Intergenic
1032089726 7:128905416-128905438 CTGGGGACATGAAGAGAGCTGGG - Intronic
1032318650 7:130864771-130864793 CAGGGGGAATGAAGAGAAGTTGG + Intergenic
1032323908 7:130908849-130908871 TTGGGGGGATGGGGAGATGTGGG + Intergenic
1033235705 7:139636327-139636349 CTGGGTGGAAGGAGAGAAGACGG - Intronic
1033492663 7:141859533-141859555 CTGGTGAGATGGGGAGAGGGTGG + Intergenic
1033845932 7:145432151-145432173 CTGAGGAGAAGGAGAGATGAGGG + Intergenic
1033857176 7:145577876-145577898 ATGGGGAGCTGGAAAGGAGTTGG + Intergenic
1034397083 7:150835304-150835326 GTGGGGAGATGGGGAGATGTTGG + Intronic
1034690353 7:153008699-153008721 CTGGGAAAAAGGAGAGAAATGGG + Intergenic
1035237692 7:157509271-157509293 ATGGGGAGAAGGAGAGAGGGGGG + Intergenic
1035382426 7:158448390-158448412 CTGGGGAGGAGGAGGGAGGTTGG + Intronic
1035391680 7:158508550-158508572 GTGGGGAGCTGGAGAGGAGCAGG + Intronic
1035444689 7:158932282-158932304 CTTGGGGGATGGAGTGCAGTGGG + Intronic
1035482144 7:159195777-159195799 CTGGGGAGAGGGAGGGATGGGGG + Intergenic
1035553281 8:545395-545417 CGGGGGAGAAGGAGAGAACCGGG - Intronic
1035693020 8:1572218-1572240 CTGATGAGATGGAGAGGAGAGGG + Intronic
1036032136 8:4985520-4985542 CTGGGGATAGGAAGAGAATTGGG - Intronic
1036108074 8:5863666-5863688 CTGAGGAGATGGAGAGAGACAGG + Intergenic
1036614906 8:10380720-10380742 CTGGAGAGATGGATGGAAGGAGG + Intronic
1036787333 8:11696990-11697012 CCGGGGAGATGGTGTGAAATAGG + Intronic
1037456185 8:19066566-19066588 CTGTGGAGTAGAAGAGAAGTTGG - Intronic
1038402531 8:27296304-27296326 CTGGGGAGAGGGAGAGCATCAGG - Intronic
1038449500 8:27630688-27630710 GTGGGGAGAGGAAGAGAATTTGG - Intergenic
1038946445 8:32366326-32366348 GGGGGCAGATGAAGAGAAGTTGG - Intronic
1039209151 8:35192126-35192148 TGGGGGTGATGGAGAGATGTTGG - Intergenic
1039913526 8:41843379-41843401 GGGGGGAAATGAAGAGAAGTGGG - Intronic
1039929051 8:41966564-41966586 TTAGGTAGATGGAGAGAACTAGG - Intronic
1040416706 8:47202240-47202262 CTGGGGAGATGGACACACCTTGG + Intergenic
1040514445 8:48123357-48123379 CTGGGCAGAAGCAGAGAAGGTGG + Intergenic
1040685823 8:49871653-49871675 CTGAGGAGAAGGAGAGATGGGGG + Intergenic
1040686544 8:49879721-49879743 CGGGGAAAATGGAGACAAGTTGG - Intergenic
1040732407 8:50464483-50464505 CTGCAGAGAGGGAGAGAAATGGG + Intronic
1041006384 8:53500370-53500392 GTGGTGAGATGGGGAGATGTAGG - Intergenic
1041224594 8:55685800-55685822 CTTGGGAAATAGAGAGAAGCAGG + Intergenic
1041523463 8:58779736-58779758 AGGTGGAGATGAAGAGAAGTAGG - Intergenic
1041569786 8:59324541-59324563 ATGGGAAGATGGGGAGGAGTGGG - Intergenic
1041800051 8:61788936-61788958 TAGGGGAAATGGAGAGATGTTGG - Intergenic
1041878226 8:62715084-62715106 CAGAGGAGAGAGAGAGAAGTAGG + Intronic
1041896182 8:62926940-62926962 CTGGGCAGAGGGAGTAAAGTTGG - Intronic
1042016138 8:64314623-64314645 CAGCAGAGAGGGAGAGAAGTGGG + Intergenic
1042332940 8:67600369-67600391 GTGGGTGGATGGAGAGATGTTGG + Intronic
1042807012 8:72781964-72781986 CTGGGGAGAGGGAGAGCATCAGG + Intronic
1042882413 8:73508359-73508381 CTGAGGAGATGGAGAGAGATGGG + Intronic
1042943452 8:74130964-74130986 CTGGGGAGATGGAGAGAGTTGGG + Intergenic
1043689553 8:83133026-83133048 CTGATGAGATGTAGAGAAATGGG + Intergenic
1043693398 8:83186512-83186534 GTGGGAAGAAGGAGAGAAGCAGG + Intergenic
1043728621 8:83646086-83646108 CTGGGAAGAGGGAGAGCATTAGG - Intergenic
1043973832 8:86563352-86563374 ATGGGGCACTGGAGAGAAGTGGG - Intronic
1043977823 8:86602925-86602947 CTGGGGAGATGAAGCCAAATAGG - Intronic
1044094977 8:88052412-88052434 CAGTGGAGATGGAGCAAAGTGGG - Intronic
1044557298 8:93577425-93577447 CTGTACAAATGGAGAGAAGTGGG + Intergenic
1044604819 8:94039433-94039455 CAGTGGAGATGGAGAGAGATGGG + Intergenic
1044613675 8:94118758-94118780 CTGAGGGGATGGAGAAAAATGGG + Intergenic
1044810010 8:96050539-96050561 GTGGGGAGATAAAGAGAGGTTGG + Intergenic
1044947438 8:97402867-97402889 CTGGGGAGATACCCAGAAGTGGG + Intergenic
1045130431 8:99145935-99145957 CTGGGAAGATGTAAAGAAGCTGG - Intronic
1045322199 8:101090801-101090823 CAGTGGGGATGGAGAGAATTGGG + Intergenic
1045520465 8:102898659-102898681 CTGGGAGGAAGGAGAGAAGAGGG + Intronic
1045803789 8:106133055-106133077 TTGGGGAGATGGAGCCTAGTGGG + Intergenic
1046023092 8:108689868-108689890 CTGGAGAAATGGAGAGGAGGGGG - Intronic
1046026028 8:108725084-108725106 CAGGGGAGATGGCTCGAAGTGGG - Intronic
1046091980 8:109513813-109513835 CAGTGGAGGTGGTGAGAAGTGGG - Intronic
1046424025 8:114022741-114022763 CTGAGGAGAGGGAGAGAAATGGG + Intergenic
1046515000 8:115247558-115247580 CAGGGGAGCTGGAGAAATGTAGG - Intergenic
1046713837 8:117545622-117545644 TGGGGGAGAGGGAGAGGAGTCGG + Intergenic
1046869759 8:119192742-119192764 CTGGGAAGGGGAAGAGAAGTGGG - Intronic
1047009897 8:120660882-120660904 CTGAGGAGAGGGAGAGAGATGGG + Intronic
1047030921 8:120879833-120879855 CAGTGGACCTGGAGAGAAGTTGG + Intergenic
1047066339 8:121288158-121288180 CTGGGCAAATGGTGACAAGTTGG + Intergenic
1047085952 8:121515362-121515384 GTGGGGAGAGGGAGAGCATTAGG - Intergenic
1047939777 8:129818086-129818108 CAGGAGAGATGGAGAGATGTAGG - Intergenic
1048348286 8:133595130-133595152 CTGGAGAGAGAGAGAGAAGGAGG + Intergenic
1048496565 8:134940627-134940649 TTGGAGAGATGGAGAAAGGTAGG + Intergenic
1048497711 8:134948811-134948833 CAGGGAAGATGAAGAGAAGGAGG - Intergenic
1048506071 8:135023121-135023143 ATGGGGAGATGAAGACAGGTTGG - Intergenic
1048543546 8:135365093-135365115 CTGGGCAGAGAGAGACAAGTTGG - Intergenic
1048969142 8:139634645-139634667 CTGGGGACCTGGAGACAAATTGG - Intronic
1049046885 8:140159422-140159444 CTAAGGAGTTGGAGAGCAGTGGG - Intronic
1049151603 8:141038590-141038612 CTGGGGAGGAGGAGAGCAGCGGG - Intergenic
1049238162 8:141523088-141523110 CTGGGGAGGTGGAAAGAACCTGG - Intergenic
1049251325 8:141590747-141590769 CTGGGGAGGTGGAGAGAGTGTGG - Intergenic
1049272879 8:141705415-141705437 ATGGAGAGATGGAGAGATGATGG + Intergenic
1049272908 8:141705539-141705561 ATGGGGAGATGGGGAGATGAAGG + Intergenic
1049299037 8:141860088-141860110 ATGCGGAGATGGAGAGAGGTGGG + Intergenic
1049302283 8:141877966-141877988 CTGGAGAGAAGGAGACTAGTGGG - Intergenic
1049466110 8:142752006-142752028 CAGTAGAGATGGAGAGGAGTGGG - Intronic
1050085068 9:1956562-1956584 AAGAGGAGATGGAGAGAGGTTGG + Intergenic
1050520232 9:6489548-6489570 CTGGTGAGATGCAGAGAAACTGG - Intronic
1050762536 9:9090188-9090210 CCAGGGAGATGAAGAGAGGTAGG - Intronic
1050858308 9:10390925-10390947 CTGGGGACATTGACAGATGTTGG - Intronic
1050947001 9:11536017-11536039 ATGGGGAGATGGAGAGAAGTTGG + Intergenic
1051099324 9:13502902-13502924 ATGGGGAAAGGGAGAGAAGCAGG - Intergenic
1051123750 9:13780383-13780405 CTGAGGAGAGGGAGAGACATGGG - Intergenic
1051252949 9:15180662-15180684 GTTGGAAAATGGAGAGAAGTTGG - Intronic
1051252951 9:15180680-15180702 ATTGGAAAATGGAGAGAAGTTGG - Intronic
1052209314 9:25882896-25882918 GTGAGGAAATGGGGAGAAGTAGG - Intergenic
1052385331 9:27816399-27816421 GTAGGGAGATAAAGAGAAGTTGG + Intergenic
1052658547 9:31398245-31398267 AGGGGGAGATGAAGAGAAGTTGG - Intergenic
1052686975 9:31769251-31769273 TTGGGGAGGTAAAGAGAAGTTGG + Intergenic
1054839411 9:69719969-69719991 CTGGGGTGAGGGAGAGAGATGGG - Intronic
1054957758 9:70932933-70932955 CAGAAGAGATGGTGAGAAGTAGG + Intronic
1055124400 9:72702592-72702614 CAAGAGAGATGGAGAGAATTTGG + Intronic
1055646374 9:78365123-78365145 CTGGGGCGAGGGAGAGGGGTGGG + Intergenic
1055758664 9:79582864-79582886 CTGGGCTGTTGGAGAGAAGCAGG + Intronic
1055760458 9:79601679-79601701 CTGAGGAGAGGGAAAGAAGGGGG - Intronic
1055984460 9:82042370-82042392 TTGGGGAAATAGAGAGAAATTGG - Intergenic
1056322263 9:85446832-85446854 CTGGGTAGATGGTCAGTAGTGGG + Intergenic
1056491178 9:87108771-87108793 CTGGGGAGATGGAGTCACTTGGG - Intergenic
1056592178 9:87972638-87972660 CTGTGGCTATGGAGAGCAGTGGG + Intronic
1056901311 9:90602464-90602486 CTGGGGAGATACCCAGAAGTGGG + Intergenic
1057010358 9:91595971-91595993 GTGGGGAGATGGAGAGAATCAGG - Intronic
1057268843 9:93635919-93635941 CTGGGGAGGTGGGGAGGAGACGG + Intronic
1057304811 9:93905860-93905882 CTGGGGACAGTGAGAGGAGTGGG - Intergenic
1057575691 9:96240602-96240624 GTGGCGAGGTGGAGAGAAGCCGG - Intronic
1057918318 9:99074771-99074793 CTGAGGAGGTGGAGAGCAGGTGG - Intergenic
1058288452 9:103209099-103209121 CAGGGGAGACAGAGAGAAGGGGG + Intergenic
1058466727 9:105236352-105236374 TTTGGGGGATGGAGAGAAGACGG + Intergenic
1058603742 9:106698379-106698401 CTGGTGAGATAGAGTTAAGTAGG + Intergenic
1058732292 9:107861922-107861944 AAGAGCAGATGGAGAGAAGTGGG + Intergenic
1058919968 9:109604014-109604036 CTGGGAAGTGGGAAAGAAGTAGG - Intergenic
1058935163 9:109763306-109763328 CTATGGAGATGGAGAGAAAAGGG - Intronic
1059118285 9:111618232-111618254 GTGGGGAGAGGGAGAGGAGAGGG + Intergenic
1059368043 9:113801813-113801835 CTGGGGTGAGGGAGAGAAGGCGG + Intergenic
1059572509 9:115454778-115454800 CTGAGGAGAGGGTGAGAGGTGGG + Intergenic
1059710956 9:116867260-116867282 CCGAGGAGAGGGAGAGAAGGTGG + Intronic
1059763353 9:117360502-117360524 CTGGGGATATGGAGATGAGCAGG + Intronic
1059770159 9:117416133-117416155 CAGGGAAGATGAAGAAAAGTAGG - Intergenic
1059820652 9:117968659-117968681 TGGGGGAGATGGAGAGAACAAGG + Intergenic
1059821850 9:117982476-117982498 CTAGAGAGATGGGAAGAAGTTGG - Intergenic
1059833647 9:118126659-118126681 CTGAGGAGAGGGAGAGACATGGG - Intergenic
1059853450 9:118368749-118368771 ATGGGGAGAGGGAGAGAAGGAGG + Intergenic
1060165975 9:121415720-121415742 CTGGGAAGATGTGGAGAAATAGG - Intergenic
1060619401 9:125050165-125050187 TTGGGGAAATGGAATGAAGTGGG - Intronic
1060654376 9:125358978-125359000 CTTTGTAGATGAAGAGAAGTAGG - Intronic
1060686804 9:125622139-125622161 ATGGGGAGATGGGGAGAGGCTGG + Intronic
1060820086 9:126656580-126656602 CTTGGGACATGGGGAGAGGTGGG + Intronic
1060956829 9:127647589-127647611 CAGAGGAGATGGTGAGAAGTGGG - Intronic
1060991659 9:127853256-127853278 GTGGGGAGGTGGGGAGAAGTTGG + Intronic
1061271281 9:129544840-129544862 CTGGGGAGGTGGAGAGTAGGAGG - Intergenic
1061433045 9:130543307-130543329 CTGGGGACATGCAGAGGAGGGGG - Intergenic
1061749532 9:132767959-132767981 CAGGGGAGGTGAAGAGAGGTTGG + Intronic
1062085055 9:134644106-134644128 CCTGGGAGGTGGAGAGACGTTGG - Intronic
1062145667 9:134988437-134988459 GGGGGCAGATGGAGGGAAGTTGG - Intergenic
1062170713 9:135133289-135133311 CAGGCGAGCTGGAGAGAAGGGGG + Intergenic
1185922232 X:4106538-4106560 TGGGGGAAATGGAGAGATGTTGG - Intergenic
1186503219 X:10068703-10068725 CTGCAGAGATGGAGATAAGATGG - Intronic
1186934762 X:14436314-14436336 ATGGGAAGATGGGGAGAAGCTGG - Intergenic
1187082551 X:16006688-16006710 GTGGGGAGAGGGAGAGCATTAGG - Intergenic
1187949785 X:24460490-24460512 GTGGGGGGAGGGAGAGAGGTAGG + Intergenic
1187984522 X:24796063-24796085 CTGGAGAGGAGGAGAGAGGTGGG - Intronic
1187984662 X:24797217-24797239 CAGGGGAAATGGAGAGAGGGTGG - Intronic
1188221880 X:27550662-27550684 GAGGGAAGATGGAGAGAGGTTGG - Intergenic
1188291446 X:28393611-28393633 CTGAGGAGAAGGAGAGAGATGGG + Intergenic
1188721157 X:33525522-33525544 ATGGGGAAATGGGGAGATGTTGG + Intergenic
1189214516 X:39311640-39311662 GGTGGGGGATGGAGAGAAGTGGG - Intergenic
1189224941 X:39404853-39404875 TTGGGGAAATGGGGAGATGTTGG - Intergenic
1189354107 X:40298581-40298603 CTGGGCAGATGGAGAGGGGGAGG - Intergenic
1189552002 X:42102851-42102873 CTGGGGAGAAGGAGAGCATGGGG - Intergenic
1189778070 X:44487900-44487922 GAGGGGAGAAGGAGAGAAGCTGG + Intergenic
1190018524 X:46850721-46850743 CTGGGGCGGGGAAGAGAAGTGGG - Intronic
1190101700 X:47527103-47527125 CTGGGGAGCTGGAGAGATTGTGG - Intergenic
1190302526 X:49065010-49065032 CAGGTGAGAGGGGGAGAAGTGGG - Intronic
1190335464 X:49259073-49259095 CAGTGGAGAAGGCGAGAAGTGGG + Intronic
1190429843 X:50368511-50368533 CCAGGGAGATGAAGAGAAGGGGG - Exonic
1190467139 X:50736390-50736412 CTGGGGAGATGGAGAGCGTTAGG - Intronic
1190473629 X:50807227-50807249 GTGGGGAGATGGGGAGAAAGAGG + Intronic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1191073016 X:56421765-56421787 CTGGGGGGATGGAGCCAAGATGG - Intergenic
1191711127 X:64150991-64151013 CAGGAGAGAGAGAGAGAAGTGGG + Intergenic
1191911774 X:66159337-66159359 CGGTGGAGATAGAGAGAAGTGGG + Intergenic
1193193800 X:78605834-78605856 AGGGAGAGATGAAGAGAAGTTGG + Intergenic
1193740033 X:85205892-85205914 CAATGGAGATAGAGAGAAGTGGG + Intergenic
1193782602 X:85722205-85722227 CGGGGGGGATGAAGAGAGGTTGG - Intergenic
1194409954 X:93544999-93545021 CAGGGGAGAGAGAGAGAAGGGGG + Intergenic
1195130111 X:101842898-101842920 GTGGGGAAAGGGAGAGAAGGTGG + Intronic
1195224015 X:102773610-102773632 CTGTGGAGATAGAGAGTAGAAGG - Intergenic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195750535 X:108159046-108159068 CTGGGAGGGTGGAGAGAAGAGGG + Intronic
1195756137 X:108200613-108200635 GGGGAGAGATGGAGAGAGGTTGG + Intronic
1195831650 X:109065985-109066007 AGGGGAAGATGGAAAGAAGTTGG - Intergenic
1195910064 X:109880450-109880472 CAGAGGAGATGGGGAGAAGCAGG - Intergenic
1196007792 X:110854015-110854037 CTAGGAAGAAGGAAAGAAGTGGG + Intergenic
1196161776 X:112492901-112492923 GTGGGGTGATGGGGAAAAGTGGG - Intergenic
1196370740 X:114977063-114977085 CTGGAGAGATGTGGAGAAATAGG + Intergenic
1197494303 X:127158647-127158669 CTGGGGAGAGGGAGAAAAGATGG + Intergenic
1197867230 X:131032255-131032277 GAGGGGAAATGGAGAGATGTTGG - Intergenic
1197946663 X:131846429-131846451 GTGGGGAGAGGGAGAGCATTAGG + Intergenic
1198134673 X:133736718-133736740 CAGGGGAGATGGAGAGTAATAGG + Intronic
1198171550 X:134110800-134110822 TTGTGGAGATGAAGAGAGGTTGG - Intergenic
1198249976 X:134870459-134870481 ATGAGGAGAGGGAGAGGAGTTGG + Intergenic
1198281417 X:135146520-135146542 CTGAGGAGAAGGAGAGAGATGGG + Intergenic
1198289542 X:135225996-135226018 CTGAGGAGAAGGAGAGAGATGGG - Intergenic
1198323142 X:135539794-135539816 CTGAGGAGAGGGAGAGAGATAGG + Intronic
1198490593 X:137136394-137136416 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
1198527668 X:137518520-137518542 CTGGGGAGACTGAAAGTAGTAGG + Intergenic
1199103021 X:143827994-143828016 CTGAGGAGATGAAGAGAGATAGG - Intergenic
1199686702 X:150271591-150271613 CAGTGGAGGTGGAGACAAGTGGG + Intergenic
1199769970 X:150969094-150969116 CTGGGGACCTGGAGGGAGGTGGG - Intergenic
1199771887 X:150980411-150980433 CTGGGGGGATGGGGAGGAGCAGG + Intergenic
1200042727 X:153381416-153381438 TTGGGCTGAAGGAGAGAAGTAGG - Intergenic
1200180157 X:154145112-154145134 CTGGGGAGAGGGCCAGGAGTGGG - Intronic
1200185985 X:154183506-154183528 CTGGGGAGAGGGCCAGGAGTGGG - Intergenic
1200191637 X:154220644-154220666 CTGGGGAGAGGGCCAGGAGTGGG - Intronic
1200197392 X:154258448-154258470 CTGGGGAGAGGGCCAGGAGTGGG - Intronic
1200562209 Y:4718883-4718905 CTGGGTAGATGCTGAGTAGTGGG + Intergenic
1200722711 Y:6626230-6626252 TGGGGGAGATGGAAAGAAGGAGG + Intergenic
1200795268 Y:7335256-7335278 CTGGGGAGGTGCAGGGAAGGGGG + Intergenic
1201578718 Y:15488874-15488896 TTGGGGAGTTGGGGAGAGGTGGG - Intergenic