ID: 999054320

View in Genome Browser
Species Human (GRCh38)
Location 5:148557484-148557506
Sequence ATGTGTGTCTGGAGCTCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 493
Summary {0: 1, 1: 0, 2: 8, 3: 41, 4: 443}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999054315_999054320 22 Left 999054315 5:148557439-148557461 CCTATAGGACATTCGAGTGAAGA 0: 1
1: 0
2: 1
3: 6
4: 92
Right 999054320 5:148557484-148557506 ATGTGTGTCTGGAGCTCAGAGGG 0: 1
1: 0
2: 8
3: 41
4: 443

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999054320 Original CRISPR ATGTGTGTCTGGAGCTCAGA GGG Intronic
900827125 1:4935727-4935749 ATCTGGGCATGGAGCTCAGACGG + Intergenic
901219831 1:7577241-7577263 ATGAGTTTCTGGAGCACATAGGG - Intronic
901245833 1:7730319-7730341 CCGTGTGGCTGGAGCACAGAGGG - Intronic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903867951 1:26411978-26412000 ACGTCTGAATGGAGCTCAGAAGG + Intronic
904076443 1:27846307-27846329 CAGTGTTTCTGGAGCACAGAGGG - Intronic
904585669 1:31579268-31579290 GTGAGTGTTTGGAGCTTAGAGGG + Intronic
905087115 1:35390606-35390628 ATGTGTACCTGCAGGTCAGAGGG + Intronic
905212197 1:36382004-36382026 ATGTGTGGCTGGGGCTCTGCTGG - Intronic
905305225 1:37013315-37013337 ATTTGTGTCTGGGGCTGATATGG - Intronic
905527263 1:38648504-38648526 GTGAGTGTCTGGAGTGCAGATGG - Intergenic
905534056 1:38705208-38705230 GTGTGAGACTGGAGCTCAGCGGG + Intergenic
905933460 1:41806149-41806171 GTGTTTGTCTGGAGAGCAGAGGG - Intronic
906108806 1:43309916-43309938 ATGGGGCTATGGAGCTCAGAGGG + Intronic
907470767 1:54672055-54672077 CAGTGTGACTGGAGCCCAGAGGG + Intronic
907712913 1:56900962-56900984 AAGGCTGTCTGGAGCTCAGTGGG + Intronic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
907821201 1:57971299-57971321 ATGAGTGTCTTGAGCTGAAATGG + Intronic
907918145 1:58889369-58889391 TTGTGTGTCTGGGGAACAGAGGG - Intergenic
908751622 1:67429898-67429920 ACTTGTTTCTGGAGCTCCGAGGG - Intronic
909303303 1:74040040-74040062 ATGTGTGTCTGCACGTGAGATGG - Intronic
909345005 1:74574331-74574353 ATGTGTTTCTGGTACTCACATGG + Intronic
909552339 1:76912806-76912828 ATGTGTGTCTGCACATGAGATGG + Intronic
911669071 1:100587724-100587746 AGGTAAGTCTGGAGCTCAGAGGG - Intergenic
912466469 1:109878158-109878180 ATGTCTGTCTTGACCACAGACGG + Intergenic
912948215 1:114102329-114102351 ATGTGTGTGGGTAGCTCTGAGGG + Intronic
913689647 1:121267049-121267071 ATGTGTCACTGGGGCTCACACGG + Intronic
914147951 1:145013223-145013245 ATGTGTCACTGGGGCTCACACGG - Intronic
915055923 1:153130414-153130436 AGCTGTGCCTGGAGCTCAGCTGG - Intergenic
915308130 1:154992887-154992909 ATGTGTATCTGGAGCAGGGAGGG - Exonic
916211946 1:162366865-162366887 AGGTGTGTCTGGAGCTATGTGGG + Intronic
916543637 1:165781895-165781917 ATGTGTCTCTGCAGATGAGATGG + Intronic
917313163 1:173697919-173697941 ATGTGTGTCTGTACTTGAGATGG - Intergenic
918089650 1:181278084-181278106 ATGTGTGTCTGCACGTGAGATGG - Intergenic
918497098 1:185152906-185152928 ATTTGTTTTTGGAGCTCAGGAGG + Intronic
918632909 1:186740139-186740161 ATGTGGGTTTGGAGTTCAGGAGG - Intergenic
918689713 1:187465715-187465737 TTTTGTGTCTGGAGCTGAGGGGG - Intergenic
920563881 1:206958668-206958690 CTGTGTCTCTGCAGCTCAGGAGG - Exonic
922145701 1:222941948-222941970 TTGTGTGTATGTTGCTCAGAGGG + Intronic
922338089 1:224633961-224633983 ATGTTTTTCTGCAGCTCACATGG - Intronic
923026464 1:230208478-230208500 ATATGTGTCTGGTGTTCAGGAGG + Intronic
923431494 1:233925520-233925542 ATGTGTGTCTGCACATGAGATGG + Intronic
923513214 1:234671589-234671611 ATGTTTGCATGGAGCTCAGCTGG - Intergenic
924287383 1:242502127-242502149 ATGTGTGTCTGAAATTCAGGAGG - Intronic
1062912923 10:1225299-1225321 GTGTGTCTCTGCAGCTGAGATGG + Intronic
1062918229 10:1258412-1258434 GTGTGTCTCTGCAGCTGAGATGG - Intronic
1062980245 10:1716205-1716227 GTGTGTTTTTGGAGCTCAGCAGG - Intronic
1063042321 10:2356185-2356207 GTGTGTTTCTAGAGCTAAGAGGG + Intergenic
1063207970 10:3853132-3853154 CTGGGTGGCGGGAGCTCAGAGGG + Intergenic
1064955803 10:20908135-20908157 ATGGGTGTCTGAAGATCACATGG - Intronic
1065853985 10:29814893-29814915 TGGTGTGGCTGGAGCTCAGATGG + Intergenic
1066595180 10:37042640-37042662 ATGTGTGTCTGCACGTGAGATGG + Intergenic
1066822713 10:39514199-39514221 ATGTGTGCATTGAACTCAGAGGG + Intergenic
1067120909 10:43471409-43471431 CTGTGTGTTTGCAGCTCAGTTGG + Intronic
1067123096 10:43491505-43491527 GAGTGGTTCTGGAGCTCAGAAGG - Intergenic
1067205450 10:44208406-44208428 ATATGGGTCAGGAGCTCAGGAGG - Intergenic
1067775532 10:49162518-49162540 ATGTGTGCCAGGAATTCAGATGG + Intronic
1069655010 10:70081321-70081343 AGGTGTGTCGGGAGCTCAGGAGG + Intronic
1069859594 10:71462098-71462120 CTGTGTCTCTGAAGCTCAGCTGG + Intronic
1071461724 10:85903120-85903142 CTATGAGTCTGGAGTTCAGAGGG - Intronic
1071769990 10:88717668-88717690 ATTTTTGTCTGTAGATCAGATGG - Intergenic
1071954526 10:90743425-90743447 ATGTGTCTGTGGAGCACAGATGG - Intronic
1072005724 10:91244940-91244962 ATATGTGTCTAGAACTCAAAGGG + Intronic
1074061444 10:109969741-109969763 ATGTGTCTCTGCAGCCCAGCTGG - Intergenic
1074286891 10:112106039-112106061 ATGTGTGTCTGCACGTGAGACGG - Intergenic
1075593001 10:123706113-123706135 ATGTGTGACTGGATCTCATCTGG - Intergenic
1075682990 10:124345657-124345679 ATGTGTGCCTGGAACTCAGTAGG + Intergenic
1076234974 10:128856388-128856410 GTGTTTTTCTGGAGCTCAAAGGG + Intergenic
1077609469 11:3635609-3635631 AGGTCTGTCTGGAGCTTAGTGGG - Intergenic
1078368066 11:10722737-10722759 ATGGGTGAGTGGAGCTCAGAGGG - Intergenic
1078819593 11:14864059-14864081 ATGTGTGTCTGCACGTGAGATGG - Intronic
1081659584 11:44879804-44879826 ATAAGTGTCTGGAGGCCAGATGG + Intronic
1081700204 11:45147713-45147735 GTGTGTGTCTAGAGCCCAGTTGG + Intronic
1082063427 11:47879772-47879794 ATGTGTGTCTGGAGGTGGGGAGG - Intergenic
1082210785 11:49498653-49498675 ATGTGTGGCTGGAGGTGAGCTGG - Intergenic
1084036020 11:66510853-66510875 ATGTGTGTCTGGAGGTCGCTCGG + Intronic
1086386304 11:86312446-86312468 ATGTGTGTCTGCACGTGAGATGG + Intronic
1086638854 11:89126136-89126158 ATGTGTGGCTGGAGGTGAGCTGG + Intergenic
1086661826 11:89428470-89428492 ATGTGTGTCTGCATGTGAGATGG - Intronic
1086806319 11:91247257-91247279 ATGTGTGTGTGGAGGGGAGAAGG + Intergenic
1087794478 11:102440800-102440822 ATGTGTGTCTGCACATGAGATGG - Intronic
1088572318 11:111234370-111234392 ATGTATATCTGAAGCTGAGAAGG + Intergenic
1088645423 11:111913096-111913118 AAGTGTGTCTTGAGGTCAGCAGG - Intronic
1088813235 11:113405406-113405428 CCTGGTGTCTGGAGCTCAGAGGG + Intergenic
1088826272 11:113496863-113496885 ATGTGCCTCTGGGGCCCAGAGGG + Intergenic
1089382771 11:118047959-118047981 AGGTGTCTCTGGGGCTCAGATGG + Intergenic
1089563721 11:119359264-119359286 ATCTGGGTCTTGAACTCAGATGG + Exonic
1090481919 11:127076566-127076588 ATAAGAGTCTGGAACTCAGAAGG + Intergenic
1090668813 11:128931874-128931896 ATGTGTGTCTGGAGAACACAGGG - Intergenic
1090936163 11:131344452-131344474 ATCTGAGTCTGGGGCTCAGGGGG + Intergenic
1090966588 11:131602967-131602989 ATTTGTGTCTTGAACTAAGATGG - Intronic
1092711067 12:11338286-11338308 ATGTGTGTCTGCACATGAGATGG + Intergenic
1093571430 12:20669953-20669975 ATGTGTGTCTGCACGTGAGATGG - Intronic
1093699420 12:22202007-22202029 ATGTCTTTCTGGACCACAGAAGG + Exonic
1094865733 12:34528301-34528323 ATGCATGTCTGAAGCACAGAAGG - Intergenic
1094879699 12:34706795-34706817 ATGTGTGTCTTCAACTCACAGGG + Intergenic
1094893956 12:35002451-35002473 ATGTGTGTGTTCAGCTCACAGGG + Intergenic
1094915228 12:35346887-35346909 ATGTGTGTGTTCAGCTCACAGGG + Intergenic
1094919951 12:35422973-35422995 ATGTGTGTGTTCAGCTCACAGGG + Intergenic
1094923957 12:35488195-35488217 ATGTGTGTGTTCAGCTCACAGGG + Intergenic
1094959243 12:36059674-36059696 ATGTGTGTGTTCAGCTCACAGGG + Intergenic
1094965786 12:36165663-36165685 ATGTGTGTGTTCAGCTCACAGGG + Intergenic
1094966086 12:36170422-36170444 ATGTGTGTGTTCAGCTCACAGGG + Intergenic
1094966979 12:36184685-36184707 ATGTGTGTGTTCAGCTCACAGGG + Intergenic
1094980588 12:36404133-36404155 ATGTGTGTGTTCAGCTCACAGGG + Intergenic
1094990764 12:36569262-36569284 ATGTGTGTGTTCAGCTCACAGGG + Intergenic
1095005972 12:36815256-36815278 ATGTGTGTGTTCAGCTCACAGGG + Intergenic
1095016821 12:36990986-36991008 ATGTGTGTGTTCAGCTCACAGGG + Intergenic
1095075934 12:37925095-37925117 ATGTGTGCCTTCATCTCAGAGGG - Intergenic
1095082102 12:38014571-38014593 ATGTGTGGCTTCAGCTCACAGGG + Intergenic
1095635749 12:44431390-44431412 ATATGTTTCTGGAGCTCTGGGGG + Intergenic
1096236782 12:49933884-49933906 TGGTGTGTCTGGAGATCACACGG + Intergenic
1097376376 12:58848197-58848219 ATGTGTGTGTGGAGAATAGAGGG - Intergenic
1097625239 12:61992157-61992179 TTATGTGTCTGGATTTCAGAAGG - Intronic
1097839085 12:64303430-64303452 ATGTGTGTGTGGAGGGGAGATGG - Intronic
1098188735 12:67925619-67925641 ATGTAAGGTTGGAGCTCAGAAGG - Intergenic
1099397114 12:82154191-82154213 ATGAGTGGCAGGAGTTCAGAGGG - Intergenic
1100594736 12:96062106-96062128 ATGTGTATCTGGACTTCAGGAGG - Intergenic
1101397064 12:104357574-104357596 AGGTGGGTCTGGGGCTCAGGAGG + Intergenic
1102583875 12:113909735-113909757 AAGTGGGTCTGGAGGTGAGAAGG - Intronic
1103433256 12:120905256-120905278 AAGTGAATCTGGAGCTTAGATGG + Intergenic
1103542135 12:121673321-121673343 GTGTGTGGCTGGAGCAGAGACGG - Intergenic
1104104141 12:125643075-125643097 ACGTGTGTCTGGGGCTCAGAAGG + Intronic
1104159159 12:126161938-126161960 ATATGTGAGTGGAGCCCAGAGGG - Intergenic
1104275889 12:127327495-127327517 ACATGCATCTGGAGCTCAGAAGG - Intergenic
1104663314 12:130628054-130628076 CTGGGTGTCTGGAGCACAGATGG - Intronic
1104859445 12:131916864-131916886 ATGTGTGTCTGGCCTGCAGAGGG + Intronic
1105201584 13:18184431-18184453 ATGTGTCTCTGCATGTCAGATGG - Intergenic
1105547503 13:21361627-21361649 GTGTGTGACTTGAGCTGAGAAGG + Intergenic
1107189144 13:37558973-37558995 CTGTCTGTCTGCCGCTCAGAAGG + Intergenic
1108204024 13:48070638-48070660 ATCTCTGGCTGCAGCTCAGAAGG + Intronic
1108261000 13:48656449-48656471 ATGAGAGTTTGAAGCTCAGACGG + Intronic
1108518694 13:51225249-51225271 ATATCTGTCTGGAACTCAGAAGG + Intronic
1108837585 13:54571194-54571216 ATTTGGGTCTTGAGCTCAGAGGG + Intergenic
1108934298 13:55866919-55866941 AGGTGATTCTGGAGGTCAGAGGG - Intergenic
1109346139 13:61116876-61116898 ATCTCTGACTGCAGCTCAGAAGG + Intergenic
1110413041 13:75224116-75224138 ATGGGAATCTGGAGCACAGATGG - Intergenic
1111273326 13:85915676-85915698 ATGTGTGTCTGCATGTGAGATGG + Intergenic
1111786409 13:92792641-92792663 ATGTGTGTCTGCACATGAGATGG - Intronic
1112231828 13:97595461-97595483 ATGTGTGTCTGCACATGAGATGG - Intergenic
1112419920 13:99239341-99239363 ATGTGTGTCCGGGGTTGAGAAGG - Intronic
1113119246 13:106908707-106908729 ACTTCTGTCTGCAGCTCAGAAGG - Intergenic
1113333192 13:109352033-109352055 GTGTGTGTGTGGAGGTGAGAGGG + Intergenic
1114215595 14:20655546-20655568 AAGTGGGTCTGGATCTCTGAGGG + Intergenic
1116052649 14:39823915-39823937 ATGTGTGTCTGCACATGAGATGG + Intergenic
1116384252 14:44311154-44311176 ATGTGTGTCTGCATGTGAGATGG - Intergenic
1117099362 14:52331007-52331029 ATGTGTGTAAAGAGGTCAGAGGG - Intergenic
1118104165 14:62638796-62638818 ATGTGTCTCTGCAGGTGAGATGG - Intergenic
1118521108 14:66586275-66586297 ATGTGTGTCTGCATGTGAGATGG + Intronic
1120112752 14:80577325-80577347 ATTTGAGTCTGGAGCTCAGAAGG - Intronic
1121552246 14:94811699-94811721 ATGTGTGGCTGGATCTCAGGGGG + Intergenic
1121729038 14:96173689-96173711 CTGTGTAGCTGCAGCTCAGAGGG + Intergenic
1121832552 14:97064630-97064652 AGGAGTCGCTGGAGCTCAGAGGG - Intergenic
1122267653 14:100554172-100554194 ATGGGAGCCCGGAGCTCAGAGGG + Intronic
1122781946 14:104147445-104147467 CTGTGGGTCTGCAGCTCTGAAGG - Intronic
1202889625 14_KI270722v1_random:143791-143813 ATGTGTGTCAGGTGGGCAGAGGG - Intergenic
1202889638 14_KI270722v1_random:143911-143933 ATTTGTGTCAGGAGGGCAGAGGG - Intergenic
1124530434 15:30500750-30500772 ATTTGTGTCTGGAGGGCAGGGGG - Intergenic
1124768225 15:32506938-32506960 ATTTGTGTCTGGAGGGCAGGGGG + Intergenic
1124962254 15:34407683-34407705 ACGTGTCTCTGGAGCTGAGCAGG + Intronic
1124978877 15:34553904-34553926 ACGTGTCTCTGGAGCTGAGCAGG + Intronic
1125062403 15:35440097-35440119 ATCTCTGGCTGCAGCTCAGAAGG + Intronic
1126071468 15:44868383-44868405 ATGTGTGTCTGCATGTGAGATGG - Intergenic
1126260150 15:46680186-46680208 ATGTGTATGTGCAGCTCACAGGG - Intergenic
1126720305 15:51571039-51571061 ATGTGTGTCTGCATGTGAGATGG - Intronic
1126796612 15:52264948-52264970 AAGTGTTTCTGGAGCCTAGAAGG - Intronic
1127291761 15:57577787-57577809 ATGTGTTTGTGGACCTAAGAGGG - Intergenic
1127971867 15:63968223-63968245 ATGAGTAGCTGGAACTCAGAAGG - Intronic
1129060106 15:72853937-72853959 ACGTGGATCTGGAGCTCAGGGGG - Intergenic
1130384435 15:83398918-83398940 ATGTGTTCCTGCAGGTCAGATGG + Intergenic
1131161106 15:90105391-90105413 ATGTGTGTCTGGCTCCCAGAGGG - Intergenic
1131635171 15:94225330-94225352 AAGTGTGACTGGAAGTCAGAAGG - Intergenic
1132984410 16:2756793-2756815 CTGTGTGTCTGGGGCATAGATGG + Intronic
1133050545 16:3115106-3115128 GTGTGAGGCTGGAGCTGAGAAGG + Intronic
1133479517 16:6156451-6156473 ATGTATGTGAAGAGCTCAGATGG + Intronic
1134649875 16:15899893-15899915 ATGTGTGCCAGGAGCACAGCAGG + Intergenic
1134665229 16:16013881-16013903 GTGTGTGGCTGGAGCAGAGATGG + Intronic
1136092030 16:27927522-27927544 TTGTGTGGCTGGAGCACAGTGGG - Intronic
1137537964 16:49341883-49341905 CTGTGTGGCTGGAGTTCAGTGGG + Intergenic
1137674034 16:50295000-50295022 CTGGGGCTCTGGAGCTCAGATGG + Intronic
1137822043 16:51455369-51455391 AGGTGTTTCTGACGCTCAGATGG - Intergenic
1138110461 16:54319778-54319800 TTGTGTGTCAGGAACTAAGAAGG + Intergenic
1138318317 16:56089374-56089396 AGGTGGGAATGGAGCTCAGAGGG + Intergenic
1139381884 16:66537654-66537676 TTGTGTGTCTAGACCACAGATGG - Intronic
1139528957 16:67532645-67532667 ATGGGTGTCTGAAGCCCAAAAGG + Intronic
1140198285 16:72874164-72874186 TCTTGTGCCTGGAGCTCAGATGG + Intronic
1140664241 16:77213346-77213368 ATTTGTGAGGGGAGCTCAGATGG - Intergenic
1140901579 16:79372810-79372832 CAGTGGGTCTGGAGCTGAGAGGG - Intergenic
1141055514 16:80810212-80810234 ATGTGAGTCAGGAACTCAGCCGG + Intergenic
1142702066 17:1668835-1668857 AGGTGTGTTGGGAGCTCAGCTGG - Intronic
1144039083 17:11392529-11392551 AGGTGTGTATGGAGATCACATGG - Intronic
1144699124 17:17325311-17325333 CTGAGTGTCTGGAGCTCAGAGGG - Intronic
1146297657 17:31662205-31662227 CTGAGTGTCTGGAGCTCAGATGG + Intergenic
1147243518 17:39106015-39106037 AGATGGGTCTGGAGCTCACAGGG - Intronic
1147961851 17:44172355-44172377 GTGTGTGTCTCCAGCTCACAAGG + Intronic
1148204525 17:45771557-45771579 ATGAGTGTCCTGAGCTCTGATGG - Intergenic
1148511628 17:48175856-48175878 CTGTGTGGCTGGGGCTCAGTGGG + Intronic
1150094327 17:62359203-62359225 ATGTGTCTCTGCACCTGAGATGG - Intergenic
1150449077 17:65250773-65250795 ATGTAAGTCCAGAGCTCAGAGGG + Intergenic
1152261248 17:79268512-79268534 AACTGTGGCTGGAGCTCAGAGGG - Intronic
1152271596 17:79328177-79328199 CTGTGTGTCTGGAACGGAGATGG + Intronic
1152506231 17:80750541-80750563 ATGTGTGCCTGGTGCTGGGAGGG - Intronic
1153694891 18:7630134-7630156 ATGTGGGGTTAGAGCTCAGAAGG + Intronic
1153781158 18:8496061-8496083 ATGTGTGTCAGGACCACTGAAGG - Intergenic
1155408136 18:25512754-25512776 ATGTGTGTGTGAAACTCAGGTGG + Intergenic
1156709566 18:39926504-39926526 ATGTGTGTCTGCACATGAGATGG - Intergenic
1157529852 18:48410694-48410716 ATGTCTGTCTGGAGCGCAGAGGG - Intronic
1158423594 18:57319071-57319093 ATGTAGGTCTGGAGGCCAGAAGG - Intergenic
1158638311 18:59180439-59180461 CTGTTAGTCTGGAGCTGAGAGGG + Intergenic
1159431774 18:68362027-68362049 ATTTCTGGCTGCAGCTCAGAAGG + Intergenic
1159453051 18:68626766-68626788 TTGTGTGTCTGCAGTTCAAAGGG + Intergenic
1159627311 18:70709577-70709599 ATGTGTGTTCAGAGCTAAGATGG - Intergenic
1159904365 18:74076827-74076849 CAGTGTGGCTGGAGCACAGATGG - Intronic
1159997551 18:74980887-74980909 CAGTGTGTCTGGGGCTGAGAAGG - Intronic
1160129249 18:76209730-76209752 ATGTCTGTCTCTAGCTCACAAGG + Intergenic
1160584183 18:79903663-79903685 ATGTGTACCTTGGGCTCAGACGG + Exonic
1160810118 19:1009616-1009638 GTGTGTGTCTTGAGCCCAAACGG - Exonic
1160910498 19:1471709-1471731 TTGGGTGGATGGAGCTCAGAAGG + Exonic
1161912521 19:7205182-7205204 GCTTGTATCTGGAGCTCAGATGG - Intronic
1161918807 19:7250851-7250873 CTCTGAGTCTGGAGCTCAGAGGG + Intronic
1163497754 19:17656446-17656468 CTGTGTGACTGGGGCTCAGGTGG - Intronic
1164366461 19:27588282-27588304 ATGTGTGTATTCATCTCAGAGGG + Intergenic
1164811534 19:31161089-31161111 ATGTGTGTGTGTATCTCACATGG + Intergenic
1165250033 19:34523676-34523698 ATGTGGGTCTGGTGCACAGGTGG + Intergenic
1165830957 19:38729919-38729941 AAGTGAGTCTGGAGCAGAGAGGG - Exonic
1167565053 19:50250785-50250807 CTGTTTGTCTGGACCTCAGGAGG - Intronic
1168151964 19:54454095-54454117 ATGGGTGTCTTGTGCTCAGATGG + Intronic
1168516296 19:57012940-57012962 ATCTGTTTCTGGAGCTCATGAGG + Intergenic
1202665026 1_KI270708v1_random:110558-110580 ATGTGTGTCAGGTGGGCAGAGGG - Intergenic
1202665039 1_KI270708v1_random:110678-110700 ATTTGTGTCAGGAGGGCAGAGGG - Intergenic
925487168 2:4348343-4348365 AAGTACTTCTGGAGCTCAGAAGG + Intergenic
926180057 2:10634532-10634554 ATGTACCTCTGTAGCTCAGAGGG + Intronic
926259123 2:11240592-11240614 ATGGTTGCCTGGGGCTCAGAGGG + Intronic
926572295 2:14543101-14543123 AAGTGTGTCTGGAACTCATGGGG + Intergenic
926901850 2:17760286-17760308 ATGTGAGTCTGGAGCTCAAAGGG - Intronic
927255827 2:21040084-21040106 ATGGGTGTCGGGAGATCTGATGG + Intronic
927455461 2:23245326-23245348 AAGTGTGTCTAAAGCTGAGAGGG - Intergenic
927674273 2:25093046-25093068 AAGTTTTTCTGGAGCTGAGAGGG - Exonic
928407027 2:31022577-31022599 ATGTGTATGTGGAGCTAAGGGGG + Intronic
928821841 2:35371039-35371061 ATGTGTGTCTGGAGGAGGGATGG + Intergenic
929233993 2:39587749-39587771 ATGAAAGTCTGGGGCTCAGAGGG - Intergenic
929795585 2:45056043-45056065 AGGTGGGTCAGGAGCTCCGAAGG + Intergenic
931043836 2:58327578-58327600 ATGTGTGTCTGCACGTGAGATGG - Intergenic
931193011 2:60023800-60023822 ATGTGTTTCTGGATCTGAGCTGG + Intergenic
932487578 2:72093896-72093918 ATTTGGATCTGGAGCTCAGGAGG - Intergenic
933074066 2:77900542-77900564 ATGTGTGTGTGCAGGTCACAGGG + Intergenic
933264398 2:80166704-80166726 ATCTGTGTCTGAAGCTGGGAGGG + Intronic
933540465 2:83634737-83634759 ATGAGTGTTGGTAGCTCAGAAGG - Intergenic
934942227 2:98510996-98511018 ATTTGTGTCTGCAGGTGAGAAGG + Intronic
936012096 2:108931307-108931329 TTGTGTTTCTCGTGCTCAGAGGG + Intronic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
937403460 2:121606050-121606072 ATGTGTGTCTGAAGAGCAGCTGG + Exonic
937980868 2:127614608-127614630 ATGGGCTTCTGGAGCTCAGCAGG + Intronic
938567376 2:132531107-132531129 ATGTGTCTCTGCAGGTGAGATGG - Intronic
939033498 2:137103637-137103659 ATGTGTGTCTGTATGTGAGATGG - Intronic
939308743 2:140444442-140444464 ATGTGTGTCTAGAACATAGAAGG + Exonic
939327434 2:140712004-140712026 ATGTTTATATGGAGCACAGACGG - Intronic
941052118 2:160746840-160746862 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
941191793 2:162393312-162393334 ATGTGGGACTGAAGCTCAGGTGG + Intronic
941809987 2:169745910-169745932 ATGTGGGTTTGCAGCTGAGAAGG + Intronic
942655845 2:178213293-178213315 ATGTGCCTCTGGAATTCAGAAGG - Intronic
942865620 2:180670864-180670886 ATGGGACTCTGGAGCTGAGAGGG - Intergenic
945481340 2:210349436-210349458 ATGTGTGTCTGCACGTGAGATGG + Intergenic
946297355 2:218795621-218795643 ATCTTTGGCTGCAGCTCAGATGG - Intronic
946305367 2:218854000-218854022 AAATGGGTCTGGAGCTCAGAGGG - Intergenic
947033731 2:225826827-225826849 ATGTGTGTCTGCACGTGAGATGG - Intergenic
947232279 2:227900668-227900690 ATGTGTGCCTGAAACTCAGGTGG + Intronic
948265647 2:236633457-236633479 GTGTGTGTCTGGAGCTGGGATGG + Intergenic
1170537885 20:17359472-17359494 GTGTGGGAATGGAGCTCAGATGG - Intronic
1170763133 20:19269328-19269350 GAGTGTTTCAGGAGCTCAGAAGG + Intronic
1171217936 20:23365722-23365744 ATGTGCGTCTTGAGCGCGGACGG - Exonic
1171233571 20:23507189-23507211 ATATGATTCTGGAGTTCAGAAGG - Intergenic
1171744786 20:28959267-28959289 ATGTGTGTATTCATCTCAGAGGG + Intergenic
1172093739 20:32450753-32450775 ATGGGGGTCTGGGGCTCAGCAGG - Intronic
1172217106 20:33243449-33243471 AAGTGTGTGTGGATTTCAGAAGG + Intergenic
1172876015 20:38164863-38164885 ATGTGTGCCTGGAGCTGTGCAGG - Intronic
1173555066 20:43960243-43960265 ATGTGTGCCTGGATCTGAGGAGG - Intronic
1174691983 20:52515717-52515739 ATGTGAGTCTGGTTCTCTGAGGG + Intergenic
1175185782 20:57178918-57178940 ATGTCTGTCATGAGCACAGAAGG + Intronic
1175699008 20:61123850-61123872 ATGGGTGGCTGGAGCCTAGAAGG - Intergenic
1175905474 20:62377546-62377568 ATGCAGGCCTGGAGCTCAGATGG + Intergenic
1176716369 21:10353566-10353588 ATGTGTCTCTGCATGTCAGATGG + Intergenic
1176946603 21:14989782-14989804 ATGTGTGTGTGGAGGTGAGGAGG + Intronic
1176960776 21:15156452-15156474 CAGTGTGTCTGGGGCTCACAAGG - Intergenic
1177071052 21:16508710-16508732 ATGTGTTTCTTAAGCTCAAAGGG + Intergenic
1177764411 21:25440345-25440367 ATTCATGTCTGGAGCTCAGTAGG + Intergenic
1179934787 21:44595570-44595592 CTGGGTGTCCGGAGCTCAGAAGG - Intronic
1180331752 22:11487478-11487500 ATGTGTGTCAGGTGGGCAGAGGG - Intergenic
1180331765 22:11487598-11487620 ATTTGTGTCAGGAGGGCAGAGGG - Intergenic
1180502106 22:15939344-15939366 ATGTGTCTCTGCAGGTGAGATGG - Intergenic
1180601970 22:17026379-17026401 ATGTGTCTCTGCATGTCAGATGG - Intergenic
1180741234 22:18054464-18054486 ATATGAGTCTGAAGCTCAGCTGG - Intergenic
1183430425 22:37762522-37762544 ACCTGTGTCTGGAGTTCAGGCGG + Intronic
1184194654 22:42918888-42918910 ATGTGTTTCTTCAGCTGAGAGGG - Intronic
1185209540 22:49562327-49562349 ATGTGTGTCTGGACCAATGAGGG + Intronic
949335845 3:2974509-2974531 ATGGCAGTCTGGAGCCCAGAGGG + Intronic
950261755 3:11547100-11547122 AAGAGTGTCTGGGGCCCAGAGGG + Intronic
951336845 3:21433876-21433898 GTGTGTGTCTGGAGCTCATGTGG - Intronic
952966730 3:38625683-38625705 ATGTGTGTCTGGCCCTGAGTGGG + Intronic
953324535 3:42001798-42001820 ACATGAGTCTGGAGTTCAGAGGG + Intergenic
953882556 3:46698602-46698624 ATGAGGGACTGAAGCTCAGAGGG + Intergenic
954154084 3:48675141-48675163 ATTCTTGTCTGGAGCTCACAGGG - Intronic
954978805 3:54724023-54724045 ATGTGTGTCTGCACGTGAGATGG - Intronic
955211698 3:56947381-56947403 ATGTGTCTCTGCAGGTGAGATGG - Intronic
955555292 3:60130490-60130512 ATGTAAGACTGGAACTCAGACGG + Intronic
955798466 3:62662060-62662082 CTATGTGTCTGGAACTCAGAAGG + Intronic
955916043 3:63909391-63909413 ATGTGTGTGTGGAGATGACAAGG - Intronic
957146302 3:76428844-76428866 ATGACTGTCGGCAGCTCAGAAGG - Intronic
958581495 3:96031390-96031412 AAGTTTGTCAGCAGCTCAGAAGG - Intergenic
958624312 3:96605227-96605249 ATGTGTCTCTGCAGGTGAGATGG + Intergenic
959403875 3:105936842-105936864 ATGAGTGACTGGAGCACAGAGGG - Intergenic
959648718 3:108731009-108731031 ATGTGTGTCAGGACCTTAGCAGG + Intergenic
960454982 3:117860066-117860088 ATATGGGTCTGGAGCACAGCGGG - Intergenic
960477522 3:118146861-118146883 ATGTATATGTGGAGCTCACAGGG + Intergenic
962630550 3:137271249-137271271 ATGTGTGTCTGGAGCTTTTGAGG - Intergenic
962836545 3:139194533-139194555 ATGTGTGTCTGCACGTGAGATGG + Intronic
963209228 3:142670315-142670337 TTGTGTGACTGGAGCTGAGATGG + Intronic
963844217 3:150139179-150139201 ATATGGATCTGGAGCTCAGAAGG + Intergenic
965119959 3:164541591-164541613 ATTTATGTCTGGAGATTAGAAGG + Intergenic
966546552 3:181155890-181155912 ATGTGTGTCTGCATCTGAGCAGG + Intergenic
967371158 3:188747892-188747914 ATGTTACACTGGAGCTCAGAGGG - Intronic
968317020 3:197733634-197733656 TTGTGTATCTGGAGCTAAGGAGG + Intronic
968697888 4:2041715-2041737 ATCTGTGGCTGGAGCTCAGCAGG - Intronic
968984584 4:3868219-3868241 CTGCGTGTGTGGAGCTCACAGGG + Intergenic
969869445 4:10095606-10095628 AAGTGTATCTGCAACTCAGAAGG + Intronic
970867284 4:20773514-20773536 AGGGCTCTCTGGAGCTCAGACGG + Intronic
970966122 4:21930076-21930098 GTGTGTGTCTTGATCCCAGAAGG - Intronic
971090582 4:23339731-23339753 ATGTTTGTCTCAAGCTCACATGG + Intergenic
972740982 4:41885842-41885864 AGGTGAGTTTGGAGCTAAGAAGG + Intergenic
973547148 4:51993320-51993342 ATGTGAGTCTGGAGCTTAGATGG + Intergenic
974201039 4:58640893-58640915 ATATATGTCTGGATTTCAGAAGG - Intergenic
974403413 4:61433723-61433745 ATATGAGTCTGGAGCTCAGAAGG - Intronic
975232375 4:71949808-71949830 ATGTGTCTCTGCAGGTGAGATGG - Intergenic
976901537 4:90183262-90183284 GTGTGTGTTTGGAGGTCATAGGG - Intronic
977046392 4:92072980-92073002 ATGCGAGTCTGGAACCCAGAAGG - Intergenic
977467515 4:97401234-97401256 ATGTGTCTCTGCACCTGAGATGG + Intronic
977624403 4:99174609-99174631 GTGTGTCTCTGCAGATCAGATGG + Intergenic
977663254 4:99615581-99615603 ATGTGTCTCTGAAGCTAGGATGG - Intronic
979711632 4:123786867-123786889 ATGTGTGTCTGGGAATCTGATGG + Intergenic
979775661 4:124585330-124585352 ATGTGTGTCTGCACATGAGATGG - Intergenic
980216256 4:129856021-129856043 ATGTGTCTCTGCAGGTGAGATGG - Intergenic
980532859 4:134076724-134076746 ATGTGGGTCTGGAGCTTTGAGGG + Intergenic
980703156 4:136457918-136457940 GTGTTTGTGTGGACCTCAGATGG - Intergenic
980861221 4:138501645-138501667 GTGTGTGTCTGGGGGTCAGGTGG - Intergenic
981254988 4:142650470-142650492 ATGTGTCTCTGTACCTGAGATGG - Intronic
982897204 4:160947244-160947266 ATTTTTGTCTTGAGCTTAGAGGG + Intergenic
983976220 4:173937233-173937255 TTGTGTGTCAGGAGGTAAGAAGG - Intergenic
984949298 4:184994816-184994838 GAGTGTGTCTGGAGGTCAGGAGG + Intergenic
985733935 5:1566383-1566405 GTGTGTGTCTGGAGGCCAGGTGG - Intergenic
986273872 5:6256917-6256939 ATGTGTACCTGGAGCTAGGAAGG + Intergenic
987056396 5:14197232-14197254 ATCAGTATCTGGTGCTCAGAGGG - Intronic
987266187 5:16257340-16257362 ATATGTATCTGGAACTCAGGAGG + Intergenic
988191673 5:27945018-27945040 ATGTGTGGATGGAGCTCATCAGG + Intergenic
988312075 5:29572406-29572428 ATGTGTGACTGGTGTTTAGAAGG + Intergenic
990118504 5:52419551-52419573 CTATGTGCCTGGAGCTCAGGAGG - Intergenic
990149261 5:52798726-52798748 ATTTGTGTCAGGAGGGCAGAGGG + Intronic
990788594 5:59451424-59451446 GTATGTGTCTGGAGCTCAGGAGG - Intronic
991089073 5:62676688-62676710 ATGTGTGTCTGCACATGAGATGG + Intergenic
992573408 5:78084069-78084091 ATGTGTGTATGAACCTAAGATGG - Intronic
992788152 5:80189401-80189423 ATTTGTGTCTTTGGCTCAGAGGG - Intronic
992964424 5:81985442-81985464 AGGTGTGCCTTGAACTCAGAAGG - Intronic
993244496 5:85433697-85433719 ATGTGTGTCTGCACATGAGATGG - Intergenic
993663783 5:90670306-90670328 AGGTGTTTCTGAAGGTCAGAGGG + Intronic
994193735 5:96898810-96898832 AAGTGTGTCTGGACCACTGACGG - Intronic
996315734 5:122158730-122158752 CTATGAGTCTGGAACTCAGAAGG + Intronic
997089212 5:130837150-130837172 TTGTCTGTATGGAGCTTAGAAGG + Intergenic
997304779 5:132829397-132829419 ATGTGGCTCTGGAGTTCAGCAGG + Intronic
997519891 5:134516201-134516223 ATTTCTGCCTGGAGCCCAGAAGG + Intergenic
997771666 5:136560655-136560677 ATGTCATTCTGGAGCTCAGCTGG + Intergenic
998444819 5:142190515-142190537 ATGGTAGTTTGGAGCTCAGAGGG + Intergenic
998694014 5:144616842-144616864 ATGTGTGTGTGCAGGTCACAGGG + Intergenic
998770116 5:145533601-145533623 ATGTGTGACTGGAGCTTACAGGG + Intronic
999054320 5:148557484-148557506 ATGTGTGTCTGGAGCTCAGAGGG + Intronic
1000369890 5:160524978-160525000 ATGTCTGTCATGGGCTCAGAAGG - Intergenic
1002193718 5:177491525-177491547 CTGAGTGTCTGGGGCTCAGCTGG + Intronic
1002426010 5:179176371-179176393 ATGTGGGTCTGGAGCCCTGCGGG - Intronic
1002569275 5:180130809-180130831 ATATGACTCTGGAGATCAGAGGG - Intronic
1002968658 6:1992200-1992222 GTGTGAGTCTGGAGCTCAGCGGG - Intronic
1002970019 6:2006048-2006070 ATGCTTGTCTGGAACTCAGAAGG - Intronic
1003404175 6:5815056-5815078 ATGTGTGACTTGAGCTGAGAAGG - Intergenic
1003436318 6:6091731-6091753 GTGTGAGTGAGGAGCTCAGATGG + Intergenic
1003491684 6:6627802-6627824 ATGTGTAACTGAAGCACAGAGGG + Intronic
1004268301 6:14169421-14169443 ATGTGTGTGTTCAGGTCAGAGGG - Intergenic
1005198809 6:23319558-23319580 CTGTGTGTCTGGAGCTGAAGGGG + Intergenic
1005601158 6:27427635-27427657 ATGTGGGTCTTGAGCTCAGGAGG - Intergenic
1005601752 6:27433078-27433100 ATGTCTGTCTGGTGCTCAGTTGG - Intergenic
1006486805 6:34349533-34349555 ATGTGGGACTGGAGTTAAGAGGG + Intronic
1008429504 6:51398890-51398912 AAGTGTGTGTGGACCTCAGTGGG - Intergenic
1008508716 6:52256215-52256237 ATGTGGGGCTGGAGAGCAGATGG - Intergenic
1009254742 6:61372396-61372418 ATGTGTGTATTGAACTCACAGGG + Intergenic
1010461216 6:76116646-76116668 ATGTGTGTCTGCACATGAGATGG + Intergenic
1010541557 6:77098545-77098567 ATCTCTGACTGCAGCTCAGAAGG + Intergenic
1010997150 6:82546890-82546912 ATGTGTCTCTGCATCTGAGATGG + Intergenic
1011640404 6:89412088-89412110 AGGTTTGTCTAGAGCTCAGCGGG + Exonic
1011736339 6:90314112-90314134 ATATGGGTCTGAAACTCAGAAGG + Intergenic
1012415091 6:99004539-99004561 ATATGGATCTGGAGCTCAGTGGG - Intergenic
1012844559 6:104373365-104373387 AGGTGAATCTGGAGCTCAGAAGG + Intergenic
1013874167 6:114803796-114803818 GTGTGTGTCTGCAGGTGAGATGG + Intergenic
1014401895 6:121000143-121000165 CTTTGTGTCTGGAGCTCTCAGGG - Intergenic
1014572537 6:123027694-123027716 ATGTGTACCTGGAGCTCATCAGG + Intronic
1014881428 6:126728495-126728517 ATGGGTCTCTGCAGGTCAGATGG - Intergenic
1015223855 6:130834126-130834148 ATATGTGTCAGGATCTCAGAAGG + Intronic
1015243241 6:131049796-131049818 ATTTGTGTCTTGAGCCCTGAAGG - Intronic
1015282970 6:131453754-131453776 ATGTATATTTGGAGTTCAGATGG + Intergenic
1016912659 6:149214570-149214592 CAGTGTGACTGGAGCACAGAGGG - Intergenic
1017518100 6:155176102-155176124 AGGTGTGTCTGGAATTCAGTGGG + Intronic
1018398088 6:163396339-163396361 ATGTGAGTCTGGATCCCAGAAGG - Intergenic
1018507621 6:164488841-164488863 ATGTGTGTCTGCACATGAGATGG + Intergenic
1018568697 6:165184585-165184607 ATGTGGTTTTGGAACTCAGAAGG - Intergenic
1018737225 6:166696400-166696422 ATATTAGTCTGAAGCTCAGAAGG - Intronic
1018976154 6:168568661-168568683 ATGGGTAGGTGGAGCTCAGAGGG - Intronic
1019452339 7:1106294-1106316 GTGTGTGTCTGGGCATCAGAGGG + Intronic
1020640629 7:10749324-10749346 ATGTGTGTCTGCACGTGAGATGG - Intergenic
1020977101 7:15020212-15020234 ATGTGAATCTGGAGCTCAAGAGG + Intergenic
1021617327 7:22516246-22516268 ATTTGTGCTAGGAGCTCAGAAGG - Intronic
1021815444 7:24443085-24443107 CTGTGTGTCTGGCCCTCACAAGG + Intergenic
1022926919 7:35065655-35065677 ATTTGTGCTAGGAGCTCAGAAGG - Intergenic
1023165764 7:37342371-37342393 ATTTGTGTCTGAAGCTAGGAAGG - Intronic
1024536648 7:50440391-50440413 AGGTGTTTCTGGAGGTCACAAGG - Intergenic
1025224116 7:57141915-57141937 ATCTGTGTGTTGAGCCCAGAAGG + Intergenic
1025500841 7:61293723-61293745 ATGTGTGCATGTAGCTCATAGGG + Intergenic
1025576109 7:62643412-62643434 ATGTGTGTCTTCATCTCATAGGG - Intergenic
1025721947 7:64025156-64025178 ATCTGTGTGTTGAGCCCAGAAGG - Intergenic
1025907675 7:65800436-65800458 ATGTGTCACTGGGGCTCACAGGG + Intergenic
1027918330 7:84357033-84357055 TAGTGTGTGTGGTGCTCAGATGG - Intronic
1028547391 7:92018826-92018848 ATATGACTCTGCAGCTCAGAAGG - Intronic
1029423840 7:100484760-100484782 GTGTGTGTCTGGAGGTCTGTGGG + Intronic
1029492669 7:100880798-100880820 ATGTGGGTCTGGAGCACAGGCGG + Intronic
1029619989 7:101684407-101684429 ATGACTGGCTGGAGCACAGAGGG + Intergenic
1030171409 7:106606638-106606660 ATAGGAGTCTGGAGTTCAGAGGG - Intergenic
1031467266 7:122127875-122127897 ATATGAGTCTGAAGCTCAGGAGG - Intronic
1031803486 7:126278063-126278085 ATGTGTGTCTGCACGTGAGATGG + Intergenic
1033685033 7:143631316-143631338 ATGTGTCTCTGGGGCTAAGTTGG + Intronic
1033688206 7:143710535-143710557 ATGTGTCTCTGGGGCTAAGTTGG + Intronic
1033699580 7:143826305-143826327 ATGTGTCTCTGGGGCTAAGTTGG - Intergenic
1033932889 7:146546163-146546185 ATTTGTGTGTGTAGCTTAGAGGG + Intronic
1034150769 7:148913937-148913959 ATCTGTGTCAGGAGCCCACATGG + Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034459672 7:151191499-151191521 AAATGTGTGTGGAGCTCAGCTGG - Intronic
1035241979 7:157538107-157538129 GTGTGTGTGCAGAGCTCAGATGG - Intergenic
1035488647 7:159252802-159252824 GTGTGTGTCTGGAGCCCTGGGGG - Intergenic
1035698611 8:1620944-1620966 TTGTTTGTCTGGAGAGCAGAGGG - Intronic
1036757329 8:11479911-11479933 AACTGCGTCTGCAGCTCAGAAGG + Intergenic
1037620348 8:20558160-20558182 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
1038416575 8:27400796-27400818 GCGTGGGTCTGGAGCTCAGGAGG + Intronic
1040119410 8:43665329-43665351 ATGTGTGTATTCATCTCAGAGGG + Intergenic
1040694646 8:49980986-49981008 CTGTGTGCATGGGGCTCAGAAGG - Intronic
1041132857 8:54721333-54721355 ATCTGCCTCTGGAGCTCTGAAGG + Intergenic
1042303220 8:67308207-67308229 CTGTGTGTCAGGAATTCAGATGG - Intronic
1042332327 8:67593771-67593793 ATGTGTGTCTGCACGTGAGATGG + Intronic
1042394719 8:68278539-68278561 ATGTGTGTCTGCACGTGAGATGG - Intergenic
1043691550 8:83159656-83159678 ATCTGTTTCTGCAGCTCAGAGGG + Intergenic
1044739742 8:95314108-95314130 GTGTAGGTCTGGATCTCAGAGGG + Intergenic
1044830064 8:96238517-96238539 ATGCATGTCTGGTGCTCAGTTGG + Intergenic
1045576137 8:103422291-103422313 ATGCAGGTCTGGAGCTCAGGAGG + Intronic
1046678237 8:117137027-117137049 ATGTGTTTCTTGAGGGCAGATGG + Intronic
1046828805 8:118721604-118721626 ATGTGTGTCTGCACGTGAGATGG + Intergenic
1047213498 8:122858566-122858588 GTGTGCCTGTGGAGCTCAGAGGG + Intronic
1047697761 8:127419764-127419786 ATGAGTGACTGAAGCTAAGAAGG + Exonic
1048475844 8:134741697-134741719 GTATGAGTCTGGAGCTAAGAAGG - Intergenic
1049265938 8:141667961-141667983 GAGTGCGTCTGGAGCACAGATGG + Intergenic
1049604873 8:143524636-143524658 GTGTGTGCCTGAAGCTCACAGGG - Intronic
1052059515 9:23942990-23943012 ATCTCTGTCTACAGCTCAGAAGG - Intergenic
1052513669 9:29452825-29452847 ATGTGTGTCTGCATGTGAGATGG - Intergenic
1052717173 9:32130749-32130771 ATGTGTGTCTGCATGTGAGATGG - Intergenic
1053121891 9:35553699-35553721 AAGTGTGGCTGGAGCACAGTGGG + Intronic
1054729295 9:68684640-68684662 GAGTGAGTCTGGAGTTCAGAGGG + Intergenic
1056441263 9:86623520-86623542 ATTTCTTTCTGGATCTCAGATGG + Intergenic
1056809026 9:89750114-89750136 ATGGGACTCTGGTGCTCAGATGG - Intergenic
1057206678 9:93177766-93177788 ATGGGGGTCTGGAGTGCAGAGGG - Intergenic
1057426031 9:94950509-94950531 CTGTGCATCTGGGGCTCAGATGG + Intronic
1059904187 9:118963515-118963537 ATTGATGTCTGGAGTTCAGAAGG - Intergenic
1062297161 9:135837920-135837942 ATGTGTGTCTGTAGAACAGGTGG - Intronic
1062297205 9:135838456-135838478 ATGTGTGTCTGTAGAACAGGTGG - Intronic
1062310984 9:135937095-135937117 AAGTGTCTCTGGAGCTGCGATGG - Intronic
1062371901 9:136243950-136243972 AACTGTCCCTGGAGCTCAGAAGG - Intronic
1062644112 9:137538036-137538058 GTGTGTCTCTGGAGCTGAGGTGG - Intronic
1186654917 X:11601992-11602014 CTGTGTGTATGGAGGTGAGAGGG + Intronic
1187355283 X:18564116-18564138 ATGTGTCTCTGGACTTCAGAGGG + Intronic
1187676499 X:21721552-21721574 ATGTGTGTCTTGGTCTGAGAAGG - Intronic
1187754080 X:22500971-22500993 ATGCGTGTTTGAAGTTCAGATGG - Intergenic
1188543123 X:31271287-31271309 ATCTGAGTCTTGAGCTCAGAGGG + Intronic
1190820839 X:53970601-53970623 ATGTGTGTCTGCACTTAAGATGG - Intronic
1192762001 X:74103888-74103910 ACCTGTGTATGGAGCTTAGAGGG - Intergenic
1193034694 X:76936479-76936501 ATGTGTGTCTGCACGTGAGATGG - Intergenic
1193315855 X:80064433-80064455 ATGTGTCTCTGCAGGTGAGATGG + Intergenic
1193745277 X:85271091-85271113 ATATGTTTCTTGAGTTCAGAAGG - Exonic
1196187278 X:112757912-112757934 ATATGGGTCTGAAGCTCAGGAGG - Intergenic
1196946355 X:120830946-120830968 ATGTGTGTCTGCATGTGAGATGG + Intergenic
1198598974 X:138264696-138264718 ATGTGTATCTGCAGGTCACAGGG + Intergenic
1198631225 X:138640864-138640886 ATGTGTGTCCGTATCTCAGCAGG + Intronic
1200581210 Y:4952802-4952824 ATGTGTGTCTGCACGTGAGATGG + Intergenic
1201418670 Y:13774598-13774620 ATGTGTCTCTGCACGTCAGATGG + Intergenic