ID: 999054502

View in Genome Browser
Species Human (GRCh38)
Location 5:148559588-148559610
Sequence CTAAACATACAAATGGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999054500_999054502 -5 Left 999054500 5:148559570-148559592 CCTAGGTTTCTTGAGAGACTAAA 0: 1
1: 0
2: 1
3: 14
4: 212
Right 999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG No data
999054495_999054502 20 Left 999054495 5:148559545-148559567 CCTTTAAATATATGCACTCTTTC 0: 1
1: 0
2: 0
3: 19
4: 310
Right 999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG No data
999054498_999054502 -3 Left 999054498 5:148559568-148559590 CCCCTAGGTTTCTTGAGAGACTA 0: 1
1: 0
2: 0
3: 8
4: 122
Right 999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG No data
999054497_999054502 -2 Left 999054497 5:148559567-148559589 CCCCCTAGGTTTCTTGAGAGACT 0: 1
1: 0
2: 0
3: 12
4: 219
Right 999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG No data
999054499_999054502 -4 Left 999054499 5:148559569-148559591 CCCTAGGTTTCTTGAGAGACTAA 0: 1
1: 0
2: 2
3: 9
4: 132
Right 999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999054502 Original CRISPR CTAAACATACAAATGGACAA TGG Intronic
No off target data available for this crispr