ID: 999057310

View in Genome Browser
Species Human (GRCh38)
Location 5:148592329-148592351
Sequence ATAGGTAAACATATGGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 222}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999057310 Original CRISPR ATAGGTAAACATATGGGGCA TGG (reversed) Intronic
900504698 1:3023648-3023670 ATAGGCAAAGACATGGGGAAGGG - Intergenic
901727460 1:11253297-11253319 ATAGGAAAAAATGTGGGGAAAGG - Intronic
905111843 1:35600892-35600914 ATAGGTAAACATTTAGTTCAGGG - Intronic
906953658 1:50354730-50354752 ATAAATAAATATATGGGACAAGG + Intergenic
907203918 1:52752309-52752331 ATAGGGCAACCTATGGGGGAAGG + Intronic
908668424 1:66518402-66518424 ATAGGTAAACTTATGTCGGAGGG - Intergenic
910691861 1:89973682-89973704 ACAGGAAGAGATATGGGGCAAGG - Intergenic
911346605 1:96703999-96704021 ATAGGAAAACGTATTGGGCAAGG + Intergenic
912053711 1:105567834-105567856 ATATGTAACAATATGTGGCAGGG - Intergenic
912713641 1:111966848-111966870 AAGGGTAAACTCATGGGGCATGG + Intronic
915783493 1:158580797-158580819 ATATGTTGACATATGGGGCAGGG - Intergenic
916170927 1:162001098-162001120 ATAAGTAGATATATGGGGGAAGG - Intronic
916983978 1:170170422-170170444 ATAGGTAAACACATGTCACAGGG + Intergenic
918539152 1:185608920-185608942 ATAGGTAAACACATGTCACAGGG - Intergenic
918581981 1:186142053-186142075 ATAGGTAAACTTATGACTCAGGG + Intronic
918697963 1:187567712-187567734 ATATGTAAACATAGGGGGTAGGG - Intergenic
918868742 1:189938073-189938095 ATAGGTAAACACATGTCACAGGG + Intergenic
921190270 1:212701492-212701514 CTAGGAAAACATCTGGGTCAAGG + Intergenic
921366251 1:214377468-214377490 ATAGGTAAACACATGTCACAGGG - Intronic
922867417 1:228872023-228872045 ATAGGCTAAGATATGGGGGAAGG + Intergenic
1063742478 10:8838940-8838962 ATAGGTATACATATGGGCCATGG - Intergenic
1064901637 10:20301853-20301875 ATAGGGCAAGATATGGGGGAGGG + Intergenic
1065923159 10:30411072-30411094 ATAAGTAAATATATTGGGCCAGG + Intergenic
1068850808 10:61737899-61737921 ATAGGTAAACATGTGTCACAGGG - Intronic
1070351358 10:75594904-75594926 ATATGCAAACAGATGAGGCATGG - Intronic
1071303092 10:84272518-84272540 ACAGGTGAACAGATGGGGCTGGG - Intergenic
1071380450 10:85053760-85053782 ATAGCTCAAGATATGGGGAATGG - Intergenic
1073614275 10:104977133-104977155 TGAGGTAAAAATAGGGGGCAAGG - Intronic
1078079023 11:8190716-8190738 ATTGGTAACCTAATGGGGCACGG - Intergenic
1078650244 11:13184588-13184610 ATTGGTCTACATATGAGGCAGGG + Intergenic
1078769409 11:14334195-14334217 ATAGGTAAAGTTATGGGAAATGG - Intronic
1079827694 11:25218711-25218733 AGAGGTAAATAACTGGGGCAAGG + Intergenic
1080975074 11:37329725-37329747 ATAGGTAAACTCATGGCACAGGG + Intergenic
1081365620 11:42231538-42231560 ACAAGTAAACATATGCAGCAGGG - Intergenic
1081947714 11:47013299-47013321 ATAGATAAACATGTGTGCCATGG + Intronic
1082943859 11:58737522-58737544 ATAGATAAACATCTAGGGTAAGG - Intergenic
1083145576 11:60755907-60755929 ATTGGTGAACAAAGGGGGCAAGG - Intergenic
1085441945 11:76572749-76572771 AAAAGTAAACAAATGGGGCTGGG - Intergenic
1086414788 11:86577726-86577748 ATTGGCAAAGATATTGGGCAAGG - Intronic
1086577464 11:88356499-88356521 ATAGTTAAACATAAGAGGCAAGG + Intergenic
1089207501 11:116776344-116776366 ATAGGTAAAAAGATAGGGAAAGG - Intergenic
1091130047 11:133138397-133138419 CAAGGTAACCATATGGGGAAAGG + Intronic
1091485578 12:884376-884398 ACAGATAAACATATGGGAGAGGG + Intronic
1092995686 12:13948287-13948309 GCATTTAAACATATGGGGCAGGG - Intronic
1094721444 12:33068696-33068718 ACACATAAACACATGGGGCAGGG + Intergenic
1095660399 12:44725944-44725966 ATAGGTAAACATATGTCACTGGG - Intronic
1096046775 12:48569416-48569438 ATAGGAAAATAAATGGGGCCAGG + Intronic
1096655204 12:53085864-53085886 ATAGGTAAACAAGTGTGCCATGG - Intergenic
1099860221 12:88217304-88217326 ATAGGTAAACATTTGTCACAGGG + Intergenic
1101950784 12:109173254-109173276 ATAGGTAAACTTATGTCACAGGG - Intronic
1105531205 13:21222122-21222144 AAAGGGAAAAATATGGGGGAGGG - Intergenic
1105643696 13:22293600-22293622 ATAGGTAAACTTATGTCACAGGG + Intergenic
1106381398 13:29243356-29243378 ATAGGCAGACAGATGAGGCAAGG + Intronic
1106697150 13:32187593-32187615 ATAGGTAGCCATCTGGGGAAAGG - Exonic
1107996406 13:45865387-45865409 ATAGTCACACATATGAGGCAGGG + Intergenic
1108233625 13:48377447-48377469 ATAGGTAAGAGTATGGGCCATGG + Intronic
1109793943 13:67285524-67285546 ATGGATAAACTTATGGGGGAGGG + Intergenic
1111363012 13:87201068-87201090 ATAGGTAAACTCATGTGACAGGG - Intergenic
1113182841 13:107651017-107651039 ATAGGTAAACACATGTCACAGGG - Intronic
1115069087 14:29299611-29299633 TTAGGTTAGCAAATGGGGCATGG + Intergenic
1115682120 14:35752485-35752507 ATACATAAGCATATGTGGCAGGG + Intronic
1115926618 14:38442875-38442897 ATAGGTAAACATGTGTCACAGGG + Intergenic
1117051030 14:51859960-51859982 ATAAGTATTCTTATGGGGCACGG - Intronic
1117758758 14:59004178-59004200 ATAGGGAAAAGAATGGGGCATGG + Intergenic
1120944507 14:89981595-89981617 CTAGGCAATGATATGGGGCAGGG - Intronic
1121695269 14:95907434-95907456 AACGGTAAGCATAAGGGGCAAGG + Intergenic
1126425487 15:48523097-48523119 ATTAGTAAATATTTGGGGCATGG + Intronic
1127939331 15:63678055-63678077 AAAGGTAAACATACTAGGCATGG - Exonic
1127949685 15:63793056-63793078 ATAGGGCAGGATATGGGGCAAGG + Intronic
1130984744 15:88837448-88837470 ATCTGTAGACATATGGGACAAGG + Intronic
1131327030 15:91457717-91457739 AAAGGTAAACATATGAGGTAGGG - Intergenic
1131484823 15:92810976-92810998 ATAAGGACACAAATGGGGCAGGG - Intergenic
1131734776 15:95320360-95320382 ATAGGGCAAGATATGGGGGAAGG + Intergenic
1131742528 15:95409863-95409885 ATATATACACATATAGGGCATGG - Intergenic
1132209616 15:100010325-100010347 ATAAGTAAATATATTGGGCATGG + Intronic
1132957044 16:2599799-2599821 ATAGGGAAACAAGTGGAGCAGGG + Exonic
1132969391 16:2678218-2678240 ATAGGGAAACAAGTGGAGCAGGG + Intergenic
1133590540 16:7238687-7238709 ATAGGTAAACTTGTGTGTCATGG + Intronic
1134378408 16:13701264-13701286 ATAGTTTAACAAATGGGGCCAGG + Intergenic
1135815887 16:25633390-25633412 ATATATTAATATATGGGGCAGGG + Intergenic
1135966970 16:27043843-27043865 ATAGGTAAACTTATGTCACAAGG + Intergenic
1137494155 16:48956759-48956781 ATAGGAAAACTCCTGGGGCAGGG - Intergenic
1149101572 17:52912571-52912593 ATAGGTAAACACATGTCACAGGG - Intergenic
1153476447 18:5503946-5503968 TTAGGTAATCATATGTGGTAAGG + Intronic
1153802688 18:8685078-8685100 ATAGGGAGACCTATGGGTCAGGG + Intergenic
1155743936 18:29326589-29326611 ACAGGAAAACACATGGGGAAAGG - Intergenic
1156586781 18:38439794-38439816 ATGGTTATACATATTGGGCAGGG - Intergenic
1158022840 18:52864589-52864611 ATAGGTATACATAGGTGCCATGG + Intronic
1158493771 18:57934308-57934330 ATAGGTAAATGTGTGTGGCATGG + Intergenic
1159400078 18:67919822-67919844 ATAGGTAAACTTATGTCACAGGG + Intergenic
1159851069 18:73527861-73527883 ATAGGTATACATGTGTGCCATGG + Intergenic
1161472620 19:4466911-4466933 ATATATAAACAGACGGGGCATGG - Intergenic
1161914448 19:7218126-7218148 ATAGGAAAACACAGGGGGAAGGG + Intronic
1165507998 19:36246904-36246926 ATAGGGCAAGATATGGGGGAGGG + Intergenic
1165837198 19:38766032-38766054 AAAGGTAAGCATATTGGGCAGGG + Intronic
926941737 2:18144826-18144848 GTAGGTAAACAAAGTGGGCAGGG - Intronic
928372439 2:30750400-30750422 ATAGGTAAACATGTGTCACAGGG - Intronic
930756836 2:54983561-54983583 AGAGGTAAAACTATGGGACAAGG - Intronic
930865219 2:56116023-56116045 ATAGGTAAACTCATGTCGCAGGG + Intergenic
932198969 2:69809196-69809218 ATAAGTAAAAAGAAGGGGCAAGG - Intronic
937316181 2:120933390-120933412 ATGGGGAGACAAATGGGGCAGGG + Intronic
937328280 2:121005316-121005338 GTAGGTAAAGAGATGGGGCTGGG - Intergenic
937629053 2:124078827-124078849 AAACGTCAATATATGGGGCATGG + Intronic
938850256 2:135252287-135252309 ATAGGTAAACATGTGTCACAGGG - Intronic
939104507 2:137933476-137933498 ATCTGTAAACATATGGGGAAAGG - Intergenic
939432126 2:142124087-142124109 ATAGGTAAACATGTGTAACAAGG + Intronic
940738186 2:157477810-157477832 ATAGGTAAACACATGTCACAGGG - Intronic
941373032 2:164691259-164691281 ATAGGAAAAGAAATGGGGAAAGG - Intronic
941462177 2:165784413-165784435 AGAGATAAATATAAGGGGCATGG + Intronic
942824098 2:180153205-180153227 ATAGGTAAACTCATGTCGCAGGG + Intergenic
943322382 2:186461575-186461597 ATAGGTAAACATGTGTCACAGGG - Intergenic
944340295 2:198588077-198588099 AAAGGTGGACATATAGGGCACGG + Intergenic
944502836 2:200379528-200379550 ATAGCTAAAGAGATGGGGGAAGG + Intronic
945036716 2:205709854-205709876 ATATGTGAACATATGGCCCATGG - Intronic
945535546 2:211013248-211013270 TAAGGTACACATGTGGGGCAGGG + Intergenic
947825602 2:233104259-233104281 ACAGATAAAGAAATGGGGCAAGG - Intronic
1173022597 20:39279663-39279685 ATAAATAAACAGATGGAGCATGG + Intergenic
1174706087 20:52657602-52657624 ATAGGTAGAAATTGGGGGCAGGG + Intergenic
1175827215 20:61942711-61942733 ACAGGTCAACACATGGGGGAGGG + Intergenic
1177165271 21:17594938-17594960 ATAGGTAAACATGTGTCACAGGG - Intronic
1177602251 21:23330537-23330559 ATAGGTAAACACATGTCACAGGG + Intergenic
1177685654 21:24434450-24434472 ATAGGTAAACATGTGTCACAGGG + Intergenic
1178153366 21:29822231-29822253 ATATGTAAACAAAATGGGCATGG + Intronic
1178452928 21:32720819-32720841 AAAGGTCAACATATGGGAAATGG - Intronic
1180217830 21:46337270-46337292 ATAAGTAAATAAATGGGGCCGGG - Intronic
1182979614 22:34656539-34656561 ATGCATAAACATATGGGGAATGG + Intergenic
1183156529 22:36079909-36079931 AGAGGTAAACACATGTGTCATGG + Intergenic
1184023253 22:41834789-41834811 ATGGGTTAACAAATGGGGGATGG + Intronic
1184293519 22:43510176-43510198 ATAAGCAAAGATGTGGGGCAGGG + Intergenic
950312776 3:11973726-11973748 ATGGGGAAACATATGAGGCCAGG - Intergenic
950768165 3:15289694-15289716 ATAGGAAAATATATGGGTGAAGG - Intronic
951597363 3:24332728-24332750 ATAGGGAAACATTTGGGGAAAGG + Intronic
951603674 3:24407030-24407052 AAAGGTCAACTTCTGGGGCATGG + Intronic
951871016 3:27362531-27362553 AGAGGTAATTATATGAGGCAAGG + Intronic
952026104 3:29084615-29084637 ATAGGTAAACACATGTCACAAGG + Intergenic
952127950 3:30324196-30324218 ATAGGTAAACACATGTCACAAGG - Intergenic
953081381 3:39622154-39622176 GAAGGTAAATATATGGGGGAGGG + Intergenic
953790551 3:45944647-45944669 ATTGGTAAACAGATTGGGCCTGG - Intronic
954053190 3:47999780-47999802 ATAGGTAAACACATGTCACAAGG - Intronic
955034865 3:55257748-55257770 ATAAGGAATCATACGGGGCATGG - Intergenic
955218213 3:57002639-57002661 ATAGGTAAACGTGTGTGTCATGG + Intronic
955716150 3:61832432-61832454 GTGGGTAAGCATCTGGGGCAGGG + Intronic
959894890 3:111594433-111594455 ATAAGTAAGTATCTGGGGCATGG - Exonic
960211515 3:114972968-114972990 ATAAATAATCTTATGGGGCAAGG + Intronic
960326621 3:116304300-116304322 ATATGTAAAGATATTGGGCTTGG + Intronic
960343415 3:116502861-116502883 ATAGGTAAACACATGTCACAGGG - Intronic
961978857 3:131055438-131055460 ATAGATAAAAATAAGGGGCCAGG + Intronic
962135526 3:132727739-132727761 ACAGGTAAACATATTGGCTATGG - Intergenic
963785362 3:149529136-149529158 ATAGGCATAAATATGGGGAAAGG - Intronic
964375258 3:156042972-156042994 ATAGGTAAACTCATGTTGCAGGG + Intronic
965281290 3:166757016-166757038 ATAGGTTAAAATATGGGAAATGG + Intergenic
966877272 3:184329814-184329836 AAAGGTAAAGAGATGGGGAAAGG + Intronic
967151580 3:186655403-186655425 ATAGGTAAACTCATGTCGCAGGG - Intergenic
968633283 4:1663901-1663923 AGAGGAAACCATAAGGGGCAGGG + Intronic
971453550 4:26822477-26822499 TTAGGGAAACATATGGGGCTTGG - Intergenic
971709148 4:30089042-30089064 ATAAAAAAACATATGGGGCCGGG - Intergenic
974354204 4:60791033-60791055 ATAGGGCAAGATATGGGGGAGGG - Intergenic
975138885 4:70900952-70900974 ATAGGTAAACGTGTGTGCCATGG + Intergenic
976012925 4:80513912-80513934 ATATTTAAACATATGGGTTAAGG - Intronic
976205233 4:82617877-82617899 ATAGGTAAAAAGATGGGGGAAGG - Intergenic
976793364 4:88905454-88905476 ATAGGTAAACATGTGTCACAAGG + Intronic
977572021 4:98638597-98638619 ACAGGTAAAGGTATGGGGCAAGG + Intronic
978954934 4:114600562-114600584 ATAGGTAAACACATGTCACAGGG + Intronic
980261326 4:130452363-130452385 ATAGGTATACATATGTGCCATGG + Intergenic
980848675 4:138354606-138354628 TGAGGTGAACATATGGGGCTTGG + Intergenic
981181399 4:141750064-141750086 ATAGGTAAACATGTGACTCAGGG - Intergenic
982816854 4:159896752-159896774 ATAGGGAAACAGATGGGAAATGG + Intergenic
983234847 4:165167596-165167618 ATGGGTACACATATGGGTAAGGG - Intronic
984881076 4:184410410-184410432 AGAGGTCAGCATATGGGGCTGGG - Intronic
984996171 4:185432565-185432587 ATAGATAAAAATATGAGGCTGGG + Intronic
987756861 5:22107695-22107717 AAAGGTAAACAAAGGGGGCAGGG + Intronic
988730599 5:33969102-33969124 ATTGATAAACAAATGGGTCAAGG - Intronic
988793719 5:34633134-34633156 AAAAGTAAACATCTGGGGCATGG + Intergenic
990409498 5:55526992-55527014 ATAAGTAAACAAATAGGACACGG - Intronic
991178171 5:63715541-63715563 ATAGGTAGAAATATGGGCAAAGG - Intergenic
991572994 5:68075095-68075117 ATAGGAAACCAGATTGGGCAGGG - Intergenic
992555811 5:77902003-77902025 ATATGTAAACCTATGGTGTATGG - Intergenic
993283409 5:85958237-85958259 ATAGGTAAACTTGTGTGTCATGG - Intergenic
994885468 5:105555882-105555904 ATTTGTAAAGATATGGGGTAAGG + Intergenic
995946102 5:117648273-117648295 ATAGGTATATATATGTGCCATGG + Intergenic
996125842 5:119724874-119724896 ATATGTAGACCCATGGGGCAGGG + Intergenic
997946080 5:138202715-138202737 ATAGATAAATAAATGGGGAAAGG + Intronic
999057310 5:148592329-148592351 ATAGGTAAACATATGGGGCATGG - Intronic
1000647941 5:163781091-163781113 GTAGGTAAACAAAGGGGGCTGGG + Intergenic
1004138943 6:12997408-12997430 ATAGATAAATATATGGGGGATGG + Intronic
1009264001 6:61531417-61531439 ATAGGTAAACTTATGTCACAGGG - Intergenic
1009383717 6:63063691-63063713 ATAGGTAAACGTGTGGGTCCAGG - Intergenic
1010952499 6:82054116-82054138 TTAGGTAAACTTGTGGGGGAGGG - Intergenic
1012582493 6:100885593-100885615 ATAGGTGGGCATATGGGCCAAGG + Intergenic
1014964392 6:127729022-127729044 ATAGGGAAACAAGTGAGGCAAGG - Intronic
1015104777 6:129523112-129523134 ATAAGTAAATATATGAGGCTGGG + Intergenic
1015288838 6:131514910-131514932 ATAAGTAAACATATGTCACAGGG + Intergenic
1015515295 6:134077337-134077359 AGAGGAAATCTTATGGGGCATGG - Intergenic
1016835007 6:148468098-148468120 CTAGGAAAACAAAGGGGGCAGGG - Intronic
1020146162 7:5645103-5645125 ATAGGCAAACAGGCGGGGCACGG - Intronic
1021115227 7:16739506-16739528 ATCTGTGAACAAATGGGGCAGGG - Intergenic
1022145656 7:27537312-27537334 ATAGTTAAACATCTGAGACAAGG + Intronic
1023502995 7:40870766-40870788 ATAAGTAAACAAATGGAGAACGG - Intergenic
1026364228 7:69631400-69631422 ATAGTTTAACATCTGGGTCAGGG + Intronic
1027751557 7:82154189-82154211 ATATGCAGATATATGGGGCAGGG - Intronic
1030200418 7:106897427-106897449 ATAGGTAAACACATGTCACAGGG + Intronic
1030312809 7:108085032-108085054 ATAAGAAAATATATGGGGCCTGG - Intronic
1030994394 7:116340745-116340767 TTAAGAAACCATATGGGGCAGGG + Intronic
1034737845 7:153445721-153445743 AGAGGTAAAATTGTGGGGCAGGG - Intergenic
1038050569 8:23806516-23806538 ATATTTAAACATATGGTACATGG + Intergenic
1038119012 8:24590910-24590932 ACAGGTGAAAATATGGGCCATGG - Intergenic
1041356991 8:57011940-57011962 ATAGGTAAACTCATGTGACAGGG + Intergenic
1041810280 8:61901140-61901162 ATATGTAAACATATTGGCTACGG - Intergenic
1041914023 8:63121588-63121610 ATAGGTAAACACATGTCACAGGG + Intergenic
1042728083 8:71900909-71900931 TTAGATAAACAAATGGGACAGGG + Intronic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1043573146 8:81627935-81627957 ATAGGTAAACGTTTGGGTGAGGG + Intergenic
1046409387 8:113819443-113819465 ATAGGTAAACATATGTCACAGGG + Intergenic
1047128315 8:121988075-121988097 ATAGAAAAACATATAGGGAAGGG + Intergenic
1048623391 8:136159142-136159164 ATAGGGAACCATAAGGGGAATGG + Intergenic
1051104819 9:13567225-13567247 AAAAGTACACACATGGGGCAGGG - Intergenic
1051685537 9:19654557-19654579 CTAGGTAAAGGAATGGGGCATGG + Intronic
1053245614 9:36532403-36532425 ATTGGGAAACAGATGTGGCAAGG - Intergenic
1055120123 9:72650547-72650569 ATAGGTAAACATGTGTCACAGGG + Intronic
1055278156 9:74642741-74642763 ATAGGTAAACAAGTTGGGTACGG - Exonic
1056192241 9:84195672-84195694 ATAGGTAAACTTATGTCACAGGG - Intergenic
1058007172 9:99929659-99929681 ATATGTAATTATATGGGGGAAGG - Intronic
1058533550 9:105931347-105931369 ATAGGTAAACTTATGAGGGGTGG + Intergenic
1058568355 9:106311564-106311586 ATTTGTAAACAAATTGGGCAGGG + Intergenic
1059730351 9:117050921-117050943 AAAGGACAACATATGGGGGAGGG - Intronic
1059969632 9:119651972-119651994 ATAGGCAAAAATATTGGGAAAGG - Intergenic
1059975589 9:119713449-119713471 ATAGGTAAACATATGTCACAGGG + Intergenic
1060106175 9:120874935-120874957 ATAGGGAAACAGGTGTGGCAAGG + Intronic
1061644868 9:131992995-131993017 AAAGGCACACATATGGGGCATGG + Intronic
1062007316 9:134246531-134246553 ACAGGTAAAGATCTGGGTCAAGG + Intergenic
1187005159 X:15225546-15225568 ATAGTTAGACAAATGGGCCATGG + Intergenic
1187182047 X:16952139-16952161 ATAGGTATATATATGTGCCATGG + Intronic
1187343638 X:18443396-18443418 ATAGGTAAACACATGTCACAGGG + Intronic
1187441716 X:19326747-19326769 ATAGGTAAACAAAATGGGCATGG - Intergenic
1190053220 X:47167161-47167183 CTAGGAAAAAATATGGGGAAAGG - Intronic
1191023121 X:55884382-55884404 ATAGGTAAACACATGTCACAGGG - Intergenic
1192386251 X:70673947-70673969 ATAGGTAAACACATGTCACAGGG + Intronic
1193383582 X:80844867-80844889 ATAGTAAAACATAGGGAGCAAGG + Intergenic
1195431185 X:104791236-104791258 TGAGGTAAACAGATGGGGGAGGG - Intronic
1195823976 X:108977195-108977217 ATAGGTAAACACATGTCACAGGG + Intergenic
1197359905 X:125488414-125488436 ATAGGTAAACTTGTGTGGTAGGG + Intergenic
1198256946 X:134932286-134932308 ATAGGGCAAGGTATGGGGCAAGG + Intergenic
1201674212 Y:16560816-16560838 TTAGAAAAATATATGGGGCAGGG - Intergenic
1201915963 Y:19181454-19181476 CTATGTAAACATATGGGTTAAGG - Intergenic