ID: 999061329

View in Genome Browser
Species Human (GRCh38)
Location 5:148638888-148638910
Sequence CACGCCCATCTAATTTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 851
Summary {0: 1, 1: 9, 2: 69, 3: 246, 4: 526}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999061329_999061335 11 Left 999061329 5:148638888-148638910 CCACAAAAAATTAGATGGGCGTG 0: 1
1: 9
2: 69
3: 246
4: 526
Right 999061335 5:148638922-148638944 CTGTAGTTCCAGCTACCTGGGGG 0: 4
1: 216
2: 1948
3: 5333
4: 8439
999061329_999061339 21 Left 999061329 5:148638888-148638910 CCACAAAAAATTAGATGGGCGTG 0: 1
1: 9
2: 69
3: 246
4: 526
Right 999061339 5:148638932-148638954 AGCTACCTGGGGGGCTGAGGTGG 0: 45
1: 1188
2: 15553
3: 30730
4: 46637
999061329_999061332 9 Left 999061329 5:148638888-148638910 CCACAAAAAATTAGATGGGCGTG 0: 1
1: 9
2: 69
3: 246
4: 526
Right 999061332 5:148638920-148638942 GCCTGTAGTTCCAGCTACCTGGG 0: 64
1: 2742
2: 43902
3: 178822
4: 264358
999061329_999061341 25 Left 999061329 5:148638888-148638910 CCACAAAAAATTAGATGGGCGTG 0: 1
1: 9
2: 69
3: 246
4: 526
Right 999061341 5:148638936-148638958 ACCTGGGGGGCTGAGGTGGGAGG 0: 36
1: 876
2: 10700
3: 25050
4: 74122
999061329_999061331 8 Left 999061329 5:148638888-148638910 CCACAAAAAATTAGATGGGCGTG 0: 1
1: 9
2: 69
3: 246
4: 526
Right 999061331 5:148638919-148638941 TGCCTGTAGTTCCAGCTACCTGG 0: 67
1: 2940
2: 43405
3: 144646
4: 149977
999061329_999061334 10 Left 999061329 5:148638888-148638910 CCACAAAAAATTAGATGGGCGTG 0: 1
1: 9
2: 69
3: 246
4: 526
Right 999061334 5:148638921-148638943 CCTGTAGTTCCAGCTACCTGGGG 0: 6
1: 215
2: 1902
3: 4799
4: 7680
999061329_999061340 22 Left 999061329 5:148638888-148638910 CCACAAAAAATTAGATGGGCGTG 0: 1
1: 9
2: 69
3: 246
4: 526
Right 999061340 5:148638933-148638955 GCTACCTGGGGGGCTGAGGTGGG 0: 47
1: 1248
2: 18917
3: 114150
4: 214688
999061329_999061336 12 Left 999061329 5:148638888-148638910 CCACAAAAAATTAGATGGGCGTG 0: 1
1: 9
2: 69
3: 246
4: 526
Right 999061336 5:148638923-148638945 TGTAGTTCCAGCTACCTGGGGGG 0: 112
1: 3905
2: 56534
3: 173211
4: 229178
999061329_999061337 18 Left 999061329 5:148638888-148638910 CCACAAAAAATTAGATGGGCGTG 0: 1
1: 9
2: 69
3: 246
4: 526
Right 999061337 5:148638929-148638951 TCCAGCTACCTGGGGGGCTGAGG 0: 5
1: 402
2: 10966
3: 114228
4: 221951

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999061329 Original CRISPR CACGCCCATCTAATTTTTTG TGG (reversed) Intronic
900182551 1:1318500-1318522 TACGCCCAGCTAATTTATTTTGG - Intronic
901282934 1:8053271-8053293 CACGCCTGGCTAATTTTTTGTGG - Intergenic
901299733 1:8190891-8190913 CATGCCCAGCTATTTTTTTTTGG + Intergenic
901596414 1:10389010-10389032 CACGCCCAGCTAATTTTGGGGGG + Intergenic
902029893 1:13414613-13414635 CACGCCCAGCTAATTTTTGTGGG + Intronic
902894768 1:19471708-19471730 CACGCCTGGCTAATTTTTTTTGG - Intronic
903424183 1:23241090-23241112 CATGCCCAGCTAATTTTTGTGGG - Intergenic
903592546 1:24468156-24468178 CATGCCTGGCTAATTTTTTGTGG - Intronic
903783005 1:25834458-25834480 CACGCCCAGCTAATTTTTTTTGG - Exonic
903881948 1:26516550-26516572 GACGCCCAGCTAATTTTTGGTGG + Intergenic
903927477 1:26840964-26840986 CACATACAGCTAATTTTTTGGGG + Intronic
904154358 1:28470537-28470559 CATGCCCGGCTAATTTTTGGGGG - Intronic
904711199 1:32431829-32431851 CATGCCCAGCTAATTTTTACAGG + Intergenic
904746383 1:32713803-32713825 TACGCCCGACTAATTTTTTTTGG + Intergenic
904975400 1:34452354-34452376 CACGTCTATCTAATTCATTGGGG - Intergenic
905776635 1:40671917-40671939 CATGCCCAGCTAATTATTTTTGG + Intergenic
906025344 1:42668790-42668812 CTTGCCCATCTAATTTTGGGAGG + Intronic
906104693 1:43284813-43284835 CACGCCCTCCTCAGTTTTTGGGG + Intronic
906261114 1:44391005-44391027 GATGCCCAGCTAATTTTTTTTGG + Intergenic
906283994 1:44573959-44573981 CACGCCCAGCTCATATTTTTTGG - Intronic
906359070 1:45137218-45137240 CATGCCCAGCTAATTTTTTTAGG + Intronic
906412176 1:45587341-45587363 CACACCTGGCTAATTTTTTGGGG + Intronic
906420006 1:45657694-45657716 CATGCCCAGCTAACTTTTTTGGG - Intronic
906646532 1:47479119-47479141 CACGTCCGGCTAATTTTTTTTGG - Intergenic
907015731 1:51011088-51011110 CACGTCCAGCTAGTTTTTTTTGG - Intergenic
907206454 1:52776060-52776082 CACGCCCGGCTAATTTTTTTGGG - Intronic
907254803 1:53170839-53170861 CACACCCAGCTAATTTTTGTGGG - Intergenic
907272999 1:53301572-53301594 CATGCCCAGCTAATTTTTTTTGG - Intronic
907324914 1:53631231-53631253 CAATACCTTCTAATTTTTTGTGG + Intronic
907411874 1:54288861-54288883 CACACCCAGCTGATTTTTTTTGG - Intronic
907463882 1:54622580-54622602 CATACCCAGCTAATTTTTTGTGG - Intronic
907497821 1:54856442-54856464 CACGCCCGGCTAATTTTTTTTGG - Intronic
907507750 1:54933658-54933680 CACGCCTGGCTAATTTTTTGTGG + Intergenic
908469578 1:64430624-64430646 CATGCCCAGCTAATTTTTGTGGG + Intergenic
908955495 1:69621199-69621221 CATGCCCGGCTAATTTTTTATGG + Intronic
909018704 1:70407710-70407732 CATGCCAGGCTAATTTTTTGTGG - Intergenic
910006793 1:82407064-82407086 CATGCCCAGCTAATATTTTTTGG - Intergenic
910448510 1:87324016-87324038 CACGCCCAGCTAATTTTTTTTGG - Intergenic
911186696 1:94911610-94911632 CATGCCCAGCTAATTTTTGTGGG - Intronic
911442444 1:97944207-97944229 CACGCCCAGCTAATTTTTGTGGG + Intergenic
912398187 1:109365377-109365399 CATGCCCAGCTAATTTTGTGAGG + Intronic
912455706 1:109795583-109795605 CACGCCCGGCTAATTTTTTTTGG + Intergenic
912767665 1:112430384-112430406 CCCACCTATCTAATTTGTTGTGG + Intronic
912886975 1:113484879-113484901 CACGCCCAGCTAATTTTTTTTGG + Intronic
913525074 1:119683488-119683510 CACGCCCAGCTAACTTTTTAAGG - Intronic
914326316 1:146620292-146620314 CACACCCAACTAATTTTTGTGGG - Intergenic
914687041 1:149989581-149989603 CATGCCCAGCTAATTTTTGTGGG - Intronic
914724808 1:150318629-150318651 CACGCCCGGCTAATTTTTTGTGG - Intergenic
914949457 1:152099794-152099816 CATGCCCAGGTAATTTTTTTTGG + Intergenic
915070917 1:153266053-153266075 CACGCACTTATAATTTTTTATGG + Intergenic
915115560 1:153596938-153596960 CACGCCCGGCTAATTTTTGGGGG + Intergenic
915261715 1:154681620-154681642 CACGCCCGCCTAATTTTTTTTGG - Intergenic
915393625 1:155565138-155565160 CATGCCCACCTGATTTTTTTTGG - Intergenic
915477885 1:156163873-156163895 CAGGCCCAGCTCATTTTTTTTGG - Intronic
916150425 1:161783241-161783263 CAAGCCCACCTAAATTCTTGGGG + Intronic
916227365 1:162502017-162502039 CACACCCAGCTAATTTTTTGAGG - Intronic
916518417 1:165541557-165541579 CATGCCCAGCTAATTTTTTTTGG - Intergenic
916552171 1:165859668-165859690 CACACCCTGCTAATTTTTTGTGG - Intronic
917294130 1:173501665-173501687 CACGCCCAGCTAATTTTTGGTGG + Intronic
918061518 1:181065458-181065480 TGCGCCCATCTAATTTTTGTGGG - Intergenic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
918777662 1:188655858-188655880 CAGGCCCAGCTAATTTTTGTGGG + Intergenic
918864944 1:189883186-189883208 CACGCCCGACTAATTTTTGTAGG + Intergenic
919911825 1:202115951-202115973 CACACCCAGCTAAATTTTAGTGG + Intergenic
920045990 1:203132688-203132710 CACGCCCAGCTATTTGTTTTTGG - Intronic
920148039 1:203879755-203879777 CATGCCCGGCTAATTTTTTACGG - Intergenic
920332882 1:205223822-205223844 CAAGCCTGACTAATTTTTTGCGG - Intergenic
920391687 1:205607460-205607482 CACGTCCAGCTAATTTTGGGAGG + Intronic
920655883 1:207874446-207874468 CACGCCCAGCTAATTTTTTGTGG - Intergenic
920982397 1:210850352-210850374 CACGCCCAGCTACTTTTTTTTGG - Intronic
921203958 1:212832173-212832195 CATGCCCAGCTAATTTTTGTGGG + Intronic
921672091 1:217936801-217936823 CACATACATATAATTTTTTGTGG - Intergenic
921996375 1:221423850-221423872 CACTCCCAACTAGTTTTATGAGG + Intergenic
922320961 1:224486260-224486282 CATGCCCAGCTAATTTTTGTGGG + Intronic
922344942 1:224688766-224688788 CACGCCCGACTAATTTGTGGGGG - Intronic
922498302 1:226077970-226077992 CACGCCCAGCTAATTTTTGTGGG + Intergenic
922523515 1:226279002-226279024 CATGCCCTGCTAATTTTTTGTGG - Intronic
922708116 1:227802109-227802131 CACGCCCAGCTAACTTTTTTGGG + Intergenic
922782818 1:228267061-228267083 CATGCCTAGCTAATTTTTTAAGG + Intronic
923250567 1:232176422-232176444 CACACCCAGCTAATTTTTAAAGG - Intergenic
923372149 1:233325517-233325539 CACGCCCAGCTAATTTTTTTTGG - Intergenic
923785577 1:237065434-237065456 CACGCCTGGCTAATTTTTTTTGG + Intronic
923812673 1:237337093-237337115 CACGTCTGGCTAATTTTTTGTGG - Intronic
924763868 1:247013271-247013293 TACGCCCGGCTAATTTTTTGTGG - Intergenic
1062865348 10:847681-847703 CAGGCCCAGCTAATTTTTTTTGG + Intronic
1063315873 10:5005524-5005546 CACGTCCATCTATTTTTTTTTGG - Intronic
1063672668 10:8112061-8112083 CATGCCCAGCTAATTTTTGTGGG + Intergenic
1063992533 10:11581927-11581949 CACGCCGGGCTAATTTTTGGTGG + Intronic
1064039523 10:11947628-11947650 CATGCCCAGCTAATTATTTTGGG - Intronic
1064203611 10:13304353-13304375 CACGCTCAGCTAATTTTCTGGGG - Intergenic
1064628909 10:17289336-17289358 CCCTGCCACCTAATTTTTTGAGG + Intergenic
1064661538 10:17612763-17612785 CACGCCCGGCTAATTTTTTTTGG - Intronic
1064759324 10:18602217-18602239 CACACCCAGCTAATTTTTGTGGG + Intronic
1064916986 10:20469593-20469615 CACGTACATCCACTTTTTTGAGG - Intergenic
1065069529 10:22008180-22008202 CATGCCCAGCTAATTTTTTTTGG - Intergenic
1065374226 10:25020608-25020630 CACACCCAGCTAATTTTTGTAGG - Intronic
1065545485 10:26815752-26815774 CATACCCAGCTAATTTTTTTGGG - Intronic
1065559571 10:26948836-26948858 CACGCCCAGCTAATTTTTTTGGG - Intergenic
1065567842 10:27032916-27032938 CACACCTGGCTAATTTTTTGTGG - Intronic
1065791107 10:29261840-29261862 CACACCCAGCTAATTTGATGAGG + Intergenic
1065798050 10:29325006-29325028 CATGCCTAGCTAATTTTTTTTGG - Intergenic
1066207945 10:33208215-33208237 CACGCCGAGCTAATTTTTTGTGG + Intronic
1066236608 10:33490966-33490988 CACTCCCGGCTAATTTTTTATGG - Intergenic
1066251873 10:33641105-33641127 CGAGCCCGGCTAATTTTTTGGGG - Intergenic
1066373807 10:34839454-34839476 CATGCCTAGTTAATTTTTTGTGG + Intergenic
1067379337 10:45758762-45758784 CATGCCCGGCTAATTTTTTGTGG + Intronic
1067887037 10:50099424-50099446 CATGCCCGGCTAATTTTTTGTGG + Intronic
1068071046 10:52196167-52196189 CACGCCTGGCTAATTTTTTTTGG + Intronic
1070431499 10:76343972-76343994 CACGCCTGGCTAATTTTTTTTGG + Intronic
1070620406 10:78005320-78005342 CATGCCCGGCTAATTTTTTAAGG - Intronic
1071331851 10:84568428-84568450 CTGGCCCATCTATTTTTTTGAGG + Intergenic
1071341605 10:84653851-84653873 CACGCCCAGCTAATATTTTGTGG + Intergenic
1071948629 10:90677405-90677427 CATGCCTGGCTAATTTTTTGTGG + Intergenic
1072070497 10:91910561-91910583 AACACCCAGCTAATTTTTAGTGG + Intergenic
1072115077 10:92363021-92363043 CATGTCCAGCTAATTTTTTTTGG - Intergenic
1072153719 10:92704712-92704734 CATGCCTAGCTAATTTTTAGGGG - Intergenic
1072162852 10:92784471-92784493 CATGCCCAACTAATTTTTGTGGG + Intergenic
1072315779 10:94201630-94201652 CAAGCCCGGCTAATTTTTTTTGG + Intronic
1072387476 10:94946056-94946078 CACGCCCATGTATGTTTATGTGG + Intronic
1072575776 10:96699025-96699047 CACGCCTGGCTAATTTTGTGGGG - Intronic
1073010448 10:100355085-100355107 CATGCCTGGCTAATTTTTTGTGG + Intronic
1073252649 10:102130889-102130911 CATGCCCAGCTAATTTTTTGGGG - Intergenic
1074770094 10:116727912-116727934 CATGCCCGACTAATTTTTTTGGG + Intronic
1075878935 10:125832963-125832985 CATACCCGGCTAATTTTTTGTGG - Intronic
1076042706 10:127264815-127264837 CGTGCCCAGCTAATTTTTTGTGG + Intronic
1076456079 10:130597681-130597703 CGCGCCCGGCTAATTTTTTTTGG + Intergenic
1078184269 11:9038483-9038505 CACGCTCAGCTAACTTTTTAAGG - Intronic
1079051460 11:17164193-17164215 CACACCCAGCTAATTTTTTTGGG - Intronic
1079596270 11:22251871-22251893 CACGCCTGGCTAATTTTTTTTGG - Intronic
1080191882 11:29560267-29560289 CACGCCCAGCTACTTTTTTGGGG - Intergenic
1080536905 11:33230706-33230728 CACGCCCGGCTAATTTTCTTGGG + Intergenic
1080725371 11:34894490-34894512 CACGCCTGGCTAATTTTTTCTGG - Intronic
1081116094 11:39203395-39203417 CATGCCCAGCTAATTTTTAGTGG - Intergenic
1081162249 11:39763656-39763678 CACGCCCGGCTTATTTTTTTTGG - Intergenic
1081163725 11:39784391-39784413 CACGCCCTGCTAATTTTTTTTGG + Intergenic
1081443632 11:43107981-43108003 CACGCCCGGCTAATTTTTTTTGG + Intergenic
1081486671 11:43536036-43536058 CACGTCCAGCTAATTTTTTTTGG + Intergenic
1083791046 11:64986130-64986152 CACTCCCATCTATTTGTTTGAGG + Intergenic
1083825235 11:65198814-65198836 CATGCCCAGATAATTTTTTTTGG + Intronic
1083907224 11:65680975-65680997 CATGCCCAGCTAATTTTTTTTGG + Intergenic
1083916869 11:65752066-65752088 CATACCCAGCTAATTTTTTTTGG + Intergenic
1083942461 11:65903841-65903863 TACGCCCAGCTAATTTTTTTTGG + Intergenic
1084167379 11:67381989-67382011 CATGCCTGGCTAATTTTTTGGGG - Intronic
1084318907 11:68362532-68362554 CACACCCAGCTAATTTTTGGGGG - Intronic
1084365805 11:68697392-68697414 CACGCCTGGCTAATTTTTTGTGG + Intergenic
1084777303 11:71385982-71386004 CATGCCCGGCTAATTTTTTTTGG - Intergenic
1084842965 11:71872569-71872591 CACGCCCAGCTATTTTTTTTTGG - Intronic
1085288116 11:75377375-75377397 CATGCCCAGCTAATTTTTTTTGG - Intergenic
1085927909 11:81044046-81044068 CACGCCCGGCTAATTTTTTTTGG - Intergenic
1086083585 11:82931506-82931528 CATGCCCAGCTAATTTTTGTGGG + Intronic
1087717205 11:101622117-101622139 CATGCCCAGATAATTTTTTTTGG - Intronic
1087818726 11:102687869-102687891 CACGCCTGGCTAATTTTTTGTGG + Intergenic
1088467946 11:110161975-110161997 TATGCCCAGCTAATTTTTTTTGG - Intronic
1089028403 11:115296105-115296127 CATGCCCAGCTAATATTTTTTGG + Intronic
1089193640 11:116677241-116677263 CACACCCAGCTAAATTTTTTTGG - Intergenic
1089514134 11:119020860-119020882 CACACCCAGCTAATTTTTTGTGG + Intronic
1090798167 11:130153335-130153357 CACGCCCAGCTAACTTTTTGGGG - Intergenic
1090819350 11:130327098-130327120 CATGCCCAGCCAATTTATTGTGG + Intergenic
1091079011 11:132648656-132648678 CATGCCCAGCTAATTTTTTCTGG + Intronic
1092492021 12:8954059-8954081 CATGTCCATATGATTTTTTGAGG + Intronic
1093406327 12:18809492-18809514 CACGCCCGGCTAATTTTTTGTGG + Intergenic
1094106691 12:26819912-26819934 CATGCCCAGCTAATTTTTTTGGG - Intronic
1094538750 12:31345307-31345329 CACGCCCAGCTAATTTTTCTGGG + Intergenic
1094644948 12:32313822-32313844 CGTGCCCAGCTAATTTTTTCTGG - Intronic
1095207086 12:39450663-39450685 CATGCCCAGCTAATTTTTTAAGG + Intergenic
1095456908 12:42396881-42396903 CATGCCCAGCTAATTTTTTGTGG - Intronic
1096246989 12:49996478-49996500 CATGCCCGGCTAATTTTTTTTGG - Intronic
1096315321 12:50559574-50559596 CACACCTGGCTAATTTTTTGTGG - Intronic
1096467792 12:51856968-51856990 CACGCTCAACTAATTTTTGTAGG + Intergenic
1097099826 12:56579474-56579496 CACACCCGGCTAATTTTTTTTGG - Intronic
1098044083 12:66382080-66382102 CATGCCCAGCTAATTTTGAGGGG - Intronic
1098414785 12:70220542-70220564 CATGCCCAGCTAATTTTTGTTGG + Intergenic
1098543951 12:71690304-71690326 CATGCCCAGCTAATTTTTTCTGG + Intronic
1100069474 12:90694548-90694570 CATGCCCGGCTAATTTTTTTTGG + Intergenic
1100315232 12:93439319-93439341 CACACCCAGCTAATTTTTGTAGG - Intronic
1100534351 12:95492719-95492741 AACGCCCAGCTAATTTTTTTTGG + Intronic
1100551843 12:95653297-95653319 CACACCCAGCTAATTTTTTGTGG + Intergenic
1100662023 12:96709875-96709897 CACGCCCAGCTAATTTTTTGTGG + Intronic
1101844737 12:108353774-108353796 CATGCCCAGTTAATTTTTTATGG + Intergenic
1101905496 12:108822180-108822202 CACAGCCAGCTAGTTTTTTGTGG - Intronic
1102118429 12:110421359-110421381 CACGCCTGGCTAATTTTTTTTGG + Intergenic
1102286115 12:111658093-111658115 CACGCCCAGCTAATTTTAGTAGG + Intronic
1102718333 12:114994386-114994408 CCCTCCCATCTCACTTTTTGGGG + Intergenic
1103501271 12:121404541-121404563 CACACCCAGCTAATTTTTTTTGG + Intronic
1103774403 12:123355624-123355646 TGCACCCAGCTAATTTTTTGAGG - Intronic
1103865812 12:124051166-124051188 CACGCCCAGCCAATTTTTGTGGG - Intronic
1104913677 12:132252724-132252746 CACGCCTGGCTAATTTTTTTTGG - Intronic
1105009974 12:132749150-132749172 CACGCCCAGCTGATTTTTTTGGG + Intronic
1105438596 13:20397771-20397793 CATGCCCGGCTAATTTTTTTTGG - Intergenic
1105464049 13:20620720-20620742 CACGCCTGGCTAATTTTTTGTGG + Intronic
1106151945 13:27113076-27113098 CATGCTCAGCTAATTTTTTAAGG - Intronic
1107484127 13:40810313-40810335 CATGTCCAGCTAATTTTTTTTGG + Intergenic
1108734741 13:53270935-53270957 TACTTCCTTCTAATTTTTTGGGG + Intergenic
1109408854 13:61938181-61938203 CATGCCCAGCTAATTTTTGGGGG + Intergenic
1111024942 13:82508984-82509006 CACACCTGGCTAATTTTTTGTGG - Intergenic
1111453754 13:88453078-88453100 CACACCCGGCTAATTTTTTTTGG + Intergenic
1112011257 13:95295663-95295685 GACACCTAGCTAATTTTTTGAGG - Intronic
1112287672 13:98118441-98118463 CAAGCCCAGCTAATTTTTAGTGG + Intergenic
1112522130 13:100105683-100105705 CACACCCAGCTAATTTTTGTGGG - Intronic
1112748163 13:102551583-102551605 CAAGCCCGGCTAATTTTTTTTGG - Intergenic
1113566292 13:111321635-111321657 CACGCCCATCCGATTTTCTTGGG - Intronic
1113840726 13:113359426-113359448 CATGCCCAGCTAATTTTTAAGGG - Intronic
1114038672 14:18655376-18655398 CACGCCCCACTAATTTTTGTAGG + Intergenic
1114119945 14:19659671-19659693 CACGCCCCACTAATTTTTGTAGG - Intergenic
1114334298 14:21672015-21672037 CACTCTCATCTGAATTTTTGTGG + Intergenic
1114541469 14:23463285-23463307 CACGCCCAACTAATTTTTGTGGG - Intergenic
1115231286 14:31163444-31163466 CACGCCCAGCTAATTCTTTGGGG - Intronic
1115816612 14:37170791-37170813 CATGCCCGGCTAGTTTTTTGGGG - Intronic
1116458884 14:45147904-45147926 CACGCCCGGCTTTTTTTTTGGGG - Intronic
1116742227 14:48770954-48770976 CATGCCCAGCTAATTTTTGTAGG - Intergenic
1116989677 14:51262162-51262184 CATGCCCAGCTAAATTTTGGGGG + Intergenic
1117151481 14:52892609-52892631 CACGTCCAGCTAATTTTTTTTGG + Intronic
1117362956 14:54996441-54996463 CATGCCTGGCTAATTTTTTGTGG - Intronic
1117421627 14:55552245-55552267 CACGCCCGGCTAACTTTTTGTGG + Intergenic
1117682257 14:58216279-58216301 CACACCCAGCTAATTTTTGGGGG + Intronic
1118123464 14:62872534-62872556 CACGCCCAGCTAATTTTTTTTGG - Intronic
1118387263 14:65266230-65266252 CATGCCCGGCTAATTTTTTTTGG - Intergenic
1118432094 14:65729180-65729202 CATGCCCAGCTAATTTTTTATGG + Intronic
1118574683 14:67230413-67230435 CATACCCAGCTTATTTTTTGTGG - Intergenic
1119452048 14:74719983-74720005 CACGCCCGGCTAATTTTTTTTGG - Intronic
1120167527 14:81217633-81217655 CACTCCTGGCTAATTTTTTGTGG - Intronic
1120416608 14:84226811-84226833 CAAGCTCATCTAATTTTATGTGG - Intergenic
1121202278 14:92128324-92128346 CACGCCCAGCTAATTCTTTTTGG - Intronic
1123714886 15:23020427-23020449 CATGCCCGGCTAATTTTTTGGGG - Intronic
1124108596 15:26764971-26764993 CACACCCAGCTAACTTTTTGTGG - Intronic
1124158079 15:27245714-27245736 CATGCCCAGCTAATTTTTTGTGG - Intronic
1124407864 15:29407820-29407842 CACACCCCACTAATTTTTTGGGG + Intronic
1124477733 15:30049507-30049529 CACACCCAGCAAATTTTTTTTGG + Intergenic
1125159991 15:36631985-36632007 CACGCCCAGCTAGCTTTTTAAGG + Intronic
1125624272 15:41093689-41093711 CACGTTCAACTAATTTTTGGGGG - Intronic
1125653155 15:41333733-41333755 CACGCCCGGCTAATTTTTTAAGG - Intronic
1127656545 15:61061194-61061216 CATGCCCGGCTAATGTTTTGTGG - Intronic
1127696011 15:61448571-61448593 CATGCCCAACTAATTTTTGTAGG + Intergenic
1128058100 15:64715650-64715672 CACGCCTGGCTAATTTTTGGTGG - Intergenic
1128064799 15:64757817-64757839 CACGCCTGGCTGATTTTTTGTGG - Intronic
1129083257 15:73060801-73060823 CATGCCCAGCTAATTTTTTTGGG + Intronic
1129281052 15:74485294-74485316 CACGCCCAGCTAGGTTTTTTTGG + Intergenic
1130138956 15:81207077-81207099 CACGCCTGGCTAATTTTTTGTGG - Intronic
1131104604 15:89724043-89724065 CACGCCCAGCTATTTTTTTTTGG - Intronic
1132173516 15:99688598-99688620 CACGCCCGGCTAATTTTTTGTGG - Intronic
1132361480 15:101219921-101219943 CACGCCCGGCTAATTTTGTGAGG + Intronic
1132824186 16:1894927-1894949 CACGCCCAGCTAATTGTTTTTGG + Intergenic
1132827099 16:1910566-1910588 CATGCCCAGCTAATTTTTTTTGG - Intergenic
1133093965 16:3428221-3428243 CATGCCCAGCTAATTTTGTGGGG - Intronic
1133122983 16:3623050-3623072 CATGCCCAGCTAATTTTTTTGGG - Intronic
1133157793 16:3887978-3888000 CATGCCCAGCTAATTTTTTTTGG + Intergenic
1134087522 16:11368309-11368331 GACACCCAGCTAATTTTTTTTGG + Intronic
1134133282 16:11664103-11664125 CACGCCTAGCTAAATTTTTTTGG - Intergenic
1134396677 16:13871464-13871486 CACGCCCGGCTAATTTTTTTTGG - Intergenic
1134440595 16:14297514-14297536 CACGCCCGGCTAATTTTTTTTGG - Intergenic
1134491212 16:14696831-14696853 CATGCCCAGCTAATTTTTTGTGG - Intergenic
1134496593 16:14735949-14735971 CATGCCCAGCTAATTTTTTGTGG - Intronic
1135077000 16:19402381-19402403 CACGCATGGCTAATTTTTTGAGG + Intergenic
1135169952 16:20175025-20175047 CACGCCCAGCTAATTTGTGTAGG - Intergenic
1136129317 16:28209970-28209992 CATGCCTGGCTAATTTTTTGTGG - Intronic
1136353265 16:29726116-29726138 CACGCCCAGCCTATATTTTGAGG + Intergenic
1136430016 16:30191608-30191630 CATGCCCAGCTAATTTTTGGGGG - Intergenic
1137246758 16:46712145-46712167 AATGCCCAACTAATTTTTTTTGG + Intronic
1137416125 16:48282252-48282274 CATGCCCAGCTAATTTTTGTGGG - Intronic
1137998602 16:53248680-53248702 CACACCCAGCTAATTTATTTTGG + Intronic
1138199284 16:55077179-55077201 CAAGCCCATCTGCTTCTTTGGGG - Intergenic
1139508890 16:67415300-67415322 CACGCTCAGCTAATTTTTTAAGG - Intronic
1139519628 16:67473503-67473525 TACGCCCAACTAATTTTTTGTGG + Intronic
1139571739 16:67817120-67817142 CACACCTGGCTAATTTTTTGCGG + Intronic
1139575496 16:67839401-67839423 CACACCCAGCTAATTTTTTTTGG - Intronic
1139626493 16:68193510-68193532 CACACCCAGCTAATTTTTGTAGG - Intronic
1139697684 16:68686809-68686831 CACACCCAGCTTATTTTTTTTGG - Intronic
1139735004 16:68979998-68980020 CATGCCCGGCTAATTTTTTTTGG + Intronic
1139806710 16:69571914-69571936 CACGCCCGGCTAATTTTTTTTGG + Intronic
1139821448 16:69724543-69724565 CACACCCAGCTAATTTTTTTTGG - Intronic
1139823637 16:69740095-69740117 CATGCCCATCAAATTTTATTTGG - Intergenic
1140007251 16:71090654-71090676 CACACCCAACTAATTTTTGTGGG + Intronic
1140047362 16:71450560-71450582 CACACCCGGCTAATTTTTTGTGG - Intronic
1140217260 16:73018448-73018470 AATGCCCAGGTAATTTTTTGTGG - Intronic
1140816528 16:78626285-78626307 CACGCTCAGCTAATTTTTGCAGG + Intronic
1140879772 16:79187569-79187591 CACGCCCAGCTGATTTTTAGTGG + Intronic
1140913141 16:79471518-79471540 CATGCCCAACTAATTTTTGTGGG - Intergenic
1141106389 16:81237219-81237241 CATGCCCAGCTAATTTTTTTTGG + Intergenic
1141417729 16:83889514-83889536 CATGCCCAGCTAATTTTTATGGG + Intergenic
1141542513 16:84736943-84736965 CTCGCCCGGCTAATTTTTTGTGG + Intronic
1142536236 17:619086-619108 CACGCCCAGCTAATATTTCCCGG + Intronic
1142736356 17:1902669-1902691 CACGCCCAGCTGATTTTTTGGGG + Intergenic
1142905424 17:3038080-3038102 CCTGCCCAGCTAATTTTTTAGGG - Intergenic
1143819451 17:9547945-9547967 CACACCCAGCTAATTTTTGTGGG + Intronic
1144130032 17:12238024-12238046 CACGCCCAGCTAATTTTTGGGGG - Intergenic
1144526397 17:15994103-15994125 CATGCCCAGCTAATTTTTTTTGG + Intronic
1145237550 17:21219461-21219483 CATGCCCAGCTAACTTTTTTTGG - Intergenic
1145873263 17:28294321-28294343 CATGCCCAACTAATTTTGGGGGG + Intergenic
1145952298 17:28828410-28828432 CATGCCTGGCTAATTTTTTGTGG - Intronic
1146206502 17:30909483-30909505 TATGCCCAGCTAATTTTTTTTGG - Intronic
1146407035 17:32547791-32547813 CACGCCCGGCTAATTTTTGTAGG - Intronic
1146999393 17:37350361-37350383 CACACCCAGCTAATTTTTTCTGG - Intronic
1147499465 17:40948848-40948870 CATGCCCAGCTAATTTTTGTGGG - Intergenic
1147520061 17:41162426-41162448 CATGCTCATCTAAATATTTGGGG + Intergenic
1147610701 17:41800414-41800436 CACACCTGGCTAATTTTTTGGGG - Intergenic
1147801679 17:43095423-43095445 CACACCCGGTTAATTTTTTGTGG - Intronic
1148004709 17:44417369-44417391 CACATCCAGCTAATTTTTGGGGG + Intronic
1148009184 17:44461845-44461867 CAAGCCCAACTAATTTTTGGGGG + Intronic
1148432841 17:47656389-47656411 CACACCCAGCTAACTTTTTTGGG - Intronic
1148511917 17:48178177-48178199 CAAACTCATCTTATTTTTTGAGG + Intronic
1148832273 17:50441325-50441347 CACACCCAGCTAAATTTTTTTGG + Intronic
1148910229 17:50938592-50938614 CACGCCTGGCTAATTTTTGGGGG + Intergenic
1149483079 17:57018962-57018984 CACGCCCGGCTAATATTTTGAGG + Intergenic
1149587703 17:57803890-57803912 CACGCCCAGCTAATTTTTTTGGG + Intergenic
1149674733 17:58449541-58449563 CACACCCAGCTAATTTTTGCAGG - Intronic
1149748010 17:59118107-59118129 AATGCCCAGCTAATTTTTTGTGG - Intronic
1149790770 17:59474917-59474939 CATGCCCAGCTAATTTTTCTGGG + Intergenic
1150093508 17:62351579-62351601 CACACCCAGCTAATTTTTGTGGG + Intergenic
1150349246 17:64430023-64430045 CACACCCAACTAATTTTTGTGGG + Intergenic
1150555676 17:66252095-66252117 CATGCCCAGCTAATTTTTGTAGG - Intronic
1150743006 17:67794763-67794785 CCCGCCCAGCTGATTTTTTTTGG - Intergenic
1150779441 17:68108808-68108830 GACTCCCAGCTAATTTTTTTGGG + Intergenic
1151088567 17:71409018-71409040 CACGCCCAGCTGATTTTCGGAGG - Intergenic
1151119918 17:71781467-71781489 CGCGCCCGGCTAATTTTTTTTGG - Intergenic
1151230433 17:72681097-72681119 CATGCCCAGGTAATTTTTTTGGG + Intronic
1151278915 17:73057105-73057127 CATGCCCAGTTAATTTTTTGTGG + Intronic
1151308305 17:73278124-73278146 CACGCCCAGCTAATTTTAAGCGG + Intergenic
1151447149 17:74174645-74174667 CACGCCCAGATGATTTTTTTTGG - Intergenic
1151731091 17:75911673-75911695 CACGCTCAGCTATTTTTTTGTGG + Intronic
1151735314 17:75936333-75936355 CAGGCCCAGCTAATTTTGGGGGG - Intronic
1152085970 17:78218757-78218779 CACGCCTGGCTAATTTTTTTTGG + Intronic
1152156967 17:78640767-78640789 CATGCCAAGCTAATTTTTTTTGG - Intergenic
1152607881 17:81302199-81302221 CACACCCGGCTAATTTTGTGGGG + Intergenic
1152764853 17:82130793-82130815 CACGCCCAGCTCCTTTTTTTTGG + Intronic
1153517403 18:5916948-5916970 CACGCCCAGCTATTTCTTTTTGG - Intergenic
1153638739 18:7136559-7136581 CACGCCCGGTTAATTTTTTTTGG + Intergenic
1153671838 18:7419180-7419202 CATGCCCAGCTAATTTCTTTTGG + Intergenic
1153763544 18:8354054-8354076 CACGCCCAGCTAATTTTTTGTGG - Intronic
1154118538 18:11633069-11633091 CAGGCCCAACTAATCTTTTTTGG + Intergenic
1154345676 18:13541917-13541939 CACACCCCACTAATTTTTTTGGG - Intronic
1155142357 18:23054755-23054777 CACGCCCAGCTAATTTTTATGGG + Intergenic
1155352483 18:24920070-24920092 CACACCCAGCTAATTTTGTGGGG - Intergenic
1155482835 18:26308095-26308117 CATGCCCAACTAATTTTGGGGGG - Intronic
1155574940 18:27234399-27234421 AACACCCAGCTAATTTTTTGTGG + Intergenic
1155647413 18:28095651-28095673 CATGCACAGCTAATTTTTAGTGG - Intronic
1156243352 18:35274170-35274192 CATGCCCAGCTAATTTTTGGGGG + Intronic
1156332290 18:36133874-36133896 CACGCCTTTCTAGTTTTTTAGGG + Intronic
1157931856 18:51832302-51832324 TACGCCCGGCTAATTTTTTGTGG - Intergenic
1158032904 18:52988793-52988815 CACACACATGTAATTTTTTGTGG + Intronic
1158525830 18:58212633-58212655 CATGCCTAGCCAATTTTTTGTGG + Intronic
1158579425 18:58668756-58668778 CACGCCTGGCTAATTTTTTTTGG + Intergenic
1158800941 18:60908016-60908038 CACGCCCGGCTAATTTTTTTTGG + Intergenic
1158970159 18:62658774-62658796 CACACCCAGCTAATTTTTTGAGG - Intergenic
1159191028 18:65042894-65042916 CACGTCCAGCTAATTTTTTGGGG + Intergenic
1159347425 18:67225249-67225271 CATGCCCAGCTAATTTTTGTGGG + Intergenic
1160152876 18:76408108-76408130 CAGCCTCATCTCATTTTTTGAGG - Intronic
1160204201 18:76820311-76820333 TATGCCTAGCTAATTTTTTGTGG - Intronic
1160456424 18:79005603-79005625 CACACCCTGCTAATTTTTTGGGG + Intergenic
1160882732 19:1329196-1329218 CATGCCCAGCTAATTTTTCTAGG - Intergenic
1160973022 19:1778253-1778275 CATGCCCATTTAATTTTTTAAGG + Exonic
1161272308 19:3396797-3396819 CACACCCAGCTAATTTTTGTAGG - Intronic
1161392266 19:4027714-4027736 CACGCCTGGGTAATTTTTTGTGG + Intronic
1161477541 19:4494759-4494781 CACGCCCAGCTAATTTTTTAAGG - Intronic
1161529370 19:4778064-4778086 CACGCCTGGCTAATTTTTTGGGG + Intergenic
1161742227 19:6028920-6028942 CACACCCACCTAATTTTTTTTGG - Intronic
1161758682 19:6154239-6154261 TACGCCTGGCTAATTTTTTGGGG - Intronic
1162460943 19:10813667-10813689 CATGCCCAGCTAATTTTTTTTGG - Intronic
1162648480 19:12067041-12067063 CACACCCAGCTAATTTTTTATGG - Intronic
1162653226 19:12107618-12107640 CATGCCCAGCTAATTTTTGTGGG - Intronic
1162662528 19:12181627-12181649 CACGCCCAGCTAATTTTTTTTGG + Intronic
1162839908 19:13348849-13348871 CACACCCAGCTAATTTTGGGGGG - Intronic
1163933710 19:20422998-20423020 CACACCCGGCTAATTTTGTGTGG - Intergenic
1164256016 19:23528909-23528931 CAAGCCCAGCTAATTTTTTTAGG - Intronic
1164275788 19:23716672-23716694 CACGCCCAGTTAATTTTTTGTGG - Intergenic
1164309666 19:24034646-24034668 GACGCCCAGCTAATTTTTGCGGG + Intronic
1165430962 19:35772460-35772482 CAGGCCCAGCTAATTTTTAGTGG - Intergenic
1166111657 19:40626694-40626716 CACCCCCATCTAATTTCTTCAGG + Intronic
1166358983 19:42244223-42244245 CACGCCCAGCTAATTTGGTTTGG + Intronic
1167434206 19:49469729-49469751 CATGCCCAGCTAATTGTTGGGGG + Intronic
1167750571 19:51377185-51377207 CACTCCCAGCTAATTTTTTGGGG - Intergenic
1167915529 19:52736899-52736921 CACGCCTGGCTAATTTTTTTGGG + Intergenic
1167947428 19:52999984-53000006 CACATCCAGCTAATTTTTAGTGG - Intergenic
1167951378 19:53030452-53030474 CACGCCCAGCTAACTTTTGTGGG - Intergenic
1168045412 19:53790767-53790789 CATGCCCAGCTAATTTTTTTTGG + Intergenic
1168223049 19:54974954-54974976 CAGGCCCGGCTAATTTTTTGTGG + Intronic
1168260796 19:55193272-55193294 CATGCCCAGCTATTTTGTTGGGG - Intronic
1168419859 19:56194443-56194465 CACGCCCGGCTAATTTTTATAGG + Intronic
1168428162 19:56256347-56256369 CACACCCGGCTAATCTTTTGTGG + Intronic
1168624067 19:57902815-57902837 CATGCCCGGCTAATTTTTTGTGG + Intronic
926180252 2:10636449-10636471 CACACCCAGCTAATTTTGTTTGG - Intronic
926725521 2:15994495-15994517 CAAGCCCGGCTAATTTTGTGGGG + Intergenic
927034177 2:19155801-19155823 CAGGCCCAGCTAATTTTTCTAGG - Intergenic
927541396 2:23914683-23914705 CTCGCCCGGCTAATTTTTTTTGG - Intronic
927724197 2:25408380-25408402 CACACCCAACTAATTTTTGTTGG - Intronic
927733959 2:25501534-25501556 CATGCCCAGCTAATTTTTGTTGG + Intronic
928508875 2:31983102-31983124 CACACCCAGCTAATTTTTGTGGG - Intronic
928966749 2:36983569-36983591 CACACCCAGCTAATATTTTTGGG - Intronic
928989174 2:37213566-37213588 CATGCCCAGCTCATTTTTTGGGG + Intronic
929126692 2:38529143-38529165 CACACCCAGCAAATTTTTTTTGG + Intergenic
929231531 2:39565361-39565383 CAGGCTCATCTAGTTTTCTGGGG - Intergenic
929475680 2:42245249-42245271 CATGCCTGGCTAATTTTTTGTGG + Intronic
931270006 2:60693275-60693297 CACGCCCGGCTAATTTTTTTTGG - Intergenic
931329665 2:61267597-61267619 TACACCCAGCTAATTTTTTGTGG + Intronic
931672889 2:64664823-64664845 CATGCCCAGCTAATTTTTATGGG + Intronic
932686082 2:73871389-73871411 CACGCCTGGCTAATTTTTTTTGG - Intronic
933119936 2:78523835-78523857 CATGCCAAGCTAATTTTTTTGGG - Intergenic
933169994 2:79114527-79114549 CATGCCCAGCTAATTTTTGACGG + Intergenic
933205931 2:79507915-79507937 CACGCCAATACAATTTATTGTGG + Intronic
933712831 2:85340181-85340203 CATGCCCAGCTAATTTTTCTGGG + Intergenic
934866065 2:97812845-97812867 CATGCCCAGCTAATTTTGGGGGG - Intronic
935029527 2:99308866-99308888 CACGCCTGGCTAATTTTTAGTGG + Intronic
935159195 2:100514589-100514611 CATGCCTAGCTAATTTTTTGGGG + Intergenic
935632839 2:105226074-105226096 CACACCCAGCTAATTTTTGTGGG - Intergenic
935858624 2:107302659-107302681 CACACCCAGCTAATTTTTTTTGG - Intergenic
935969436 2:108516099-108516121 CACGCCCGTCTAATTTTTTTGGG + Intergenic
936843233 2:116799594-116799616 CAGGTTCAGCTAATTTTTTGTGG + Intergenic
937108012 2:119337209-119337231 CATGCCCAGCTAGTTTTTTGGGG + Intronic
937386687 2:121440533-121440555 CATGCCCTGCTAATTTTTTGTGG - Intronic
937650355 2:124312519-124312541 CACACCCAACTAATTTTTGTGGG + Intronic
937972630 2:127562451-127562473 CACGCCCAGCTAATTTTTGTGGG + Intronic
938272289 2:129983720-129983742 CACGCCCAGCTAATTTTTGTAGG - Intergenic
938909255 2:135870902-135870924 CATGCCCAGCTAATTTTTGTGGG + Intronic
940769454 2:157824908-157824930 CACGCCTGGCTAATTTTTGGTGG + Intronic
940882728 2:158962638-158962660 CACGCCCAGCTAATTTTTATTGG - Intergenic
942135527 2:172921251-172921273 CATGCCCAGCTAGTTTTTTGTGG + Intronic
942234966 2:173895137-173895159 CATGCCCAGCTAATTTCTTGGGG + Intergenic
942345438 2:174997841-174997863 CACACCCAGCTAATTTTTGTTGG - Intronic
942647410 2:178128160-178128182 CATGCCCAGGTAATTTTTTTTGG + Intronic
942977648 2:182038192-182038214 CATGACCAGCTAATGTTTTGTGG + Intronic
943989879 2:194674590-194674612 CTAGCCCATTTAATATTTTGTGG - Intergenic
944626858 2:201579395-201579417 CATGCCTGGCTAATTTTTTGTGG + Intronic
944742237 2:202623843-202623865 CATGCCCGGCTAATTTTTAGTGG - Intergenic
944831763 2:203540135-203540157 CACGCCTGGCTAATTTTTTGTGG + Intergenic
945266782 2:207898599-207898621 CATGCCCAGCTAATTTTTGTGGG - Intronic
945285848 2:208080637-208080659 CACACCTGGCTAATTTTTTGTGG - Intergenic
945949014 2:216021302-216021324 CACACCCAGCTAATATTTTGGGG + Intronic
945958408 2:216107470-216107492 CAAGCCCAGCTAATTTTTGTGGG - Exonic
946288575 2:218725374-218725396 CATGCCTAGCTAATTTTTTATGG + Intronic
946288706 2:218726620-218726642 CACATCCAGCTAATTTTTTCTGG + Intronic
946301263 2:218825489-218825511 CACGCCCAGCTAATTTTTGGGGG - Intronic
946854637 2:223940797-223940819 CATGCCCAGCTAATTTTTGTGGG + Intronic
946906609 2:224422846-224422868 CATGCCCAGCTAATTTTTTGGGG - Intergenic
947080042 2:226385976-226385998 CATTCACATCTAATTTCTTGTGG + Intergenic
947881342 2:233516529-233516551 CAGGCCCGGCTAATTTTTAGTGG - Intronic
948436865 2:237959728-237959750 TGCGCCCAGCTAATTTTTTGTGG - Intergenic
948438631 2:237970863-237970885 CATGCCGAGCTAATTTTTTTTGG + Intronic
948900109 2:240952188-240952210 CATGCCCGGCTAATTTTTTGTGG - Intronic
1168862247 20:1053952-1053974 CACGCCCAGCTAATTTTGTATGG - Intergenic
1168969383 20:1920312-1920334 CACACCCATCAAACATTTTGAGG - Intronic
1169071400 20:2734250-2734272 CATGCCCAGCTAATTTTTGTAGG - Intronic
1169076705 20:2764443-2764465 CACACCCAGCTAATTTTTTAGGG + Intergenic
1169338528 20:4777222-4777244 CATGCCCAGCTAATTTTGGGGGG + Intergenic
1169396301 20:5233030-5233052 CACACCCAGCTTATTTTTTTTGG - Intergenic
1169489196 20:6056887-6056909 CACGCCTGGCTAATTTTTAGGGG + Intergenic
1169611329 20:7383326-7383348 CACTCCCATCTTACTTTTAGTGG + Intergenic
1169674364 20:8136649-8136671 CACGTCCATCTTATTTTTGAGGG - Intronic
1170048256 20:12110885-12110907 GACTACCATCTATTTTTTTGAGG + Intergenic
1170983575 20:21237984-21238006 CATGCCTGGCTAATTTTTTGTGG + Intronic
1172180711 20:33001823-33001845 CACGCCCGGCTAATTTTTGTGGG + Intronic
1172248147 20:33460227-33460249 CATGCCCGGCTAATTTTTTTTGG - Intergenic
1172373324 20:34414621-34414643 CACGCCCAGCTAATTTTGTGGGG + Intronic
1172406791 20:34695759-34695781 CACGACCTGCTAATTTTTTTTGG - Intergenic
1172609946 20:36243012-36243034 CACGCCCAGCTAATTATTTTTGG + Intronic
1172710793 20:36921678-36921700 CACACCCAGCTAATTTTTTGTGG + Intronic
1173203557 20:40972417-40972439 CATGCCCAGCTTATTTTTTAAGG + Intergenic
1173482983 20:43417502-43417524 CATGCCCAGCTAATTTTTGCTGG + Intergenic
1173516925 20:43671123-43671145 CATGCCCAGCTAATTTTTGTGGG + Intronic
1173614647 20:44394825-44394847 CATGCCCAGTTAATTTTTTAAGG + Intronic
1173679778 20:44869861-44869883 AAGGCCCAGCTAATTTTTTGTGG - Intergenic
1173781183 20:45758733-45758755 CAAGCCCAGCTAATTTTTGTGGG + Intronic
1174009753 20:47440012-47440034 CACGCCCAGTTAATTTTGTATGG - Intergenic
1174009987 20:47442003-47442025 CATGCCCAGCTAACTTTTTTAGG + Intergenic
1174214266 20:48904079-48904101 CATGCCCAACTAATTTTTTTTGG - Intergenic
1174486981 20:50867501-50867523 CATGCCCAGCTAATTTTTTTGGG + Intronic
1174596162 20:51685403-51685425 CACGCCCAGCTAACTTTTTTTGG - Intronic
1174641365 20:52047282-52047304 CATGCCCAGCTAATTTTTGGTGG + Intergenic
1174841895 20:53908914-53908936 CATGCCCAGCATATTTTTTGTGG - Intergenic
1175058099 20:56216509-56216531 CATGCCCAGCTAATTGTTTGGGG - Intergenic
1176068117 20:63210629-63210651 CACGCCTGGCTAATTTTTTTTGG - Intronic
1176519560 21:7814363-7814385 CATGCCCAGGTAATTTTTTCTGG - Intergenic
1176921499 21:14692965-14692987 CACGTCTGGCTAATTTTTTGTGG + Intergenic
1177965105 21:27718006-27718028 CACGCCCGACTAATTTTTTTTGG + Intergenic
1178362798 21:31963651-31963673 CATGCCCAGCTAATTTTTTTTGG + Intronic
1178418150 21:32420540-32420562 CAGGCCTAGCTAATTTTTTTTGG + Intronic
1178568637 21:33713394-33713416 CACGCCTGGCTAATTTTTTTTGG + Intronic
1178653588 21:34444376-34444398 CATGCCCAGGTAATTTTTTCTGG - Intergenic
1179154692 21:38839672-38839694 AAGGCCCCTCTAATTTATTGTGG + Intergenic
1179788452 21:43742334-43742356 CATGCCCAGCTAACTTTTTGTGG + Intronic
1180462801 22:15582414-15582436 CACGCCCCACTAATTTTTGTAGG + Intergenic
1180687116 22:17677887-17677909 CATGCCCAGCTAATTTTTGTGGG - Intronic
1181080199 22:20409089-20409111 CACGCCCAGCTAAATTTTTGGGG + Intergenic
1181309369 22:21936014-21936036 CACACACAGCTAATTTTTTTTGG - Intronic
1181347750 22:22232444-22232466 CATGCCCAGCTAACTTTTTGTGG - Intergenic
1181806428 22:25377214-25377236 TATGCCCAGCTAATTTTTGGTGG + Intronic
1182386974 22:29952043-29952065 CACGCCCAGCTAATTTTTGTGGG + Intronic
1182427355 22:30281743-30281765 CATGCCCAGCTAATTATTTTTGG + Intergenic
1182634891 22:31718226-31718248 CCCGCCCAGCTAATTTTTTGGGG + Intronic
1182760221 22:32716685-32716707 CATACCCGGCTAATTTTTTGTGG + Intronic
1183132681 22:35854428-35854450 CATACCCAGCTAATTTTTTTGGG - Intronic
1183813218 22:40275800-40275822 CACACCCAGCTAATTTTTGTAGG - Intronic
1183861236 22:40671779-40671801 CACGCCTGGCAAATTTTTTGTGG + Intergenic
1184706264 22:46215583-46215605 CACGCCTGGCTAATTTTTTTTGG - Intronic
949695649 3:6691981-6692003 CACGCTCAGCTTATTTTATGAGG + Intergenic
950971890 3:17197531-17197553 CAAGCCCAGCTAATTTTTTTTGG + Intronic
951333618 3:21394804-21394826 CACACCGAGCTAATTTTTTGTGG + Intergenic
951667822 3:25146659-25146681 CGCGCCCGGCTAATTTTTTGTGG + Intergenic
952315717 3:32230550-32230572 CATGTCCGGCTAATTTTTTGGGG + Intergenic
952456726 3:33479496-33479518 CACACCCAGCTAATTTTTTGAGG + Intergenic
953775241 3:45811061-45811083 CATGCCCAGCTAATTTTTACAGG - Intergenic
953801457 3:46027035-46027057 CACACCTAGCTAATTTTTTGGGG + Intronic
953865981 3:46583904-46583926 CATGCCCGGCTAACTTTTTGGGG + Intronic
953887909 3:46728196-46728218 CACGCCCGGTTAATTTTTTTGGG + Intronic
953973373 3:47364309-47364331 CAAGCCTGACTAATTTTTTGAGG + Intergenic
954065627 3:48103735-48103757 CGCGCCTGGCTAATTTTTTGTGG + Intergenic
954261163 3:49439911-49439933 CACGGCCAGCTAATTTTTGACGG + Intergenic
954669843 3:52284328-52284350 CATGCCTGGCTAATTTTTTGTGG - Intronic
954737093 3:52715541-52715563 CAGGCCCAGCTAATTTTTTTTGG + Intronic
954820050 3:53318146-53318168 CACTATCAGCTAATTTTTTGGGG - Intronic
954835842 3:53467224-53467246 CAGCCCCAGCTAATTTTTTATGG - Intergenic
954883846 3:53854958-53854980 CACGCCCGGCTAATTTTTTGTGG - Intronic
955244942 3:57216453-57216475 CAGGCCTGGCTAATTTTTTGTGG - Intronic
955672038 3:61412171-61412193 CATGCCCAGCTAATTTTTTTTGG - Intergenic
956289439 3:67646249-67646271 CACCCCCATCTTATTGTCTGTGG - Intronic
956462847 3:69488734-69488756 CATGCCCAGCTAATTTTTAGTGG - Intronic
957131528 3:76228853-76228875 CATGCCCCACTAATTTTTTAAGG - Intronic
957269500 3:78011234-78011256 TGCGCCCAGCTAATTTTTTTTGG + Intergenic
959538382 3:107512705-107512727 CACGCCCAGCCAATTTTTTTTGG - Intergenic
959748670 3:109807696-109807718 CACACCCAGCTAATTTTTTTTGG - Intergenic
960163185 3:114372686-114372708 CACAGCCAGCTAGTTTTTTGGGG - Intronic
960635181 3:119777900-119777922 CATGCCCAGCTATTTTTTTCTGG - Intergenic
960809598 3:121615046-121615068 CACACCCAGCAAACTTTTTGTGG - Intronic
960823217 3:121756495-121756517 CATGCCCAGCTAATTTTTGTGGG + Intergenic
960985168 3:123274378-123274400 CACGCCCAGCTTATTTTTTTTGG - Intergenic
961139011 3:124539902-124539924 CACACCAAGCTAATTTTTTTTGG + Intronic
961845881 3:129762623-129762645 CAAGCCCAGCTAATTTTTTTTGG - Intronic
962573596 3:136735767-136735789 CACGCCCAGCTAATTTTTTCTGG + Intronic
962578724 3:136778083-136778105 CATGCCCAGCTAATTTTTTGTGG - Intergenic
962607704 3:137046063-137046085 CATGCCCAGCTAATTTTTGCAGG - Intergenic
962771698 3:138616529-138616551 CACACCCAGCTAATTTTTTTTGG + Intronic
963302620 3:143616035-143616057 CACGCCCAGCTAATTTTTTTTGG + Intronic
963716097 3:148805538-148805560 CACGCCCGGCTAATTTTTTGTGG - Intronic
963894787 3:150673743-150673765 CACGCCCAGCTAACACTTTGTGG + Intronic
964038127 3:152223423-152223445 CACGCCTGGCTAATTTTTTTTGG + Intergenic
964148204 3:153491974-153491996 CACGCCCAGCCTAGTTTTTGAGG - Intronic
964341760 3:155715767-155715789 CATGCCCAGCTAATTTTTTGTGG + Intronic
964721575 3:159772308-159772330 CATGCCCAACTAACTTTTTAGGG + Intronic
966178484 3:177165931-177165953 CATGTCCAGCTAATTTTTTGTGG - Intronic
966408301 3:179622122-179622144 CATGCCCAACTAATTGTTTAGGG + Intronic
966547223 3:181163320-181163342 TACGCCCAGCTAATTTTTGGTGG - Intergenic
966716143 3:183014868-183014890 TACACCCAGCTTATTTTTTGTGG + Intergenic
967082978 3:186067453-186067475 CACGCCTGGCTAATTTTTTTAGG - Intronic
967148893 3:186630202-186630224 CACACCCAGCTAATTTTTGTGGG + Intergenic
967200893 3:187071602-187071624 CACGCCCGGCTAATTTTTTGGGG - Intronic
967960934 3:194923435-194923457 CATGACCAGCTAATTTTTTGTGG + Intergenic
968053146 3:195670008-195670030 CATGCCCAGCTAATTTTTGAGGG + Intergenic
968102667 3:195978353-195978375 CATGCCCAGCTAATTTTTGAGGG - Intergenic
968277230 3:197449634-197449656 CACGACCAGCTAATTTTTTATGG - Intergenic
968320934 3:197767619-197767641 TATGCCCAACTAATTTTTAGAGG + Intronic
968775996 4:2540488-2540510 CACGCCTGGCTAATTTTTTGGGG - Intronic
969071912 4:4546547-4546569 CATGCCCAGCTAATTTTTTGGGG + Intergenic
969365503 4:6691853-6691875 CACACCAGGCTAATTTTTTGGGG - Intergenic
970501857 4:16685893-16685915 CATGCCCAACTACTTTTTTTTGG - Intronic
970618483 4:17791585-17791607 CACACCCAGCTAATTTTTGTAGG - Intergenic
970774502 4:19656718-19656740 CATGCCCGGCTAATTTTTTTTGG - Intergenic
970885976 4:20987842-20987864 CACGCCCGGCTAATTTTTTTTGG - Intronic
971360746 4:25936349-25936371 CATGCCCAGCTAACTTTTTTTGG - Intergenic
971648379 4:29238133-29238155 CACGCCCAGCTAAGTTTTGTGGG - Intergenic
972334695 4:38097317-38097339 CATGCCTGGCTAATTTTTTGTGG + Intronic
972392007 4:38622648-38622670 CACACCTGGCTAATTTTTTGTGG + Intergenic
973991442 4:56412464-56412486 CATGCCTGGCTAATTTTTTGTGG + Intronic
974246455 4:59325861-59325883 CACGCCCGGCTAAGTTTTTCGGG + Intergenic
975464118 4:74689983-74690005 CAAGCCCAGCTAATTTATTTTGG + Intergenic
975473692 4:74797637-74797659 CACACCCAGCTAATTTTTTGTGG + Intergenic
975540052 4:75499982-75500004 CATGCCCAGCTAATTTTTTGTGG - Intronic
975701125 4:77067645-77067667 CAAGCCCAGGTAATTTTGTGGGG + Intronic
976630736 4:87233415-87233437 AACGCCCAGCTAATTTTTGTTGG - Intronic
976775536 4:88701957-88701979 CAGGCCTGGCTAATTTTTTGTGG + Intronic
976779973 4:88748044-88748066 CACGCCCGGCTAATTTTTTTTGG + Intronic
977196447 4:94067065-94067087 CATGCCCAGCTAATTTTTGTGGG + Intergenic
977833188 4:101617502-101617524 CACGCCAGGCTAATTTTTTTGGG + Intronic
978528157 4:109687200-109687222 CATGCCCACCTAATATTTTTTGG - Intronic
978595020 4:110368071-110368093 CACGCCCGGCTAATTCTTTTTGG + Intronic
980102684 4:128557411-128557433 CACACTCAGCTAATTTTTTCTGG + Intergenic
980516515 4:133869157-133869179 CACGTCCAGCTAATGTTTTGGGG - Intergenic
981183710 4:141776238-141776260 CAGGCCCATTTACTTATTTGAGG + Intergenic
981601334 4:146492061-146492083 CACGCCCAGCTAATTTTTTTTGG - Intronic
981998756 4:151002855-151002877 TACACCCAGCTAATTTTTTGGGG - Intronic
982716619 4:158815537-158815559 CACGCCCAGCTAATTTGACGGGG + Intronic
982754486 4:159202438-159202460 CATGGCCATCTAAGTTTTGGGGG - Intronic
983167473 4:164495950-164495972 CACTCCCGGCTAATTTTTTTTGG - Intergenic
983328073 4:166285888-166285910 CACCCGCAGCTAATTTTTTTGGG + Intergenic
983467668 4:168115041-168115063 CATGCCCAGCTAATTTTGTATGG + Intronic
983474543 4:168197616-168197638 CATGCCCAGCTAATTTTTTTTGG - Intergenic
984304691 4:177973462-177973484 CACGCCCGGTTAATTTTTTTTGG + Intronic
984329734 4:178299020-178299042 CATGCCCAGCTAATTTTTGTGGG - Intergenic
984769926 4:183428441-183428463 CATGCCCAGCTAATTTTTCTGGG - Intergenic
987592734 5:19952204-19952226 CACACCTGGCTAATTTTTTGTGG + Intronic
987649239 5:20719259-20719281 TATGCTCAGCTAATTTTTTGTGG + Intergenic
987939989 5:24521448-24521470 CATGCCCACCTAATTTTGTAAGG - Intronic
987985667 5:25142285-25142307 CACGCCCAGCTAATTTTTAGTGG + Intergenic
988654781 5:33197884-33197906 CATGCCCAGCTGATTTTGTGAGG - Intergenic
988746321 5:34142273-34142295 TATGCTCAGCTAATTTTTTGTGG - Intergenic
988921827 5:35949359-35949381 CACGCCTGGTTAATTTTTTGTGG + Intergenic
990169586 5:53033110-53033132 CACGCCCTGCTAATTTTTTATGG - Intronic
990817340 5:59800443-59800465 CAAGCCCATCTAAGTTTTAAGGG - Intronic
991481221 5:67082303-67082325 CACGCCCAGCTAATTTTTGTTGG + Intronic
992113127 5:73514789-73514811 CACACCCAGCTAATTTATTTTGG - Intergenic
992666786 5:79018202-79018224 CATGCCCGGCTAATTTTTTGTGG + Intronic
992740221 5:79766253-79766275 CAAGCCCCGCTAATTTTTTTGGG + Intronic
994433761 5:99702227-99702249 CATGCCCAGATAATTTTTTTTGG + Intergenic
995442568 5:112208087-112208109 CACTCCCAGCTAATTTTTGTAGG - Intronic
995680841 5:114717792-114717814 CAGGCCCAGCTACTTTTTTTTGG - Intergenic
996071919 5:119140738-119140760 CCTCCCCAACTAATTTTTTGAGG + Intronic
996638697 5:125727742-125727764 CATGCCCAGCAAATTTTTTGTGG + Intergenic
996664167 5:126038516-126038538 GATGCCCATCTAAATTGTTGAGG + Intergenic
996739881 5:126789050-126789072 CACGACTGGCTAATTTTTTGTGG + Intronic
997329015 5:133045655-133045677 CATGCCCAGCTAATTTTTTTGGG - Intergenic
997948823 5:138225545-138225567 CAAGCCCAGATAATTTTTTGAGG + Intergenic
997971020 5:138402083-138402105 CGTGCCCAGCTAATTTTTTTTGG + Intronic
998032202 5:138880300-138880322 CATGCCTGGCTAATTTTTTGTGG + Intronic
998087174 5:139336041-139336063 CATGCCCAGCTAATTTTTGTAGG + Intergenic
998508570 5:142692178-142692200 CACACCCAGCTAATTTTTGTGGG - Intronic
999061329 5:148638888-148638910 CACGCCCATCTAATTTTTTGTGG - Intronic
999682656 5:154074564-154074586 CACACCCAGCTAATTGTGTGGGG + Intronic
999754883 5:154656940-154656962 CACACCCAGCTAATTTTTTTTGG - Intergenic
999831100 5:155320998-155321020 CATGCCCAGCTAATTTTTTGTGG + Intergenic
1000092426 5:157941244-157941266 CACGCCCAGCTAATTTTTGTGGG + Intergenic
1000170101 5:158693987-158694009 CACGCCCAGCTAATTTTTTTTGG + Intergenic
1000310618 5:160040741-160040763 CACTCCCAGCTAATTTTGTTTGG + Intronic
1000311833 5:160052337-160052359 CATGCCTGACTAATTTTTTGTGG - Intronic
1000613768 5:163405469-163405491 CATGCCCACCTAATTATTTTTGG + Intergenic
1000896200 5:166858452-166858474 CAGGCCCAGCTATTTTTTTTGGG - Intergenic
1001598346 5:172912923-172912945 CATGCCCAGCTAATGTTTTGTGG + Intronic
1001962621 5:175889116-175889138 CACACTCAACTAATATTTTGGGG - Intergenic
1001978201 5:176018177-176018199 CACATCCAGCTAATTTTTAGGGG + Intronic
1002005663 5:176232088-176232110 CACGCCTGGCTAATTTTTTTTGG - Intergenic
1002015531 5:176318950-176318972 TAAGCCCAGCTAATTTTTTGTGG - Intronic
1002162737 5:177325630-177325652 CATGCCCAGCTAGTTTTTGGCGG - Intergenic
1002220717 5:177678533-177678555 CACGCCCGGCTAATTTTTTTTGG + Intergenic
1002239218 5:177825585-177825607 CACATCCAGCTAATTTTTAGGGG - Intergenic
1002392240 5:178924214-178924236 CATGCCCGGCTAATTTTTTGTGG - Intronic
1002592044 5:180297283-180297305 CACACCCGGCTAATTTTTTTTGG - Intergenic
1002678631 5:180940934-180940956 CAAGCCCAGCTAATTTTTATGGG - Intronic
1004313663 6:14567513-14567535 CACGCCCAGCTAATTTTTTTCGG - Intergenic
1004420759 6:15467677-15467699 CACACCCAGCTAATTTTTTGTGG - Intronic
1004896243 6:20150718-20150740 TACGCCCAGCTAATTTTTTTTGG + Intronic
1005432752 6:25775590-25775612 CATGCCTGGCTAATTTTTTGTGG + Intronic
1005544469 6:26850506-26850528 TACGCTCAGCTAATTTTTTGTGG - Intergenic
1006142543 6:31938952-31938974 CACACCTGGCTAATTTTTTGTGG + Intronic
1006956052 6:37873112-37873134 CGCGCCTGGCTAATTTTTTGGGG - Intronic
1007040404 6:38716113-38716135 CACGCCCGGCTAATTTTTTTTGG + Intronic
1007153950 6:39724294-39724316 CACGCCCGGTTAATTTTTTGTGG - Intronic
1007573396 6:42909428-42909450 CGTGCCCAGCTAATTTTTTTTGG + Intergenic
1007654227 6:43442571-43442593 CAAGCCCAGCTAAATTTTTTTGG - Intronic
1007760482 6:44130594-44130616 CATGCCCAGCTAAATTTTGGTGG + Intronic
1007883390 6:45193557-45193579 CATGCCCAGCTAATTTTTTGAGG - Intronic
1009004452 6:57765425-57765447 CACCCCCGGCTAATTTTTTTTGG - Intergenic
1009015257 6:57892134-57892156 TACGTTCAGCTAATTTTTTGTGG - Intergenic
1010041474 6:71389920-71389942 CATGCCTGGCTAATTTTTTGTGG - Intergenic
1010652031 6:78467123-78467145 CATGCCATTCTAATTTTTTGGGG - Intergenic
1011566133 6:88674381-88674403 CATGCCTGGCTAATTTTTTGTGG - Intronic
1011605077 6:89095367-89095389 CACGCCCGGCTAATTTTTTTTGG + Intergenic
1011741164 6:90362103-90362125 CACACCCAGCTAATTTTTTGGGG - Intergenic
1012358709 6:98349414-98349436 CACACCCGTCTAATTTTTTGTGG - Intergenic
1013209044 6:107970474-107970496 TACGCCTGGCTAATTTTTTGTGG + Intergenic
1013530395 6:111014287-111014309 CACACCTGGCTAATTTTTTGTGG + Intronic
1013855570 6:114567937-114567959 CACACCCATTTCCTTTTTTGAGG - Intergenic
1014189965 6:118484157-118484179 CACGCCCAGCTAATTTTTTTGGG - Intronic
1014737075 6:125105956-125105978 CAACCCCAACTAATTTTTTTAGG + Intergenic
1015064935 6:129013278-129013300 CACGCCGGGCTAATTTTTTTTGG - Intronic
1015069360 6:129071996-129072018 CACACCCAGCTAATTTGTTTTGG - Intronic
1015446471 6:133311480-133311502 CATGCCTGGCTAATTTTTTGTGG + Intronic
1015586544 6:134782433-134782455 CACACCCGGCTAATTTTTTTGGG - Intergenic
1015596008 6:134867755-134867777 CATGCCCGGCTAATTTTTGGAGG + Intergenic
1015958446 6:138622345-138622367 CACGCCCGGCTATTTTTTTTTGG - Intronic
1016318665 6:142818510-142818532 CACGCCTGGCTAATTTTTTGTGG - Intronic
1016917027 6:149253472-149253494 CACGCCCGGCTAATTTTTGATGG - Intronic
1016961993 6:149682566-149682588 CATGCCCAGCTAATTTTTTTTGG + Intronic
1017546085 6:155451779-155451801 CACGCCCAGCTAATATTTTTTGG + Intronic
1017804897 6:157936350-157936372 TACACCCAGCTAATTTTTGGGGG - Intronic
1017934445 6:158992434-158992456 CATGCCCAGCTAATTTTTGTGGG + Intronic
1018206278 6:161440105-161440127 CACGCCCGGCTAATTTTTTTTGG + Intronic
1019584492 7:1790483-1790505 CACGCCCAGCTCATTTTTTGGGG - Intergenic
1019744255 7:2690754-2690776 CAGGCCCATCTAAGTTATTCAGG - Intronic
1019794794 7:3041726-3041748 CACGCCGGGCTAATTTTTTGTGG + Intronic
1019991645 7:4695957-4695979 CACACCCAGCTAATTTTTGTGGG - Intronic
1020400316 7:7769596-7769618 CAGGCCAATCAAATTTATTGTGG + Intronic
1021684492 7:23170055-23170077 CACGCCCGGCTAATTTTTTTTGG - Intronic
1021729715 7:23584690-23584712 TACGCCCAACTAATTTTTTGGGG + Intergenic
1022408126 7:30111774-30111796 CACACCCAGCTAATTTTGTATGG + Intronic
1022682847 7:32566331-32566353 CACGCCCAGCTAATTTTTTGTGG + Intronic
1022705013 7:32793995-32794017 CATGCCTGGCTAATTTTTTGGGG + Intergenic
1022732603 7:33044183-33044205 CAAGCCCAGCTAATTTTGTATGG + Intronic
1022976859 7:35566681-35566703 CACACATATTTAATTTTTTGAGG - Intergenic
1024157819 7:46643333-46643355 CACACCCAGCTAATTTTTTGTGG + Intergenic
1024568054 7:50699980-50700002 CACGCCCGGCTAATTTTTTTTGG - Intronic
1024606143 7:51024150-51024172 CACGCCCGGCTAATTTTTTGTGG - Intronic
1024747701 7:52427395-52427417 CACGCCCAGCTAATTTTTGTTGG + Intergenic
1025004961 7:55346195-55346217 CACAGCCATCTGAATTTTTGAGG - Intergenic
1025114196 7:56243686-56243708 CACGCCTGGCTAATTTTTTTTGG - Intergenic
1025922788 7:65929254-65929276 CACACCCAGCTAATTTTTTTTGG - Intronic
1025974070 7:66355746-66355768 CACACCCAGCTAATTTTTTTTGG - Intronic
1026182041 7:68050085-68050107 CATGCCCACTTAATTTTTTGGGG - Intergenic
1026656911 7:72264656-72264678 CACACCCAGCTGATTTTTTGTGG + Intronic
1026724253 7:72858307-72858329 CACGCCCAGCTAACTTTTGTAGG - Intergenic
1026760723 7:73123912-73123934 CACGTCCAGCTAATTTTTGTGGG + Intergenic
1026814233 7:73497084-73497106 CACACCCAGCTAATTTTTGTAGG - Intronic
1026840210 7:73666583-73666605 CACGCCCGGCTAATTTTTGTTGG + Intergenic
1027037067 7:74932707-74932729 CACGTCCAGCTAATTTTTGTGGG + Intergenic
1027086497 7:75268740-75268762 CACGTCCAGCTAATTTTTGTGGG - Intergenic
1027148684 7:75716808-75716830 CACGCCCAGCTTTTTTTTAGGGG + Intronic
1027260412 7:76460985-76461007 CACGCCCGGCTAGTTTTTTTTGG + Intergenic
1027646685 7:80810100-80810122 CTCGCCCACGTATTTTTTTGTGG - Intronic
1027787586 7:82599500-82599522 CACGCCCGGCTAATTTTTTTTGG + Intergenic
1027873415 7:83739296-83739318 CACGCCCGGCTAATATTTTCTGG - Intergenic
1028548908 7:92034655-92034677 CACACCCAGCTAATTTTTGTGGG + Intronic
1029030154 7:97458622-97458644 CATGCCCAGCTAACTTTTTGTGG - Intergenic
1029390086 7:100269249-100269271 CACGCCTGGCTAATTTTGTGTGG - Intronic
1029392798 7:100286755-100286777 CACGTCCAGCTAATTTTTGTGGG - Intergenic
1029453967 7:100658037-100658059 TATGCCCATCTACTTGTTTGGGG + Intergenic
1029481361 7:100815164-100815186 CATGCCCAGCTAATTTTTTTTGG - Intronic
1029589941 7:101500662-101500684 CACGCCCAGCTAATTTTTGTGGG - Intronic
1029591792 7:101511834-101511856 CATGCCCAGCTAATTTTGGGGGG - Intronic
1029691572 7:102185574-102185596 CACACCCAGCTAATGTTTTGGGG + Intronic
1029715435 7:102322898-102322920 CACGCCTAGCTAATTTTTTTTGG + Intergenic
1030071654 7:105703145-105703167 CACGCCCAGCTAATTTTTTGGGG - Intronic
1030090467 7:105853605-105853627 CACGCCCAGCTCATTTTTGTGGG - Intronic
1030224845 7:107138838-107138860 CATGCCCAGCTTATTTTTTTTGG + Intronic
1030564618 7:111137979-111138001 CACACCCAGCTAATTTTTGTGGG + Intronic
1031443754 7:121825734-121825756 CACACCCGGCTAATTTTTTTTGG + Intergenic
1032111411 7:129079065-129079087 CACACACAGCTAATTTTTTAAGG - Intergenic
1032201049 7:129823304-129823326 CATGCCCAGGTAATTATTTGGGG - Intergenic
1032376822 7:131428012-131428034 CATGCCCAGCTAACTTTTTTTGG - Intronic
1032905660 7:136361524-136361546 CACACCTGGCTAATTTTTTGTGG + Intergenic
1033105713 7:138520531-138520553 TTTGCCCAGCTAATTTTTTGTGG - Intronic
1033373767 7:140736891-140736913 CACACCCAGCTAATTTCTTGTGG - Intronic
1033556052 7:142489289-142489311 CACACCCAGCTAATTCTTTTTGG + Intergenic
1033714380 7:143984646-143984668 CGCGCCCAGCTAATTTTTAGTGG - Intergenic
1033928086 7:146488783-146488805 CACGCCTGGCTAGTTTTTTGTGG + Intronic
1034458206 7:151183243-151183265 CATTCCCAGCTAATTTTTTGTGG - Intronic
1034512841 7:151550323-151550345 CATGCCCAGCTAATTTAATGTGG - Intergenic
1034614014 7:152398981-152399003 CAAGCCCAGCTAATTTTTGTGGG + Intronic
1035160859 7:156949349-156949371 CACGCTCAGCTAATTTTTGTAGG + Intergenic
1035215065 7:157359660-157359682 CACACCCAACTATTTTTTTTTGG - Intronic
1035450138 7:158972682-158972704 CACGCCCAGCTAATTTTTTGTGG + Intergenic
1035848639 8:2891777-2891799 CACGCCCAGCTAATTTTTGTAGG + Intergenic
1036144619 8:6243516-6243538 CATACCCAGCTAATTTTCTGTGG - Intergenic
1036164830 8:6422843-6422865 CACGCCCGGCTAATTTTTTGTGG + Intronic
1036615551 8:10384843-10384865 AACACCCAGCTAATTTTTTTTGG - Intronic
1037297761 8:17419118-17419140 CACGTCTATCAAATTCTTTGAGG + Intergenic
1037894872 8:22645323-22645345 CACGCCCGGCTAATTTTTGGTGG - Intronic
1037959758 8:23087608-23087630 CACGCCTAGCTAATTTTTGTAGG - Intronic
1037971117 8:23172647-23172669 CACGCCCGGCTAATTTTTTATGG - Intergenic
1038272376 8:26085804-26085826 CATGCCCAGCTAATTTTTGTGGG - Intergenic
1038563975 8:28604333-28604355 CACGCCAAGCTAATTTTTATGGG + Intronic
1039853400 8:41391780-41391802 CAAGCCCAGCTAATTTTTTTTGG - Intergenic
1039865419 8:41496962-41496984 CATGCCCGGCTAATTTTTTTTGG + Intronic
1040030154 8:42816467-42816489 CATGCCTAGCTAATTTTTTTGGG - Intergenic
1040917734 8:52580701-52580723 CATGCCCAGCTAATTTTTAGTGG - Intergenic
1041061519 8:54039401-54039423 CACGCCCGGCTAATATTTTGTGG + Intergenic
1041492250 8:58446951-58446973 CATGCCCAGCTAATTTTTTCTGG + Intronic
1042532384 8:69829519-69829541 CGTGCCCAGCTAATTTTTTGTGG - Intronic
1042717506 8:71790546-71790568 CACACCCCGCTAATTTTTTGTGG - Intergenic
1042905194 8:73765501-73765523 CATGCCCAGCTAATTTTTGTGGG + Intronic
1043503507 8:80879391-80879413 CACGCTCAGCTAGTTTTTGGGGG + Intergenic
1043525073 8:81087705-81087727 CAAGCCCAGCTAATGTTTCGGGG + Intronic
1044212900 8:89571545-89571567 CACGCCCGGCTAATTTTTGGTGG + Intergenic
1044321858 8:90811102-90811124 CATGCCCGGCTAATTTTTTGGGG + Intronic
1045018068 8:98016214-98016236 CACACCAGGCTAATTTTTTGTGG - Intronic
1045220073 8:100190154-100190176 CACATCCAGCTAATTTTTTTTGG - Intronic
1046477456 8:114765400-114765422 CATGCCCAGCTAATTATTTTTGG - Intergenic
1046534285 8:115488516-115488538 CACGCCCAGCTAATTTTTTGGGG - Intronic
1047395316 8:124492478-124492500 CACACCCAGCCAATTTTTTGGGG - Intronic
1047702941 8:127468492-127468514 CACTCCCAGCTAATTTTTGTTGG - Intergenic
1047791622 8:128209519-128209541 CATGCCCAGCTAATTTTTTTTGG + Intergenic
1048338547 8:133521288-133521310 CACACCCAGCTAATTTTTGGGGG + Intronic
1048652794 8:136498011-136498033 CACACCCAGCTAAATTTTTAGGG - Intergenic
1048754948 8:137728155-137728177 CACGCCAGACTAATTTTTTTTGG + Intergenic
1048777540 8:137963965-137963987 CACGCCCAGCTAATTTTTTGTGG - Intergenic
1049108829 8:140630110-140630132 CACGCCCATCAGATTTTCTGAGG + Intronic
1049430507 8:142560994-142561016 CCTGCCCAACTAATTTTTTAAGG + Intergenic
1050590050 9:7151160-7151182 GAAGGCCATCTAGTTTTTTGTGG - Intergenic
1051423706 9:16913995-16914017 CATGCCAGGCTAATTTTTTGTGG + Intergenic
1051495526 9:17718569-17718591 CATGCCCAGCTAATTTTTGTGGG - Intronic
1051627661 9:19113728-19113750 CATGCCCAGCTAATTTTTGTGGG + Intronic
1051641442 9:19228551-19228573 CACACCCCACTAATTTTTTGGGG - Intergenic
1051887355 9:21907399-21907421 CATGCCCAGCTAATTTTTGTAGG - Intronic
1052531438 9:29689503-29689525 CATGCCCAGCTAATTTTCTGGGG + Intergenic
1052728011 9:32253251-32253273 CATGCCCGGCTAATTTTTTTTGG - Intergenic
1053119156 9:35532587-35532609 CACACCCAGCTATATTTTTGTGG - Intronic
1053194361 9:36104491-36104513 CACGCCCAGCTAAATTTGAGGGG + Intronic
1053334566 9:37254469-37254491 CACTCTCATCTTTTTTTTTGTGG - Intronic
1053345125 9:37372429-37372451 CACTCCCATCAAATGTTTTACGG + Intergenic
1053394148 9:37757238-37757260 CATGCTCATCTAATTCTTTGTGG + Intronic
1053444239 9:38139452-38139474 CATGACTAGCTAATTTTTTGTGG + Intergenic
1053611337 9:39716135-39716157 CACACCCGGCTAATTTTTTTAGG + Intergenic
1054086917 9:60755025-60755047 CACACCCGGCTAATTTTTTTAGG - Intergenic
1054242183 9:62626257-62626279 CACACCCGGCTAATTTTTTTAGG - Intergenic
1054556308 9:66660773-66660795 CACACCCAGCTAATTTTTTTAGG - Intergenic
1054751486 9:68911724-68911746 CACACCTGACTAATTTTTTGTGG - Intronic
1054781163 9:69167082-69167104 CACGCCCAGCTAATTTTTCTGGG - Intronic
1054849146 9:69828524-69828546 CACACCCGGCTAATTTTTGGTGG - Intronic
1055018127 9:71641175-71641197 CACACCCAGCTAATTTTTGTAGG - Intergenic
1055219499 9:73911196-73911218 CATGCCAAGCTAATTTTTTGGGG - Intergenic
1055279660 9:74659645-74659667 CACACCTGGCTAATTTTTTGTGG + Intronic
1057596887 9:96422199-96422221 CATGCCCAGCTAATTGTTTTTGG - Intergenic
1058138434 9:101333621-101333643 CAAGCCCAGCTAATTTTTTTTGG - Intergenic
1058454076 9:105123159-105123181 CACACCCAGCTAATTTTTGGTGG - Intergenic
1058987300 9:110220203-110220225 CACACCCAGCTAATTTTTTGTGG - Intergenic
1059298771 9:113296436-113296458 CACGCCCAGCTAATCTTTGCTGG + Intergenic
1059914700 9:119085971-119085993 CACACCCAGCTAATTTTTGTGGG - Intergenic
1060460204 9:123845511-123845533 CACACCCACTTAATTTTTTGGGG - Intronic
1060734210 9:126055986-126056008 CACGACCTGCTAGTTTTTTGTGG - Intergenic
1061096852 9:128462754-128462776 CATGCCCGGCTAATTTTTTATGG + Intronic
1061562312 9:131413530-131413552 CACACCCAGCTAATTTTTAGTGG + Intronic
1061616942 9:131786620-131786642 CATGCCTAGCTAATTTTTTGTGG + Intergenic
1061687296 9:132291869-132291891 CAGGCCCCTCTACTTTCTTGTGG - Intronic
1061870819 9:133519401-133519423 GACACCCACCGAATTTTTTGTGG - Intronic
1185987519 X:4852420-4852442 CACGCCCGGCTAACTTTTTCAGG + Intergenic
1186821400 X:13291503-13291525 CACGCCCGGCCAAGTTTTTGAGG - Intergenic
1187009749 X:15267255-15267277 CACGCCTGGCTAATTTTTTGGGG - Intronic
1187138263 X:16569442-16569464 CATGCTCAGCTAATTTTTTAAGG - Intergenic
1187153522 X:16703179-16703201 CACGCCCTGCTAATTTTTGTGGG + Intronic
1187523727 X:20035754-20035776 CACACCCACCTAATTTTTTGTGG - Intronic
1188117874 X:26267430-26267452 CACACCCAGCTAATTGTTTTTGG - Intergenic
1188536463 X:31202026-31202048 CATGCCTGGCTAATTTTTTGTGG - Intronic
1189275476 X:39782130-39782152 CAAGCCCAGCTAATGTTTTTTGG + Intergenic
1189349429 X:40265888-40265910 CACGCCCAGCTAAATTTTTTTGG - Intergenic
1189911869 X:45818120-45818142 CATGCCCACCTGATTTTTTTAGG - Intergenic
1190053151 X:47166623-47166645 CATGCCCAACTAATATGTTGTGG + Intronic
1190158819 X:48015862-48015884 CACACCCAGCTAATATTTTCTGG - Intronic
1190170632 X:48109184-48109206 CACCCCCAGCTAATTTTTTTTGG + Intergenic
1190174518 X:48138141-48138163 CACACCCAGCTAATATTTTCTGG - Intergenic
1190196991 X:48328405-48328427 CACGCCCCGCTGATTTTTTTAGG + Intergenic
1190663724 X:52678784-52678806 CACGCCCCACTGATTTTTTTAGG + Intronic
1190675699 X:52779638-52779660 CACGCCCCACTGATTTTTTTAGG - Intronic
1191603378 X:63034661-63034683 TACACCCAGCTAATTTTTTTTGG - Intergenic
1191862026 X:65673609-65673631 CATGCCCAGCTAATTTTGTATGG + Intronic
1193107894 X:77699288-77699310 CACACCTGGCTAATTTTTTGTGG + Intronic
1193529457 X:82638796-82638818 CACACCTGGCTAATTTTTTGGGG + Intergenic
1193730563 X:85097492-85097514 CATGCCCAGCTAATTTTTTAAGG + Intronic
1193913861 X:87341380-87341402 CATGCCCAGCTAATATTTTTGGG - Intergenic
1195091494 X:101463908-101463930 CATGCCCGGCTAATTTTTTTTGG + Intronic
1195132585 X:101868455-101868477 CATGCCCAGCTAATTTTCTGGGG + Intergenic
1195196401 X:102501535-102501557 CATACCCAGCTAATTTTTTGTGG + Intergenic
1196278132 X:113792667-113792689 CTCGCTCATGTAATTATTTGTGG + Intergenic
1196789793 X:119453688-119453710 CACACCTAGCTAATTTTTTGGGG + Exonic
1196908263 X:120460114-120460136 CAAGCCCAGCAAATTTTTAGTGG - Intronic
1197305308 X:124834326-124834348 CACGCCCGGCTAATTTTTGTAGG + Intronic
1197859579 X:130956238-130956260 CACGCCCGGCTAATTTTTTGTGG - Intergenic
1197932476 X:131710122-131710144 CGTGCCCAGCTAATTTTGTGGGG + Intergenic
1198207204 X:134478260-134478282 CACACCCATCTATTTTTTTTTGG + Intronic
1198462457 X:136876862-136876884 CACACCCAGCTAATTTTTGGTGG + Intronic
1199225000 X:145363058-145363080 CACGCCCAACTAATTTTTTGTGG + Intergenic
1199374073 X:147087007-147087029 CTCGCCCATTTACTTGTTTGAGG + Intergenic
1199756278 X:150867923-150867945 CACGCCCAGCTAATTTTTGTAGG - Intronic
1199876421 X:151932388-151932410 CACGCCTAGCTAATTTTGTTTGG + Intergenic
1200780546 Y:7211536-7211558 CAGGCCTGGCTAATTTTTTGTGG - Intergenic
1201055488 Y:9985979-9986001 CACGCCCGGCTAATTTTTTTTGG + Intergenic
1201497194 Y:14601256-14601278 CTCGCCCACCTAATTTTTGGTGG + Intronic
1201587924 Y:15581786-15581808 CATGCCCAGCTAATTTTTTTAGG + Intergenic