ID: 999062064

View in Genome Browser
Species Human (GRCh38)
Location 5:148646638-148646660
Sequence ATGGGCCCCTCTAAAATCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 74}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999062064_999062067 -5 Left 999062064 5:148646638-148646660 CCATAGATTTTAGAGGGGCCCAT 0: 1
1: 0
2: 0
3: 13
4: 74
Right 999062067 5:148646656-148646678 CCCATTTAACACAGAAGAAAGGG 0: 1
1: 0
2: 3
3: 43
4: 413
999062064_999062074 27 Left 999062064 5:148646638-148646660 CCATAGATTTTAGAGGGGCCCAT 0: 1
1: 0
2: 0
3: 13
4: 74
Right 999062074 5:148646688-148646710 AAGAAGCAGAAGGAAAGCAATGG 0: 1
1: 2
2: 16
3: 199
4: 1997
999062064_999062072 17 Left 999062064 5:148646638-148646660 CCATAGATTTTAGAGGGGCCCAT 0: 1
1: 0
2: 0
3: 13
4: 74
Right 999062072 5:148646678-148646700 GATCCTGGGGAAGAAGCAGAAGG 0: 1
1: 0
2: 6
3: 51
4: 460
999062064_999062069 2 Left 999062064 5:148646638-148646660 CCATAGATTTTAGAGGGGCCCAT 0: 1
1: 0
2: 0
3: 13
4: 74
Right 999062069 5:148646663-148646685 AACACAGAAGAAAGGGATCCTGG 0: 1
1: 0
2: 3
3: 37
4: 328
999062064_999062065 -6 Left 999062064 5:148646638-148646660 CCATAGATTTTAGAGGGGCCCAT 0: 1
1: 0
2: 0
3: 13
4: 74
Right 999062065 5:148646655-148646677 GCCCATTTAACACAGAAGAAAGG 0: 1
1: 0
2: 1
3: 20
4: 187
999062064_999062071 4 Left 999062064 5:148646638-148646660 CCATAGATTTTAGAGGGGCCCAT 0: 1
1: 0
2: 0
3: 13
4: 74
Right 999062071 5:148646665-148646687 CACAGAAGAAAGGGATCCTGGGG 0: 1
1: 0
2: 0
3: 29
4: 360
999062064_999062070 3 Left 999062064 5:148646638-148646660 CCATAGATTTTAGAGGGGCCCAT 0: 1
1: 0
2: 0
3: 13
4: 74
Right 999062070 5:148646664-148646686 ACACAGAAGAAAGGGATCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999062064 Original CRISPR ATGGGCCCCTCTAAAATCTA TGG (reversed) Intronic
907345627 1:53776967-53776989 TTGGGCCCTTTTAAAATCTAAGG - Intronic
907564600 1:55423018-55423040 AAGAGCCCCTCTAGAATCTAAGG - Intergenic
911546011 1:99217805-99217827 ATGGGCCCTCCCAAAATCTGAGG + Intergenic
916947140 1:169740252-169740274 AGGGGCTCTTCTAAAATCCAGGG - Intronic
919941327 1:202288546-202288568 ATTGGACCGTCTAACATCTAAGG + Intronic
921045531 1:211474548-211474570 ATAGGCCTCTCTAGAATCCAAGG - Intergenic
1067823047 10:49547715-49547737 ATAGATCCCTCTAAAATATAAGG - Intergenic
1070771240 10:79083570-79083592 ATGTGTCCCTCTAAGATCTCTGG + Intronic
1074348637 10:112713120-112713142 ATGGGTCCATCTCAAATCTAAGG - Intronic
1077190444 11:1253907-1253929 ATGGGGTCCCCCAAAATCTATGG - Intronic
1090371224 11:126254495-126254517 ATGTTCCCCTTTAAGATCTATGG - Intronic
1095403195 12:41838801-41838823 AAGGGAGCCTCTAAAATCTTGGG + Intergenic
1097885199 12:64721967-64721989 ATGGGCACCTGTAAAATGTATGG + Intronic
1098383997 12:69899378-69899400 ATAGGCCCCTCTAGAATCTCAGG - Intronic
1100659250 12:96678875-96678897 AAGCCCCCCTGTAAAATCTAAGG - Intronic
1101655685 12:106718022-106718044 ATGTGCACTTTTAAAATCTAAGG - Intronic
1105662105 13:22508032-22508054 ATGGGCTCCTCAAAATTCTAAGG + Intergenic
1108823544 13:54383162-54383184 ATTGGGCCCTCAAAATTCTATGG + Intergenic
1108926261 13:55750055-55750077 ATGGGCACTTCAGAAATCTATGG - Intergenic
1111778738 13:92694802-92694824 ATGCCCCCCTCTGAAATCTCAGG - Intronic
1119247230 14:73121786-73121808 AAGGGCCACTCTAAAAACAAGGG + Exonic
1120092308 14:80346603-80346625 TTGGGCCACTCTACAATCTTGGG - Intronic
1121708528 14:96019616-96019638 ATGGGCACCTCTACCATCTGTGG + Intergenic
1123634207 15:22287053-22287075 ATGGTGACCTCTAAAAGCTATGG - Intergenic
1125306807 15:38326724-38326746 AAGGGCCCCTCTTCAATCAAAGG - Intronic
1126639206 15:50807607-50807629 ATGTGTCCTTCTAAAATGTAGGG + Intergenic
1134837725 16:17376085-17376107 ATGGGCCCCTCTAAGCCCTAGGG - Intronic
1137936110 16:52637115-52637137 ATGGGCTCCCCAAAAATCTGAGG - Intergenic
1138860665 16:60751774-60751796 AAGGGCCCATATGAAATCTAAGG + Intergenic
1143198275 17:5093820-5093842 ATCGGCCCCTCTGGATTCTAAGG - Exonic
1146933351 17:36793579-36793601 AGGGGCCCTTCTCAAGTCTAGGG + Intergenic
1155852851 18:30794036-30794058 ATTGGCCCATCAAAATTCTAAGG + Intergenic
1157912996 18:51636907-51636929 AAGGGCCTCTCTTAAATCAAGGG - Intergenic
1164801792 19:31083205-31083227 ATGGGTGCCTCTAAATTCTGGGG + Intergenic
930218302 2:48719925-48719947 ATGGGCCCCTCTGTAAGCAAAGG - Intronic
933892533 2:86785122-86785144 ATGGGCCCCTCTGCAATGCAAGG + Exonic
935625002 2:105164675-105164697 ATGGACCAATCTGAAATCTAAGG - Intergenic
935974094 2:108560338-108560360 ATGGGTCTCTCTAAAGACTACGG - Intronic
942719834 2:178939188-178939210 ATGGGCCCCTTTTAAACGTAAGG - Intronic
943964666 2:194318698-194318720 ATGGGCACCTCTAATCTCTCTGG - Intergenic
947818621 2:233055098-233055120 ATCGGCCCCTCTCAAATCAAAGG - Intergenic
1169769578 20:9186430-9186452 AAGGGCCACTTTAACATCTATGG + Intronic
1177328414 21:19624298-19624320 ATGGGCCTATTTAAAATCTCAGG - Intergenic
1178355787 21:31909661-31909683 ATGGGCCCCTGTAAAAGACAGGG + Intronic
1178457932 21:32773027-32773049 ATGGGCCGATCTCCAATCTACGG - Intergenic
949131064 3:501863-501885 CTGGGCCCCTCTACCACCTAAGG + Intergenic
949949105 3:9214637-9214659 ATGAGCCCCTCTGAAATCCATGG + Intronic
955008000 3:54987737-54987759 ATGGGCTCCTTTAAAAGGTAAGG + Exonic
955617439 3:60824036-60824058 ATGGGCCACTCTAAGAACTTAGG + Intronic
957644642 3:82905405-82905427 TTGGACCCTTCAAAAATCTATGG + Intergenic
962014268 3:131424426-131424448 ATGGGGCCCTCTAAAGCCTAGGG - Intergenic
962830577 3:139135722-139135744 CTGGGCCCCACTAAAAGCTGTGG - Intronic
965869294 3:173247393-173247415 ATAGATCCCTCTAAAATCTAAGG - Intergenic
967815357 3:193793707-193793729 ATGGACCCCTAAAAATTCTAAGG - Intergenic
968136818 3:196225822-196225844 CTGGGCCCATCTCAGATCTATGG + Intronic
974210573 4:58769220-58769242 ATGTGTACCTCCAAAATCTAAGG - Intergenic
975063081 4:70027725-70027747 ATGGGCCCCTGAAAACTCCAGGG + Intergenic
977447052 4:97144220-97144242 ATGGGAGCATATAAAATCTAGGG + Intergenic
977728982 4:100329583-100329605 ATGAGTCTCTCTAAAATTTATGG + Intergenic
980525097 4:133979729-133979751 ATGTGACTGTCTAAAATCTATGG + Intergenic
981031045 4:140126250-140126272 AGGGGCCCCTCTTAAATGTGAGG + Intronic
981130260 4:141150593-141150615 ATAGGCCAATCTAAAATCTCTGG - Intronic
981759763 4:148181430-148181452 ATGATCCCCTCTATATTCTATGG + Intronic
982889700 4:160832240-160832262 ATAGGCCCCTTTAATATGTATGG + Intergenic
983542204 4:168923747-168923769 ATTGCCCCCTTTAAATTCTATGG + Intronic
984910783 4:184672629-184672651 CTGGACCCCTCTAAGATCTCTGG - Intronic
986058126 5:4159936-4159958 ACGGTCCCCTCTACAATGTAGGG + Intergenic
988490646 5:31702434-31702456 ATGGGCACCTTTAAAATAAAGGG - Intronic
990605177 5:57402138-57402160 ATGAGCTCTTCTAAATTCTAAGG + Intergenic
990833068 5:59982471-59982493 ATGTGCCCCTAGACAATCTAAGG - Intronic
997449939 5:133974486-133974508 AAGGGGCACTCTGAAATCTAGGG - Intronic
999062064 5:148646638-148646660 ATGGGCCCCTCTAAAATCTATGG - Intronic
999857047 5:155606229-155606251 ATGGGCCCATCTAAAATGGTAGG - Intergenic
999876621 5:155813731-155813753 ATGGACCCCTCTATAATCAAAGG - Intergenic
1003878539 6:10459792-10459814 ATGGGCACTTATGAAATCTAAGG + Intergenic
1008935934 6:56992365-56992387 ATGGGTCTCTCTAAAATAGAAGG - Exonic
1013628005 6:111956838-111956860 AACGGCACCTCTAAAATCTCAGG - Intergenic
1021996900 7:26187780-26187802 ATGGGCCCCTCTCCCATCAAGGG + Intergenic
1044475738 8:92624090-92624112 ATGGTCCCTTATAAAATGTAAGG + Intergenic
1051762869 9:20487589-20487611 ATGGACCCTTCTAAAATAGAGGG - Intronic
1054439954 9:65251668-65251690 ATGGGTCTCTTTAAGATCTAGGG + Intergenic
1058578171 9:106425720-106425742 GTGGGCCTCTCTACATTCTAGGG - Intergenic
1190627585 X:52351768-52351790 ATGGGACCATTTACAATCTAGGG + Intergenic
1191975875 X:66870294-66870316 ATGTGCCCATCTAAAATTTAGGG - Intergenic
1196893598 X:120311905-120311927 AAGGGCCACTCTATAATCAAAGG + Intergenic
1196906799 X:120444879-120444901 ATGGGCCCCACTGAACTCTGGGG + Intronic
1197760005 X:130021288-130021310 ATTGACCCCTCTGAAGTCTAAGG + Intronic
1200888594 Y:8298400-8298422 AGGGCCCCCTCCAAAATATAAGG - Intergenic