ID: 999062789

View in Genome Browser
Species Human (GRCh38)
Location 5:148654052-148654074
Sequence CCGCACATACCCGCTGCCAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 57}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999062773_999062789 24 Left 999062773 5:148654005-148654027 CCACCGGCACCCGTGGGCTCCTG 0: 1
1: 0
2: 7
3: 54
4: 276
Right 999062789 5:148654052-148654074 CCGCACATACCCGCTGCCAGAGG 0: 1
1: 0
2: 1
3: 7
4: 57
999062782_999062789 -3 Left 999062782 5:148654032-148654054 CCCGACCCCCGGCGCACTTGCCG 0: 1
1: 0
2: 1
3: 3
4: 80
Right 999062789 5:148654052-148654074 CCGCACATACCCGCTGCCAGAGG 0: 1
1: 0
2: 1
3: 7
4: 57
999062784_999062789 -8 Left 999062784 5:148654037-148654059 CCCCCGGCGCACTTGCCGCACAT 0: 1
1: 0
2: 0
3: 0
4: 14
Right 999062789 5:148654052-148654074 CCGCACATACCCGCTGCCAGAGG 0: 1
1: 0
2: 1
3: 7
4: 57
999062783_999062789 -4 Left 999062783 5:148654033-148654055 CCGACCCCCGGCGCACTTGCCGC 0: 1
1: 0
2: 2
3: 7
4: 93
Right 999062789 5:148654052-148654074 CCGCACATACCCGCTGCCAGAGG 0: 1
1: 0
2: 1
3: 7
4: 57
999062781_999062789 5 Left 999062781 5:148654024-148654046 CCTGGGGTCCCGACCCCCGGCGC 0: 1
1: 0
2: 2
3: 29
4: 391
Right 999062789 5:148654052-148654074 CCGCACATACCCGCTGCCAGAGG 0: 1
1: 0
2: 1
3: 7
4: 57
999062786_999062789 -10 Left 999062786 5:148654039-148654061 CCCGGCGCACTTGCCGCACATAC 0: 1
1: 0
2: 0
3: 2
4: 27
Right 999062789 5:148654052-148654074 CCGCACATACCCGCTGCCAGAGG 0: 1
1: 0
2: 1
3: 7
4: 57
999062772_999062789 25 Left 999062772 5:148654004-148654026 CCCACCGGCACCCGTGGGCTCCT 0: 1
1: 0
2: 0
3: 15
4: 131
Right 999062789 5:148654052-148654074 CCGCACATACCCGCTGCCAGAGG 0: 1
1: 0
2: 1
3: 7
4: 57
999062771_999062789 26 Left 999062771 5:148654003-148654025 CCCCACCGGCACCCGTGGGCTCC 0: 1
1: 0
2: 0
3: 19
4: 245
Right 999062789 5:148654052-148654074 CCGCACATACCCGCTGCCAGAGG 0: 1
1: 0
2: 1
3: 7
4: 57
999062779_999062789 14 Left 999062779 5:148654015-148654037 CCGTGGGCTCCTGGGGTCCCGAC 0: 1
1: 0
2: 1
3: 26
4: 252
Right 999062789 5:148654052-148654074 CCGCACATACCCGCTGCCAGAGG 0: 1
1: 0
2: 1
3: 7
4: 57
999062778_999062789 15 Left 999062778 5:148654014-148654036 CCCGTGGGCTCCTGGGGTCCCGA 0: 1
1: 0
2: 0
3: 21
4: 214
Right 999062789 5:148654052-148654074 CCGCACATACCCGCTGCCAGAGG 0: 1
1: 0
2: 1
3: 7
4: 57
999062776_999062789 21 Left 999062776 5:148654008-148654030 CCGGCACCCGTGGGCTCCTGGGG 0: 1
1: 0
2: 3
3: 73
4: 510
Right 999062789 5:148654052-148654074 CCGCACATACCCGCTGCCAGAGG 0: 1
1: 0
2: 1
3: 7
4: 57
999062785_999062789 -9 Left 999062785 5:148654038-148654060 CCCCGGCGCACTTGCCGCACATA 0: 1
1: 0
2: 0
3: 0
4: 17
Right 999062789 5:148654052-148654074 CCGCACATACCCGCTGCCAGAGG 0: 1
1: 0
2: 1
3: 7
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999062789 Original CRISPR CCGCACATACCCGCTGCCAG AGG Exonic
902635157 1:17730026-17730048 CCGCATTCCCCCGCTGCCAGTGG + Intergenic
902818086 1:18927389-18927411 CCCCACCTGCCCTCTGCCAGAGG - Intronic
904045466 1:27605694-27605716 CTGCACACACCCTCTGCCAAGGG - Intergenic
904738129 1:32650935-32650957 CCGCACACTCCCGCGGCAAGAGG - Intergenic
919936248 1:202252575-202252597 CAGCAACTACCTGCTGCCAGGGG + Intronic
920669356 1:207991440-207991462 TCACACACACCCTCTGCCAGGGG + Intergenic
1070584870 10:77756539-77756561 CAGCACAAACCCCCAGCCAGCGG + Intergenic
1087467414 11:98526142-98526164 CCGCACCAACCCACTGACAGTGG + Intergenic
1089648540 11:119896265-119896287 CCCCACATACCCTCTCCCAGTGG + Intergenic
1089700905 11:120243214-120243236 CCGCACATACCTGCTGATGGCGG - Intronic
1090430271 11:126640255-126640277 CCCCACATACCCACTGCCCATGG - Intronic
1090803879 11:130190535-130190557 CCGCTCATGCCCGCTGCCAGTGG + Exonic
1091353586 11:134916618-134916640 CCCCACGCACCTGCTGCCAGTGG + Intergenic
1096252124 12:50040150-50040172 CCGCCCCTACCCACCGCCAGAGG + Intergenic
1102124291 12:110468150-110468172 CCTCACCTTCCCGCTGCCCGCGG + Intronic
1102867414 12:116385046-116385068 CTGCACCTACCAGCTGCCAATGG - Intergenic
1111317211 13:86578223-86578245 CCACACCTACCTGCTGGCAGTGG - Intergenic
1115814040 14:37143376-37143398 CCACACATACCTGCTGTCACAGG + Intronic
1116862103 14:50003231-50003253 CCGCACTTGCCCGTTGCCATGGG - Intronic
1122342281 14:101036179-101036201 GCGCACATACCCTCTGCGAGGGG - Intergenic
1122858820 14:104573036-104573058 CCGCACACACCCAGGGCCAGAGG + Intronic
1128307049 15:66605518-66605540 CCGCAGTCACCAGCTGCCAGAGG - Intronic
1130970835 15:88730937-88730959 CTGCACATACCCCCTGCAACAGG + Intergenic
1132279160 15:100597740-100597762 CCCCACAAACCCGCCACCAGTGG + Intronic
1132546818 16:536997-537019 CCGCCCCGATCCGCTGCCAGAGG - Intronic
1132640821 16:977569-977591 GTGCACACACCGGCTGCCAGCGG + Intronic
1133525730 16:6603614-6603636 CTGCACATAGCGGCTGCCCGGGG - Intronic
1133950312 16:10385973-10385995 CCGCATATTCGCGCTGCCATTGG + Intronic
1135561322 16:23479113-23479135 GAGCACATACCTGCTGCCAAGGG - Intronic
1143223670 17:5282450-5282472 CCGCCCATCCCCGCTCCCCGAGG + Exonic
1145069072 17:19787860-19787882 CCACACACAGCTGCTGCCAGGGG - Intronic
1152400904 17:80065618-80065640 CCGCACATCCTCGCTGCCTGTGG - Intronic
1162329949 19:10021628-10021650 TCGCACATACAGGCTGCCAGAGG - Exonic
1163464038 19:17455784-17455806 CCGCAACTTCCAGCTGCCAGAGG - Exonic
1165307580 19:35011811-35011833 CCACACTCCCCCGCTGCCAGTGG - Intronic
925126541 2:1461234-1461256 CCCCACACACCCGCCCCCAGAGG + Intronic
932491924 2:72127916-72127938 CCGCACATGCCCACTCCAAGGGG - Intergenic
943589892 2:189784375-189784397 CCGGACAGACTCGCTGCCAGCGG + Exonic
946542753 2:220703423-220703445 CCACACATACCTTCTGCCATTGG + Intergenic
1173732403 20:45337973-45337995 CCGCACATAGCCCGTGCCTGTGG + Intronic
1180241764 21:46512403-46512425 CCTCACATACTCACTGCCTGTGG - Intronic
1181786652 22:25231891-25231913 ACACACACACCAGCTGCCAGGGG - Intergenic
1181818816 22:25459703-25459725 ACACACACACCAGCTGCCAGGGG - Intergenic
1184217209 22:43075785-43075807 CTGGACATGCCCGATGCCAGAGG - Intronic
952919700 3:38276131-38276153 CCTCACCCACCGGCTGCCAGGGG + Intronic
955996698 3:64686358-64686380 GCGCACACACCCGCCCCCAGGGG - Intronic
969503636 4:7570372-7570394 CCTCCCACTCCCGCTGCCAGAGG + Intronic
981943673 4:150315579-150315601 CCAGCCATACCAGCTGCCAGTGG - Exonic
982353501 4:154442613-154442635 CCCCACATCCCTACTGCCAGTGG + Intronic
982840296 4:160175448-160175470 TCACACATACCCGCAGCCAAAGG - Intergenic
983583552 4:169333064-169333086 CCTCACATACCAACTCCCAGTGG + Intergenic
988029121 5:25739475-25739497 CATAACATACCAGCTGCCAGGGG + Intergenic
989411723 5:41127056-41127078 CCTCCCAAACACGCTGCCAGAGG + Intergenic
992124376 5:73626054-73626076 CCGCGCCTCCCCGCTGCCACTGG - Intergenic
998192815 5:140042114-140042136 CCGCAGATCCCCGCTGGCACAGG + Intronic
999062789 5:148654052-148654074 CCGCACATACCCGCTGCCAGAGG + Exonic
1006313680 6:33278204-33278226 CAGCACATACCCCGTGCCTGAGG - Exonic
1006939655 6:37743440-37743462 CCGGACACAGCCGATGCCAGAGG + Intergenic
1013013180 6:106137986-106138008 CACCACAGACCCTCTGCCAGTGG + Intergenic
1014756536 6:125307584-125307606 CATCACATAGCAGCTGCCAGAGG - Intergenic
1016450708 6:144179535-144179557 CCACACATCCCCGCTACCAGAGG - Intronic
1019135550 6:169905537-169905559 CAGCACAGACCCGATGCCAGGGG - Intergenic
1026644794 7:72158281-72158303 CCCCACATTGCTGCTGCCAGGGG - Intronic
1027250139 7:76393724-76393746 GCGCACAGGCCCGCGGCCAGAGG + Intronic
1048060075 8:130909857-130909879 CCGCACATACCTGTTGACATAGG + Exonic
1062098768 9:134717117-134717139 CCCCCCATTCCAGCTGCCAGGGG - Intronic