ID: 999068677

View in Genome Browser
Species Human (GRCh38)
Location 5:148718850-148718872
Sequence GTTTCTATTCTGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999068677_999068680 -9 Left 999068677 5:148718850-148718872 CCTTCCTCCTTCAGAATAGAAAC No data
Right 999068680 5:148718864-148718886 AATAGAAACCTAGTTTTGTCAGG No data
999068677_999068681 -8 Left 999068677 5:148718850-148718872 CCTTCCTCCTTCAGAATAGAAAC No data
Right 999068681 5:148718865-148718887 ATAGAAACCTAGTTTTGTCAGGG No data
999068677_999068683 -1 Left 999068677 5:148718850-148718872 CCTTCCTCCTTCAGAATAGAAAC No data
Right 999068683 5:148718872-148718894 CCTAGTTTTGTCAGGGATATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999068677 Original CRISPR GTTTCTATTCTGAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr