ID: 999069048

View in Genome Browser
Species Human (GRCh38)
Location 5:148724145-148724167
Sequence GAAGCATCCTAGGCCCGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999069040_999069048 26 Left 999069040 5:148724096-148724118 CCTGGGGCCAGGAAGATAGGAAA No data
Right 999069048 5:148724145-148724167 GAAGCATCCTAGGCCCGGTGAGG No data
999069041_999069048 19 Left 999069041 5:148724103-148724125 CCAGGAAGATAGGAAATGTAAGG No data
Right 999069048 5:148724145-148724167 GAAGCATCCTAGGCCCGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999069048 Original CRISPR GAAGCATCCTAGGCCCGGTG AGG Intergenic
No off target data available for this crispr